| Literature DB >> 35096807 |
Francesca Cuomo1, Carmela Dell'Aversana1,2, Teresa Chioccarelli3, Veronica Porreca3, Francesco Manfrevola3, Chiara Papulino1, Vincenzo Carafa1, Rosaria Benedetti1, Lucia Altucci1,4, Gilda Cobellis1, Gilda Cobellis1.
Abstract
Maintenance of energy balance between intake and expenditure is a prerequisite of human health, disrupted in severe metabolic diseases, such as obesity and type 2 diabetes (T2D), mainly due to accumulation of white adipose tissue (WAT). WAT undergoes a morphological and energetic remodelling toward brown adipose tissue (BAT) and the BAT activation has anti-obesity potential. The mechanisms or the regulatory factors able to activate BAT thermogenesis have been only partially deciphered. Identifying novel regulators of BAT induction is a question of great importance for fighting obesity and T2D. Here, we evaluated the role of Hif3α in murine pre-adipocyte 3T3-L1 cell line, a versatile and well characterized biological model of adipogenesis, by gain- and loss-of function approaches and in thermogenesis-induced model in vivo. HIF3A is regulated by inflammation, it modulates lypolysis in adipose tissue of obese adults, but its role in energy metabolism has not previously been investigated. We characterized gene and protein expression patterns of adipogenesis and metabolic activity in vitro and mechanistically in vivo. Overexpression of Hif3α in differentiating adipocytes increases white fat cells, whereas silencing of Hif3α promotes "browning" of white cells, activating thermogenesis through upregulation of Ucp1, Elovl3, Prdm16, Dio2 and Ppargc1a genes. Investigating cell metabolism, Seahorse Real-Time Cell Metabolism Analysis showed that silencing of Hif3α resulted in a significant increase of mitochondrial uncoupling with a concomitant increase in acetyl-CoA metabolism and Sirt1 and Sirt3 expression. The causal Hif3α/Ucp1 inverse relation has been validated in Cannabinoid receptor 1 (CB1) knockout, a thermogenesis-induced model in vivo. Our data indicate that Hif3α inhibition triggers "browning" of white adipocytes activating the beneficial thermogenesis rewiring energy metabolism in vitro and in vivo. HIF3A is a novel player that controls the energy metabolism with potential applications in developing therapy to fight metabolic disorders, as obesity, T2D and ultimately cancer.Entities:
Keywords: HIF3α; adipose tissue; browning; sirts; CB1; thermogenesis
Year: 2022 PMID: 35096807 PMCID: PMC8790297 DOI: 10.3389/fcell.2021.740203
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
Oligonucleotides used in the study.
| Gene target | Sequence (5′-3′) |
|---|---|
|
| ACGTTGACATCCGTAAAGACCT |
|
| GCAGTAATCTCCTTCTGCATCC |
|
| TTCCGATAACGAACGAGACTCT |
|
| TGGCTGAACGCCACTTGTC |
|
| GAGAGGACAGAGGGCCTTAGG |
|
| TGATTGTGAGGCGCATGATG |
|
| GGGCGAGCCATGGCGTTGGG |
|
| TAGCTGATTGTGAGGCGCAT |
|
| GACTGGCGAGCCATGGCG |
|
| CACCTGGACAAGGCCTCTAT |
|
| GTGCGCACCCACTCGTAACTCG |
|
| CACCTGGACAAGGCCTCTAT |
|
| GGGAAGCTTGCCATGGCGCTGGGGCTGCA |
|
| CACCTGGACAAGGCCTCTAT |
|
| TCGCTGATGCACTGCCTATG |
|
| GAGAGGTCCACAGAGCTGATT |
|
| AGACAACACCACCTCCAAGA-3′ |
|
| AGTTCCTGCCTGTGATCCTC |
|
| GAAGTCCCATACACAACCGC |
|
| GTGACTCTGGGGTCAGAGGA |
|
| CTCATCGTTGTTGGCCAGAC |
|
| CCGTGTAGATGGCAAAGCAC |
|
| CTCAGGATTGGCCTCTACGA |
|
| ACTGCCACACCTCCAGTCAT |
|
| TTACAACAGGCCAGGTTTCC |
|
| GGCTGGCGACATACAGTACA |
|
| CAGCAACCTCCAGCGTCACATC |
|
| GCGAAGGTCTTGCCACAGTCAG |
|
| CTTCCTCCTAGATGCCTACAAAC |
|
| GGCATAAATTGTTACCTGATTCAGG |
|
| CTTCGCCAACTCTACCATGG |
|
| TTCCACACCCATGAGCGAGT |
|
| ACTTCAGATGGAGGCTGGAC |
|
| TCCGAAGCCATCCTTGTAGG |
|
| TCCTCTGACATTTGCAGGTCTATC |
|
| AAAGGCATTGGCTGGAAGAA |
|
| CTGATCCTGGTGGTGTTGAT |
|
| CCTCAGAGCATAGATGATGG |
FIGURE 1Modulation of Hif3α expression regulates the adipocyte differentiation toward WAT phenotype. (A) Schematic representation of experimental design. 3T3-L1 cells were plated in presence and absence of pro-inflammatory cytokines the day before the differentiation induction until the appearance of mature adipocytes (T0 to T10). Representative Oil Red O-staining by light microscopy in our experimental condition. (B) Quantification of Oil Red O-staining at 540 nm (n = 3) using a TECAN robotic station in mature adipocytes at day 7. ***p ≤ 0.001, **p ≤ 0.01 vs. control. (C) Schematic representation of transfection design and gene expression analysis (Pparg, C/ebpα, Clec10a, Cd36, Fasn) in WT, siHif3α and HIF3ATO adipocytes. Heatmap represents expression profile of WAT genes differentially expressed during adipogenesis. Values represent the means of the fold change vs. T0WT (n = 3). T0WT is calculated as 1, thus >1 means upregulation, <1 means downregulation. All values are significant (p ≤ 0.01) except those underlined.
FIGURE 2Hif3α inhibition redirects adipocyte differentiation toward BAT phenotype (A,B) 3T3-L1 cells were plated and transfected with siHif3α, and exposed to pro-inflammatory cytokines and differentiation medium until the appearance of mature adipocytes (T0 to T10). Representative Oil Red O-staining by light microscopy in our experimental condition. Quantification of Oil Red O-staining at 540 nm (n = 3) using a TECAN robotic station in mature adipocytes at day 7. ***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05 vs. control. (C) Analysis of BAT gene regulation (Ucp1, Elovl3, Prdm16, Dio2, Ppargc1a) in WT, siHif3α and HIF3ATO adipocytes. Heatmap represents expression profile of BAT genes differentially expressed across the different experimental conditions. Values represent the means of the fold change vs. T0WT (n = 3). T0WT is calculated as 1, thus >1 means upregulation, <1 means downregulation. All values are significant (p ≤ 0.01) except those underlined.
FIGURE 3Hif3α silencing enhances lipid catabolism. (A) Expression levels of Angptl4 by qPCR in WT, siHif3α, HIF3ATO cultured in differentiated medium (T0-T7) in presence or absence of cytokines. Relative gene expression data are reported as 2-ΔΔCt method, normalized to housekeeping gene (b-actin and 18S mRNA) vs. T0 WT. Data are expressed as means ± SEM (n = 3; ***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05). (B) Western blot analysis of LC3B-II protein in siHif3α adipocytes cultured in differentiation medium in presence of inflammatory cytokines (T7). The ratio of Lc3B-II/Lc3B-I/Gapdh was measured using ImageJ Analysis tool (n = 3; ***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05 vs. control cells).
FIGURE 4Hif3α silencing increases mitochondrial respiration. 3T3-L1 cells were transfected with siHif3α and induced to differentiate (A) Seahorse analysis showed the Oxygen consumption rate (OCR) expressed in ug protein. (B) Proton Leak. (C) Oxygen Consumption Rate. (D) Extracellular Acidification Rate. (E) Baseline OCR/ECAR ratio (F) Mitochondrial respiration vs. glycolysis. Values are mean ± SD (n = 3; *p < 0.05 vs. WT or control cells).
FIGURE 5The inhibition of Hif3α induces fatty acids synthesis enzymes (A) Western blot analysis of Acc, AceCS1 and PDH in siHif3α after 7 days of differentiation induction. SIRTs are activated in absence of Hif3α (B) Western blot analysis of Hif3α, Sirt1, Sirt3 and Lc3B-I/II detected in siHif3α adipocytes at T3. Densitometry values are mean ± SEM of biological triplicates and are graphed as normalized for relative housekeeping (Actin or Gapdh) using the ImageJ Gel Analysis tool and expressed as fold change. Gapdh was showed as representative housekeeping. (n = 3; ***p ≤ 0.001, **p ≤ 0.01 vs. control cells).
FIGURE 6The causal Hif3α/Ucp1 relation in thermogenesis-induced model. (A) Animal genotyping by PCR analysis of genomic DNA. (B) Animal and fat depots weights (C) Schematic representation of the distribution of adipose tissue depots collected: visceral white fat (vFAT) and inguinal/subcutaneous white fat (iFAT). (D) Representative haematoxylin and eosin-stained of vFAT and iFAT sections (upper panel) and fat cell density (lower panel). (E) Expression levels of Hif3α isoforms gene by qPCR in vFAT and iFAT of WT and CB1KO mice. Relative gene expression data are reported as 2-ΔΔCt, normalized to housekeeping genes (b-actin and 18S mRNA). Data are expressed as means ± SEM (n = 3 animals/genotype, ***p ≤ 0.001, *p ≤ 0.05 vs. WT mouse). (F) Heatmap represents expression profile of WAT-specific (Pparg, C/ebpα, Fasn) and BAT-specific genes (Ucp1, Elovl3, Prdm16, Dio2, Ppargc1a) in vFAT and iFAT differentially expressed in CB1KO compared to WT. Values represent the means of the fold change vs. WT (n = 3 animals/genotype). All values are significant (p < 0.05), except those underlined.