Genetic characterisation of Echinocephalus spp. (Nematoda: Gnathostomatidae) from marine hosts in Australia.

We genetically characterised larval and adult specimens of species of Echinocephalus Molin, 1858 (Gnathostomatidae) collected from various hosts found within Australian waters. Adult specimens of Echinocephalus were collected from a dasyatid stingray [Pastinachus ater (Macleay); n = 2] from Moreton Bay, Queensland and larvae from a hydrophiine sea snake [Hydrophis peronii (Duméril); n = 3] from Cape York Peninsula, Queensland, from an octopus (Octopus djinda Amor & Hart; n = 3) from Fremantle, Western Australia and from a lucinid bivalve [Codakia paytenorum (Iredale); n = 5] from Heron Island, Queensland Australia. All nematode samples were identified morphologically and genetically characterised using the small subunit nuclear ribosomal DNA (SSU). Some morphological differences were identified between previous studies of Echinocephalus spp. and those observed herein but the significance of these differences remains unresolved. Molecular phylogenetic analyses revealed that larval Echinocephalus sp. from H. peronii and C. paytenorum in Australia were very similar (with strong nodal support) to larval Echinocephalus sp. infecting two fish species from Egypt, Saurida undosquamis (Richardson) (Synodontidae) and Pagrus pagrus (Linnaeus) (Sparidae). The SSU sequences of larval Echinocephalus sp. from O. djinda and adults from P. ater formed a well-supported clade with that of adult E. overstreeti Deardorff and Ko, 1983 from the Port Jackson shark, Heterodontus portusjacksoni (Meyer), as well as that of the larval Echinocephalus sp., from the common carp (Cyprinus carpio Linnaeus) from Egypt. This study extends the intermediate host range of Echinocephalus larvae by including a sea snake for the first time. Findings of this study highlight the importance of genetic characterisation of larval and adult specimens of Echinocephalus spp. to resolve the current difficulties in the taxonomy of this genus.

Introduction

The taxonomy of nematodes of the gnathostomatid genus Echinocephalus Molin, 1858 was recently reviewed. Currently, Echinocephalus contains 12 recognised valid species and 10 poorly described species, considered to be invalid by Moravec and Justine (2021). In the past, identification and characterisation of new species of Echinocephalus was based on inadequate morphological descriptions often from larval forms (Moravec and Justine, 2021). Elasmobranchs are currently the only recognised definitive hosts, primarily rays but also some sharks, and teleost fishes and a few marine invertebrates thought to only be paratenic or second intermediate hosts (Moravec and Justine, 2021). Importantly, Moravec and Justine (2021) emphasised that identification of larval stages to species level was not currently possible.

The identification and taxonomy of Echinocephalus in the past has been based on morphological features. This has led to some poorly described species that have confused taxonomy within the genus and may have potentially led to misidentification of new species of parasites (Moravec and Justine, 2021; van Megen et al., 2009). Modern technological methods such as molecular techniques, such as DNA sequence data, have now been developed to enable the definition and identification of genetic markers which can lead to the accurate identification of species (Morrison, 2006; van Megen et al., 2009).

This study aimed to genetically characterise larval and adult specimens of species of Echinocephalus collected from various hosts found within Australian waters, and provides taxonomic comments on the genus Echinocephalus.

Materials and methods

Collection of specimens

Adult specimens of Echinocephalus were collected from a dasyatid stingray [Pastinachus ater (Macleay); n = 2] from Moreton Bay, Queensland. Larval specimens were collected from a hydrophiine sea snake [Hydrophis peronii (Duméril); n = 3] from Cape York Peninsula, Queensland, from an octopus (Octopus djinda Amor & Hart; n = 3) from Fremantle, Western Australia and from a lucinid bivalve [Codakia paytenorum (Iredale); n = 5] from Heron Island, Queensland Australia. Specimens were collected under the state-issued permits, including Queensland (Queensland Marine Parks permit number: G19/42323.1) and Western Australia (Murdoch Animal Ethics – Cadaver and/or Tissue Notification, Permit No. 744).

Morphological identification of nematodes

Adult nematodes and samples from each group of larvae were cleared in lactophenol. Adults were identified following Moravec and Justine (2021). For representatives of larvae from octopuses and molluscs, the cephalic extremities were excised with a scalpel and viewed as apical preparations, with the distribution of papillae examined following Moravec and Justine (2006). This was not possible for the larvae from the sea snake as they had been fixed within the fibrous host capsule. The specimens have been deposited in the Australian Helminthological Collection (AHC) of the South Australian Museum, Adelaide (SAM) (hologenophores 49120, 49122, 49124; paragenophores 49121, 49123, 49125-6).

Molecular characterisation of nematodes

Genomic DNA (gDNA) was isolated from the mid-sections of nematode specimens using the DNeasy Blood and Tissue Kit (Qiagen, Germany) following the manufacturers’ protocols. The concentration and purity of each DNA sample were determined spectrophotometrically (ND-1000 UV-VIS spectrophotometer v.3.2.1; NanoDrop Technologies, Inc., Wilmington, DE, USA).

The partial small subunit nuclear ribosomal DNA (SSU) region within the rDNA was amplified by Polymerase Chain Reaction (PCR) using the primers SSU F04 (GCTTGTCTCAAAGATTAAGCC) and SSU R26 (CATTC TTGGCAAATGCTTTCG) (Blaxter et al., 1998) in a T100 thermal cycler (BioRad, Hercules, CA, USA). PCR amplifications (initial denaturation at 94 °C for 5 min followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 53 °C for 30 s and extension at 72 °C for 40 s, and a final extension at 72 °C for 5 min) were carried out in a final reaction volume of 50 μL, containing 3.12 mM of each deoxynucleotide triphosphate (dNTP), 12.5 pmol of each primer, and 10 mM Tris-HCl (pH 8.4), 7.5 mM MgCl2 and 0.62 U of GoTaq Flexi DNA polymerase (Promega, Madison, USA). Known positive (genomic DNA of Haemonchus contortus and Echinocephalus spp.) and negative (Milli-Q H2O) controls were included in each PCR run. Aliquots (5 μL) of individual amplicons were analysed on 1.5% (w/v) agarose gel in Tris-Borate-EDTA buffer stained with GelRed (Biotium) and visualised using a GelDoc system (BioRad, Hercules, CA, USA).

Amplicons were purified using shrimp alkaline phosphate and exonuclease I (ThermoFisher Scientific, Australia) before automated Sanger DNA sequencing using the PCR primers in separate reactions. The quality of the sequences was assessed using the Geneious Prime 2021.1.1 software (Biomatters Ltd., Auckland, New Zealand; www.geneious.com). The DNA sequences determined herein have been submitted to the GenBank database under the accession numbers OL415832- OL415835.

Published SSU sequences of Echinocehalus spp. were obtained from GenBank (Table 1) and aligned with new SSU data using MUSCLE in Mesquite v.3.61 (http://www.mesquiteproject.org) using default settings and were trimmed to uniform lengths of 783 bp. The evolutionary model (K2+I) of the DNA sequence dataset was determined using the Akaike and the Bayesian information criteria (AIC and BIC) tests in jModelTest v.2.1.5 (Darriba et al., 2012). Neighbour Joining (NJ) trees were constructed using MEGA 11 (Tamura et al., 2021), and Bayesian Inference (BI) trees were built using MrBayes software (Huelsenbeck and Ronquist, 2001). The NJ trees were constructed with 10,000 bootstrap replicates using the Kimura 2-parameter distance method. The BI analysis was run for 20,000,000 generations (ngen = 20,000,000) to calculate posterior probabilities (pp), with two runs, with every 200th tree saved (samplefreq = 200). The SSU sequence of Gnathostoma lamothei was used as an outgroup. Tree topology was checked for consensus between NJ and BI analyses.

Table 1

Details of small subunit nuclear ribosomal DNA sequences of Echinocephalus spp. included in the molecular analyses.

Parasite	Developmental stage	Host (scientific name)	Location	GenBank accession number	Reference
Echinocephalus sp.	Larvae	Octopus djinda	Western Australia	OL415832	This study
Echinocephalus sp.	Adults	Pastinachus ater (Macleay)	Morton Bay, Queensland, Australia	OL415833	This study
Echinocephalus sp.	Larvae	Codakia paytenorum (Iredale)	Heron Island, Queensland, Australia	OL415834	This study
Echinocephalus sp.	Larvae	Hydrophis peronii (Duméril)	Weipa, Queensland, Australia	OL415835	This study
Echinocephalus overstreeti	Adult	Heterodontus portusjacksoni (Meyer)	South Australia	JF934729	(Laetsch et al., 2012)
Echinocephalus sp. 2	Larvae	Saurida undosquamis (Richardson)	Egypt	KY972321	GenBank
Echinocephalus sp. 1	Larvae	Pagrus pagrus (Linnaeus)	Egypt	KY911549	BenBank
Echinocephalus sp.a	Larvae	Cyprinus carpio Linnaeus	Egypt	KC493258	Abdel-Ghaffar et al. (2013)
Echinocephalus pseudouncinatus	Larvae	Atrina maura (Sowerby I)	Mexico	MN514178	Gómez-Valdez et al. (2019)

Identified as Echinocephalus sp. in GenBank but reported as E. carpiae in the publication; ^ formerly Octopus aff. O. tetricus.

Results and discussion

All of the larval stages examined conformed to earlier descriptions of this genus from Australia (e.g. Beveridge, 1987; Shamsi et al., 2021) with six rows of hooks on the cephalic inflation (Fig. 1A), two lips and clusters of tiny, spiniform papillae dorsally and ventrally (Fig. 1B and C) (Moravec and Justine, 2006). Moravec and Justine (2006) drew attention to differences in the spiniform papillae from the larvae of E. overstreeti Deardorff and Ko, 1983 they described from the type host, Taeniurops meyeni (Müller & Henle) as Taeniura melanospila, in the Pacific Ocean and the specimens described from scallops from South Australian Gulfs by Beveridge (1987). They noted that in E. overstreeti from the type host, the third row of papillae consisted of five papillae with two outlying areas of sclerotization lacking spines (Moravec and Justine, 2006, Fig. 7c) compared with the redescription of the species by Beveridge (1987, Fig. 25), in which the third and outer row consisted of three spiniform papillae. In all of the current larval specimens, only three spiniform papillae were present in the outer row, although in the specimens from C. paytenorum, they were joined by irregular areas of sclerotization, not seen in the specimens from O. djinda. The significance of these differences along with those noted by Moravec and Justine (2006) remains unresolved.

Fig. 1

A, Anterior end of Echinocephalus larva from Octopus djinda (formerly Octopus O. aff. tetricus), showing six rows of hooks on the cephalic inflation; B, Apical view of the spiniform papillae on the larva from O. djinda, showing a posterior row of three papillae; C, Apical view of the spiniform papillae on the larva from Codakia paytenorum, showing posterior row of three papillae joined by irregular areas of sclerotization. Scale bars: Fig. 1A and 40 μm; Fig. 1B and C, 10 μm.

The pairwise comparison of each of the SSU DNA sequences between the new larval specimens and the reference sequences in GenBank ranged from 0 to 6.6% (Table 2; Supplementary Fig. S1). Echinocephalus sp. from O. djinda and E. overstreeti, from Heterodontus portusjacksoni (Meyer) from South Australia (GenBank no. OL415832- OL415835) were identical. The SSU sequence data generated from Echinocephalus larvae from C. paytenorum and H. peronii were most similar to those of Echinocephalus sp. larvae from the two teleost fish hosts from Egypt, Saurida undosquamis (Richardson) (Synodontidae) and Pagrus pagrus (Linnaeus) (Sparidae), with pairwise differences of 1.5% and 2.2%, respectively (Table 2; Supplementary Fig. 1).

Table 2

Pairwise comparison of percent differences of the small subunit nuclear ribosomal DNA sequences determined herein (bold) and the selected reference sequences of Echinocephalus spp.

Taxa	1	2	3	4	5	6	7	8	9
1. OL415832 Echinocephalus sp. (ex Octopus djinda, Western Australia)	ID
2. JF934729 Echinocephalus overstreeti (ex Heterodontus portusjacksoni, South Australia)	0	ID
3. OL415833 Echinocephalus sp. (ex Pastinachus ater, Moreton Bay, Queensland, Australia)	0.2	0.2	ID
4. OL415834 Echinocephalus sp. (ex Codakia paytenorum, Heron Island, Queensland, Australia)	2.5	2.5	2.6	ID
5. KY972321 Echinocephalus sp. (ex Saurida undosquamis, Egypt)	1.3	1.3	1.5	2.2	ID
6. KY911549 Echinocephalus sp. (ex Pagrus pagrus, Egypt)	1.3	1.3	1.5	2.2	0	ID
7. OL415835 Echinocephalus sp. (ex Hydrophis peronii, Weipa, Queensland, Australia)	1.2	1.2	1.3	2.1	0.2	0.2	ID
8. KC493258 Echinocephalus sp. (ex Cyprinus carpio, Egypt)	3.1	3.1	3.2	5.5	4.4	4.4	4.3	ID
9. MN514178 Echinocephalus pseudouncinatus (ex Atrina maura, Mexico)	3.9	3.9	4	5.2	4.5	4.5	4.4	6.6	ID

OL415832 (ex Octopus djinda, Western Australia)

OL415833 (ex Pastinachus ater, Moreton Bay, Queensland, Australia)

OL415834 (ex Codakia paytenorum, Heron Island, Queensland, Australia)

OL415835 (ex Hydrophis peronii, Weipa, Queensland, Australia)

Phylogenetic analyses derived from the SSU data from the Echinocephalus sequences generated similar tree topologies for the BI and NJ analyses; therefore, only the BI tree is presented herein (Fig. 2; alignment of the SSU sequences of Echinocephalus spp. is provided in the Supplementary material). Three principal clades were evident in the phylogenetic reconstruction. Echinocephalus cf. pseudouncinatus was sister to the remaining two clades. A second clade included the larval Echinocephalus sp. from H. peronii in Australia and the larval Echinocephalus sp. from S. undosquamis and P. pagrus from Egypt, with strong nodal support (BI: 1.0; NJ: 99%). Also associated with this clade, though with poor support (0.85, 51%) and differing at 2.6% of bases, were the larvae from C. paytenorum from Heron Island. The third clade included E. overstreeti from H. portusjacksoni, the larval Echinocephalus sp. from O. djinda and adults from P. ater, all from Australia, as well larval Echinocephalus sp. from the C. carpio Linnaeus from Egypt, with strong nodal support (0.99, 99%) (Fig. 2).

Fig. 2

Genetic relationship based on Bayesian Inference analysis of the small subunit nuclear ribosomal DNA (SSU) sequences of Echinocephalus spp. collected form sea snake, stingray and octopus in Australia determined in this study (bold). Nodal support is given as a posterior probability for BI analysis followed by bootstrap values for NJ analysis on this tree. Gnathostoma lamothei (Bertoni-Ruiz et al., 2011) was used as the outgroup, however the GenBank entry for this parasite is with its old name, Gnathostoma neoprocyonis Z96947. The scale bar indicates the number of inferred substitutions per nucleotide site.

Adult specimens examined in this study from P. ater (Dasyatidae) were identified as E. overstreeti as the sequence data were only 0.2% different from those from H. portusjacksoni (Heterodontidae). The identification of the specimens from P. ater as E. overstreeti was also confirmed morphologically by measurement of the gubernaculum which was 0.8 mm in length, justifying its separation from E. inserratus, a species described recently, also from P. ater, from New Caledonia (Moravec and Justine, 2021). Moravec and Justine (2006, p.144) questioned the identity of E. overstreeti redescribed by Beveridge (1987) suggesting that it may represent another, probably undescribed, species as the type host of E. overstreeti was the blotched fantail ray, Taeniurops meyeni (as Taeniura melanospilos) (Dasyatidae). Beveridge (1987, 1991) reported adult E. overstreeti from a range of elasmobranch species from Australian waters, although gravid specimens were found only in H. portusjacksoni. In the current study, the female specimens from P. ater from Moreton Bay were gravid. The present evidence suggests that E. overstreeti, as described by Beveridge (1987), does in fact have a wide host range, occurring in both sharks and rays (Heterodontiformes, Orectolobiformes, Rajiformes, Myliobatiformes, Rhinopristiformes, Torpediniformes, Chimaeriformes). Furthermore, as the SSU sequence of Echinocephalus sp. larvae from O. djinda forms a clade with E. overstreeti, with strong nodal support (Fig. 2) and no nucleotide variation (Supplementary Fig. S1), we predict these larvae will represent E. overstreeti.

The two most phylogenetically distinct sequences (6.6% sequence difference) were those of larval Echinocephalus sp. from O. djinda and larval E. cf. pseudouncinatus, with the latter also sister to all remaining clades. The identification of the larvae of E. cf. pseudouncinatus was based on morphological features (Gómez-Valdez et al., 2019), although Moravec and Justine (2021) do not consider this type of identification to be possible. Milleman (1963) confirmed the identity of larvae and adults of P. pseudouncinatus by finding larval stage in the process of moulting to adults. However, this possibility did not exist in the study of Gómez-Valdez et al. (2019). For this reason, their sequence data have been indicated as belonging to E. cf. pseudouncinatus.

The larval Echinocephalus from C. carpio in Egypt, described as a new species, E. carpiae Abdel-Ghaffar et al. (2013) by Abdel-Ghaffar et al. (2013) belonged to the same clade as E. overstreeti and on a phylogenetic basis, E. carpiae is a junior synonym of E. overstreeti. However, the branch length and percentage difference in sequence similarity (97%) warrant further examination of this relationship. The specimens of E. carpiae were collected from a brackish lagoon bordering the Mediterranean coast of Egypt (Abdel-Ghaffar et al., 2013). The only species of Echinocephalus currently known from this region is E. uncinatus, found in the dasyatid rays Bathytoshia lata (Garman) [as Dasyatis centroura (Mitchill)] and D. pastinaca (Linnaeus) (see Beveridge, 1985), for which no molecular data are available.

Larval E. overstreeti have also been reported from S. undosquamis from the Red Sea off Egypt (Morsy et al., 2015). However, this identification was based exclusively on morphological features and therefore cannot be relied upon. It may be the same species as the specimens from the same host from Egypt listed as unpublished in GenBank and included in the current phylogenetic analyses, which clearly is not E. overstreeti.

Recently, larval Echinocephalus have been reported from the teleosts Acanthopagrus australis (Günther) and Rhabdosargus sarda (Forsskål) from Moreton Bay, Australia, but the generation of only ITS sequence data prevents comparison with the current data (Shamsi et al., 2021).

Moravec and Justine (2021) noted that resolution of the difficulties associated with the identification of the larval stages of Echinocephalus spp. would require molecular analyses. The current study has provided evidence for the validity of this approach in being able to associate a larval stage from an octopus with adult specimens of E. overstreeti from a shark in Australian waters, but the approach is severely limited by the lack of sequence data for adults of species of Echinocephalus, with E. overstreeti, as represented by the redescription of Beveridge (1987), being the only species to date with such data. In the Australian region, E. sinensis is also present although uncommon (Beveridge, 1991) and it is likely that E. inserratus, recently described from New Caledonia by Moravec and Justine (2021) will also be found in Australian waters as the same host species, P. ater, occurs in both Australian and New Caledonian waters. In European waters, molecular data for adult E. uncinatus are required to examine the purported presence of E. overstreeti suggested by the present data.

The current study extends the intermediate host range of Echinocephalus larvae in Australian waters. Larvae have been reported from bivalves and gastropods (Beveridge, 1987) but not previously from cephalopods. In the case of reptiles, Echinocephalus larvae have been reported from a turtle, Caretta, caretta (Linnaeus) (Lester et al., 1980) but not from sea snakes.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.