Literature DB >> 35068048

Plant elicitor peptide signalling confers rice resistance to piercing-sucking insect herbivores and pathogens.

Wenzhong Shen1, Xue Zhang1, Jiuer Liu1, Kehan Tao1, Chong Li1, Shi Xiao1, Wenqing Zhang1, Jian-Feng Li1.   

Abstract

Rice is a staple food crop worldwide, and its production is severely threatened by phloem-feeding insect herbivores, particularly the brown planthopper (BPH, Nilaparvata lugens), and destructive pathogens. Despite the identification of many BPH resistance genes, the molecular basis of rice resistance to BPH remains largely unclear. Here, we report that the plant elicitor peptide (Pep) signalling confers rice resistance to BPH. Both rice PEP RECEPTORs (PEPRs) and PRECURSORs of PEP (PROPEPs), particularly OsPROPEP3, were transcriptionally induced in leaf sheaths upon BPH infestation. Knockout of OsPEPRs impaired rice resistance to BPH, whereas exogenous application of OsPep3 improved the resistance. Hormone measurement and co-profiling of transcriptomics and metabolomics in OsPep3-treated rice leaf sheaths suggested potential contributions of jasmonic acid biosynthesis, lipid metabolism and phenylpropanoid metabolism to OsPep3-induced rice immunity. Moreover, OsPep3 elicitation also strengthened rice resistance to the fungal pathogen Magnaporthe oryzae and bacterial pathogen Xanthamonas oryzae pv. oryzae and provoked immune responses in wheat. Collectively, this work demonstrates a previously unappreciated importance of the Pep signalling in plants for combating piercing-sucking insect herbivores and promises exogenous application of OsPep3 as an eco-friendly immune stimulator in agriculture for crop protection against a broad spectrum of insect pests and pathogens.
© 2022 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Entities:  

Keywords:  zzm321990Magnaporthe oryzaezzm321990; Xanthamonas oryzae pv. oryzae; brown planthopper; immune stimulator; plant elicitor peptide; rice

Mesh:

Substances:

Year:  2022        PMID: 35068048      PMCID: PMC9055822          DOI: 10.1111/pbi.13781

Source DB:  PubMed          Journal:  Plant Biotechnol J        ISSN: 1467-7644            Impact factor:   13.263


Introduction

As sessile organisms constantly encountering attacks from microbial pathogens and insect herbivores, plants have evolved pattern‐triggered immunity (PTI) and effector‐triggered immunity (ETI) to fend off those opponents (Dangl et al., 2013). In PTI, plants employ plasma membrane (PM)‐residing pattern recognition receptors (PRRs) to perceive conserved signature molecules from pathogens or herbivores, which are termed microbe‐ or herbivore‐associated molecular patterns (MAMPs or HAMPs), respectively. Specific plant‐derived molecules, either passively released by invader‐induced damages or actively produced as phytocytokines, can serve as damage/danger‐associated molecular patterns (DAMPs) that function similarly to MAMPs/HAMPs. In ETI, plants deploy intracellular nucleotide‐binding leucine‐rich repeat (NLR) receptors to sense effector proteins, which have been secreted by pathogens or herbivores with an original purpose to suppress PTI. Beyond the framework of PTI and ETI, detailed molecular mechanisms underlying plant resistance to insect herbivores have been scarcely understood in comparison with those to pathogens (Ling et al., 2019; Zheng et al., 2021). Rice (Oryza sativa) is a staple food crop for billions of the global population and meanwhile an attractive nutrient source for insect herbivores and pathogens. The brown planthopper (BPH, Nilaparvata lugens Stål), arguably the most destructive insect pest of rice, annually causes staggering loss of global rice production (Savary et al., 2019). Being a piercing‐sucking insect herbivore, BPH can damage rice plants directly by penetrating the long‐cell blocks of leaf sheaths and ingesting the phloem sap using the stylet (Shi et al., 2021), or indirectly by transmitting viral diseases as an insect vector (Ling and Zhang, 2016). Overuse of chemical pesticides currently remains a major solution for rice farmers to cope with BPH, which, however, can stimulate pesticide tolerance in the pests and adversely influence the biodiversity and food safety (Lu et al., 2017; Way and Heong, 1994). By contrast, fortification of rice immunity promises an effective and eco‐friendly approach for BPH control. The formation of BPH resistance is a multifaceted process in rice (Cheng et al., 2013a). Although there has been no HAMP/DAMP‐PRR or effector‐NLR paradigm being established in rice‐BPH interactions, significant progress has been made in identifying BPH resistance genes in rice. On the one hand, two BPH resistance gene loci, Bph3 and Bph15, have been characterized to encode PM‐residing lectin receptor‐like kinases OsLecRK1‐OsLecRK3 and OsLecRK, respectively (Cheng et al., 2013b; Liu et al., 2015). OsLecRK can interact with OsADF, an actin depolymerizing factor, and OsRRK1, a receptor‐like cytoplasmic kinase, to positively modulate BPH resistance (Cheng et al., 2013b; Ma et al., 2017). Another BPH resistance gene, Bph32, has been identified as a PM‐localized short consensus repeat domain‐containing protein (Ren et al., 2016). These cell‐surface proteins are candidate PRRs or positive regulators of PTI induced by unknown HAMPs/DAMPs during BPH infestation. On the other hand, four BPH resistance genes, Bph9, Bph14, Bph18 and Bph26, have been found to encode coiled‐coil (CC)‐containing NLR proteins (Du et al., 2009; Ji et al., 2016; Tamura et al., 2014; Zhao et al., 2016). BPH14 can form homodimers and interact with transcription factors OsWRKY46 and OsWRKY72, leading to increased accumulation of the two OsWRKYs and subsequent upregulation of defence‐related genes (Hu et al., 2017). These intracellular resistance proteins probably serve as immune receptors for unidentified BPH effectors (Wang et al., 2021). In addition, the BPH resistance gene Bph6 encodes an exocyst‐localized protein that can interact with the exocyst subunit OsEXO70E1 to promote exocytosis and cell wall consolidation (Guo et al., 2018), while Bph30 and Bph40 encode atypical leucine‐rich domain‐containing proteins that mediate BPH resistance by fortifying rice sclerenchyma (Shi et al., 2021). Of note, certain BPH biotypes can rapidly adapt to resistant rice varieties harbouring only a single BPH resistance gene (Ling et al., 2019; Zheng et al., 2021), whereas stacking Bph14 and Bph15 to simultaneously enhance PTI and ETI has been shown to potentiate BPH resistance in hybrid rice (Hu et al., 2012). These observations suggest that the combination of multilayered anti‐BPH strategies enables more efficient and sustainable BPH resistance in rice. Plant elicitor peptides (Peps) are a class of phytocytokines produced by a wide range of plant species (Huffaker et al., 2006). The majority of PRECURSORs of PEP (PROPEPs) can be transcriptionally induced upon pathogen infection or wounding (Bartels and Boller, 2015). Mature Peps are liberated from the C‐termini of PROPEPs through metacaspase‐mediated cleavage and relocated to the apoplast (Hander et al., 2019; Shen et al., 2019), where they are perceived by Pep receptors (PEPRs) to elicit typical PTI responses (Yamaguchi et al., 2006, 2010). Recently, the function of Pep‐PEPR signalling has been expanded to defending chewing insect herbivores. In maize (Zea mays), the expression of ZmPROPEP3 was upregulated upon exposure to Spodoptera exigua oral secretions (OS) containing potential HAMPs. Exogenous application of ZmPep3 induced the expression of herbivory defence‐related genes and production of jasmonic acid (JA), ethylene, and phytoalexins, leading to constrained growth of S. exigua larva on maize leaves (Huffaker et al., 2013). In Arabidopsis (Arabidopsis thaliana), the expression of AtPROPEP3 and AtPEPR1/AtPEPR2 was strongly induced upon Spodoptera littoralis feeding. The Pep‐insensitive atpepr1pepr2 null plants exhibited decreased JA accumulation in response to S. littoralis OS and compromised insect resistance (Klauser et al., 2015). In rice, transcriptional activation of OsPROPEP3 was stimulated by Mythimna loreyi OS. Simultaneous treatment of OsPep3 and M. loreyi OS elicited stronger anti‐herbivore defence than separate treatments, while overexpression of OsPEPR1 also augmented defence responses induced by OsPeps or M. loreyi OS (Shinya et al., 2018). However, it remains unknown whether the Pep‐PEPR signalling is crucial for plants to defend piercing‐sucking insect herbivores, which have a distinct feeding behaviour and generally induce much less wounding than chewing insects (Du et al., 2009). In this study, we found that OsPEPRs and most OsPROPEPs were transcriptionally induced by BPH infestation in rice leaf sheaths. Knockout of OsPEPRs impaired rice resistance to BPH, whereas exogenous application of OsPep3 exerted an opposite effect. We further conducted hormone measurement and joint profiling of transcriptomics and metabolomics using OsPep3‐elicited rice leaf sheaths to obtain molecular clues as to how the Pep‐PEPR signalling contributes to rice immunity. In addition, OsPep3 application also improved rice resistance to devastating fungal blast disease and bacterial blight disease and was capable of inducing immune responses in wheat. This work demonstrates the importance of Pep signalling in plants for defending piercing‐sucking insect herbivores and inspires the use of OsPep3 as a widely useful crop immune stimulator in agriculture against a broad spectrum of insect pests and pathogens.

Results

OsPEPRs positively regulate rice resistance to BPH

The initial goal of this study was to use the rice‐BPH interaction as a model to understand whether the PEPR‐mediated Pep signalling is important for defending piercing‐sucking insect herbivores in plants. The rice genome encodes two PEPR genes, namely OsPEPR1 and OsPEPR2 (Shinya et al., 2018). To quickly assess the functional relevance of OsPEPR1 and OsPEPR2 to BPH resistance, we evaluated the time‐course induction of these genes by BPH infestation in rice leaf sheaths. A substantial increase in OsPEPR1 expression was observed at 4 and 8 h post‐BPH infestation (hpi), whereas its expression was restored to the basal level at 24 hpi (Figure 1a). By contrast, BPH challenge induced a modest increase in OsPEPR2 transcripts at 4 hpi, which declined back to the basal level at as early as 8 hpi (Figure 1a). These results hinted that OsPEPR1 and OsPEPR2 may play major and minor roles, respectively, in defending BPH.
Figure 1

OsPEPRs positively regulate rice resistance to BPH. (a) OsPEPRs can be transcriptionally induced in rice leaf sheaths by BPH infestation. Expression levels of OsPEPRs were determined by RT–qPCR using Os18s as a reference gene. Data are shown as mean ± SD of three biological replicates. **P < 0.01 (Student’s t–test). (b) Schematic diagram of CRISPR–mediated knockout of OsPEPR1 and OsPEPR2. Indels or genomic deletions introduced by CRISPR are highlighted in red. (c) OsPep3–induced ROS burst is abolished in ospepr1pepr2 null plants. ROS burst was determined for 12 leaves of 10–day–old rice seedlings using the luminol–based method. (d) OsPep3–induced MAPK activation is abolished in ospepr1pepr2 null plants. MAPK activation was determined by immunoblotting using anti–ERK antibodies. Rubisco staining indicates equal loading of total proteins. (e) The ospepr1pepr2 null plants are more susceptible than ZH11 plants to BPH infestation. Rice seedlings at the four–leaf stage were infested with BPH nymphs of the third instar at a density of 15 insects per plant for 7 days. (f) Quantification of the BPH resistance scores for different genotypes. Twenty seedlings were evaluated for each genotype. Data are shown as mean ± SD with individual data points shown as dots. **P < 0.01 (Student’s t–test). (g) The ospepr1pepr2 null plants have lower survival rates than ZH11 plants under BPH infestation. Data are shown as mean ± SD of three biological replicates. **P < 0.01 (Student’s t–test).

OsPEPRs positively regulate rice resistance to BPH. (a) OsPEPRs can be transcriptionally induced in rice leaf sheaths by BPH infestation. Expression levels of OsPEPRs were determined by RT–qPCR using Os18s as a reference gene. Data are shown as mean ± SD of three biological replicates. **P < 0.01 (Student’s t–test). (b) Schematic diagram of CRISPR–mediated knockout of OsPEPR1 and OsPEPR2. Indels or genomic deletions introduced by CRISPR are highlighted in red. (c) OsPep3–induced ROS burst is abolished in ospepr1pepr2 null plants. ROS burst was determined for 12 leaves of 10–day–old rice seedlings using the luminol–based method. (d) OsPep3–induced MAPK activation is abolished in ospepr1pepr2 null plants. MAPK activation was determined by immunoblotting using anti–ERK antibodies. Rubisco staining indicates equal loading of total proteins. (e) The ospepr1pepr2 null plants are more susceptible than ZH11 plants to BPH infestation. Rice seedlings at the four–leaf stage were infested with BPH nymphs of the third instar at a density of 15 insects per plant for 7 days. (f) Quantification of the BPH resistance scores for different genotypes. Twenty seedlings were evaluated for each genotype. Data are shown as mean ± SD with individual data points shown as dots. **P < 0.01 (Student’s t–test). (g) The ospepr1pepr2 null plants have lower survival rates than ZH11 plants under BPH infestation. Data are shown as mean ± SD of three biological replicates. **P < 0.01 (Student’s t–test). The function of OsPEPRs in perceiving OsPep3 has recently been supported using OsPEPR‐overexpressing plants (Shinya et al., 2018). However, the loss‐of‐function evidence has been lacking. We utilized the CRISPR/Cas9 technology to generate ospepr1pepr2 null plants in the Zhonghua 11 (ZH11) background and subsequently analysed the alteration of OsPep3 responses in these mutants. As OsPEPR1 and OsPEPR2 are located adjacently in the rice genome, we designed four single guide RNAs (sgRNAs), two for each gene, to increase the possibility of large genomic deletions spanning OsPEPRs. However, we only obtained two homozygous ospepr1pepr2 null alleles (i.e. #1 and #2; Figure 1b) containing the same insertion of 1 base pair (bp) at the target site 1 of OsPEPR1, leading to a premature stop codon, and the same deletion of 1093 bp at the target site 2 of OsPEPR2, leading to the loss of entire kinase domain. The two double null alleles were differed by an additional mutation at the target site 2 of OsPEPR1, which was either an insertion of 1 bp in the line #1 or deletion of 8 bp in the line #2 (Figure 1b). The sgRNA aiming at the target site 1 of OsPEPR2 somehow failed to introduce any mutation (Figure 1b). The two ospepr1pepr2 null alleles were morphologically indistinguishable from ZH11 plants at the seedling and heading stages (Figure S1a–f). However, when the leaves of 10‐day‐old ZH11 plants were treated with OsPep3, we could readily detect typical immune responses, including the burst of reactive oxygen species (ROS) and activation of mitogen‐activated protein kinases (MAPKs), at as early as 15 min after OsPep3 exposure (Figure 1c,d). By contrast, the OsPep3‐elicited ROS burst and MAPK activation was abolished in ospepr1pepr2 alleles (Figure 1c,d). To investigate the physiological role of OsPEPRs in BPH resistance, we fed ZH11 and ospepr1pepr2 seedlings at the four‐leaf stage to BPH nymphs of the third instar at a density of 15 insects per plant. The ospepr1pepr2 plants appeared to be more susceptible to BPH infestation than ZH11 plants (Figure 1e). The susceptibility was further quantified by the resistance score (Figure 1f), according to the routinely used criteria (Figure S2) (Huang et al., 2001), and by the plant survival rate (Figure 1g). Notably, in a host choice test where ZH11 and ospepr1pepr2 plants were grown side‐by‐side, we failed to detect any significant difference between the numbers of insects settled on these two genotypes at 48 hpi (Figure S3), excluding the possibility that the susceptibility of ospepr1pepr2 plants is due to increased attractiveness to the pests. Moreover, there was no obvious difference in the honeydew weight and body weight gain between BPH nymphs feeding on ZH11 or ospepr1pepr2 plants at 48 hpi (Figure S4a,b), suggesting that the pests feed equally on the two rice genotypes. Taken together, these findings indicated that the presence or absence of OsPEPRs affects rice resistance to BPH.

Rice genome encodes seven PROPEPs

We next sought to consolidate the importance of the Pep‐PEPR signalling for BPH resistance from the angle of OsPeps. In an earlier study by Lori and colleagues, three OsPROPEPs have been identified in rice (Lori et al., 2015). This gene family has recently been updated to six members (i.e. OsPROPEP1‐OsPROPEP6) (Shinya et al., 2018). By conducting the BLAST analysis of rice genome using the sequence of ZmPep1 (Huffaker et al., 2011), we identified a new member named OsPROPEP7 (encoded by Os08g0173400), which has a varying and elongated C‐terminal sequence but encompasses a fragment (i.e. OsPep7) showing sequence similarity to the putative OsPep1‐OsPep6 (Figure 2a). A phylogenetic analysis based on predicted Peps from 20 plant species out of four families indicated that Peps from the same plant family are more closely related in sequence (Figure S5). Similar conclusions have been made by two studies conducting phylogenetic analyses using full‐length PROPEPs (Lori et al., 2015; Poretsky et al., 2020). Interestingly, we noticed two exceptions, namely Arabidopsis AtPep6 and Brassica rapa BrPep5, which resemble Solanaceous Peps more than Brassicaceous Peps (Figure S5).
Figure 2

Exogenous application of OsPeps elicits immune responses in rice. (a) OsPep7 exhibits sequence similarity to other OsPeps. The conserved residues of OsPeps are highlighted in red, and the non–conserved ending residue of OsPep7 is marked in blue. ZmPep1 is underlined. (b) OsPROPEPs undergo spontaneous cleavage in protoplasts to produce OsPeps with expected sizes except OsPROPEP1. OsPROPEPs were expressed in rice protoplasts for 12 h. OsPROPEPs and OsPeps are indicated by arrows and arrowheads, respectively. (c) Exogenous application of different OsPeps can elicit ROS burst to varying levels in rice. ROS burst was determined for 12 leaves of 10–day–old rice seedlings using the luminol–based method. (d) Exogenous application of different OsPeps can elicit MAPK activation to varying levels in rice. MAPK activation was determined by immunoblotting using anti–ERK antibodies. Rubisco staining indicates equal loading of total proteins. (e) OsPROPEPs can be transcriptionally induced by BPH infestation except OsPROPEP5. Expression levels of OsPEPRs were determined by RT–qPCR using Os18s as a reference gene. Data are shown as mean ± SD of three biological replicates. **P < 0.01 (student’s t–test).

Exogenous application of OsPeps elicits immune responses in rice. (a) OsPep7 exhibits sequence similarity to other OsPeps. The conserved residues of OsPeps are highlighted in red, and the non–conserved ending residue of OsPep7 is marked in blue. ZmPep1 is underlined. (b) OsPROPEPs undergo spontaneous cleavage in protoplasts to produce OsPeps with expected sizes except OsPROPEP1. OsPROPEPs were expressed in rice protoplasts for 12 h. OsPROPEPs and OsPeps are indicated by arrows and arrowheads, respectively. (c) Exogenous application of different OsPeps can elicit ROS burst to varying levels in rice. ROS burst was determined for 12 leaves of 10–day–old rice seedlings using the luminol–based method. (d) Exogenous application of different OsPeps can elicit MAPK activation to varying levels in rice. MAPK activation was determined by immunoblotting using anti–ERK antibodies. Rubisco staining indicates equal loading of total proteins. (e) OsPROPEPs can be transcriptionally induced by BPH infestation except OsPROPEP5. Expression levels of OsPEPRs were determined by RT–qPCR using Os18s as a reference gene. Data are shown as mean ± SD of three biological replicates. **P < 0.01 (student’s t–test). We have recently reported that most AtPROPEPs produced in Arabidopsis protoplasts can be spontaneously cleaved by type‐II metacaspases (Shen et al., 2019). When OsPROPEP1‐OsPROPEP7 were expressed in rice protoplasts with C‐terminal GFP‐HA dual tags to allow the detection of processed Peps through immunoblotting, we noted that all OsPROPEPs could be cleaved to generate Pep‐GFP‐HA fragments with deduced sizes (i.e. ~35 kDa), except OsPROPEP1 (Figure 2b). These results suggested that most OsPROPEPs are able to release OsPeps in rice cells in a similar manner as AtPROPEPs in Arabidopsis. The newly identified OsPep7 does not have the conserved ending histidine residue like OsPep1‐OsPep6 (Figure 2a) and has not been biochemically validated. Therefore, we compared the eliciting activity of OsPep7 with those of OsPep1, OsPep2 and OsPep3. When the leaves of 10‐day‐old ZH11 plants were treated with individual OsPeps, OsPep3 was found to elicit the strongest ROS burst and MAPK activation, while OsPep2 and OsPep7 could induce intermediate levels of immune responses (Figure 2c,d). Notably, OsPep1 only exhibited a moderate eliciting activity (Figure 2c,d). These results verified OsPep7 as a bioactive peptide and OsPep3 as one of the most potent OsPeps.

OsPep3 treatment improves rice resistance to BPH

We noted that all OsPROPEPs, except OsPROPEP5, could be transcriptionally upregulated in rice leaf sheaths under BPH challenge (Figure 2e). Of note, only OsPROPEP3 had a decent basal expression and meanwhile was highly induced by BPH infestation at 4 hpi (Figure 2e). By contrast, OsPROPEP7 was still expressed at relatively low levels before and after BPH infestation (Figure 2e). Based on these findings and the earlier observation that OsPep3 could potently induce rice immune responses (Figure 2c,d), we examined whether OsPep3 application can boost rice resistance to BPH. To this end, ZH11 and ospepr1pepr2#1 plants at the four‐leaf stage were pretreated with OsPep3 or mock. At 12 h post‐pretreatment, these plants were fed to 15 BPH nymphs of the third instar per plant. In 10 days with a single spray of OsPep3 every 24 h, we noted that the OsPep3‐treated ZH11 plants displayed increased BPH resistance relative to mock‐treated plants (Figure 3,b). By contrast, the ospepr1pepr2 plants exhibited impaired basal resistance to BPH, while OsPep3 treatment was unable to improve the resistance (Figure 3a,b), which is consistent with our earlier finding that the ospepr1pepr2 plants were insensitive to OsPep3 (Figure 1c,d). Moreover, reduced insects were found to settle on OsPep3‐treated ZH11 plants relative to mock‐treated plants at 48 hpi in a host choice test (Figure 3c,d), suggesting that exogenous application of OsPep3 can mobilize the antixenosis defence mechanism in rice against BPH. In the same test, ZH11 and ospepr1pepr2 plants showed no difference in the number of insects settled on individual plants (Figure 3c,d), which is in agreement with our earlier result (Figure S3). We also checked the honeydew weight and body weight gain of BPH nymphs feeding on OsPep3‐ or mock‐treated ZH11 plants at 48 hpi. The insects feeding on OsPep3‐treated ZH11 plants had reduced honeydew weight and body weight gain when compared with those feeding on mock‐treated ZH11 plants (Figure S6a,b), suggesting that OsPep3‐elicited rice plants can reduce the feeding of BPH. These findings further bolstered the notion that the Pep‐PEPR signalling plays a critical role in rice for defending BPH.
Figure 3

Exogenous application of OsPep3 boosts rice resistance to BPH. (a) OsPep3 treatment enhances BPH resistance in ZH11 but not in ospepr1pepr2 null plants. Rice seedlings at the four–leaf stage were pretreated with OsPep3 and infested with BPH nymphs of the third instar at a density of 15 insects per plant at 12 h after OsPep3 pretreatment. Plants under BPH attacks were sprayed with OsPep3 every 24 h for 10 days before photographing. Scale bar = 2 cm. dpi, day post–infestation. (b) Quantification of the BPH resistance score for different genotypes. Fifteen seedlings were evaluated for each genotype. Data are shown as mean ± SD with individual data points shown as dots. **P < 0.01 (Student’s t–test). (c) BPH prefers to feed on OsPep3–unelicited ZH11 plants in a host choice test. The number of nymphs on each plant was recorded at 48 h post–infestation. Eighteen seedlings were evaluated for each genotype. Data are shown as mean ± SD with individual data points shown as dots. **P < 0.01 (Student’s t–test). (d) Representative image for (c). Scale bar = 0.5 cm.

Exogenous application of OsPep3 boosts rice resistance to BPH. (a) OsPep3 treatment enhances BPH resistance in ZH11 but not in ospepr1pepr2 null plants. Rice seedlings at the four–leaf stage were pretreated with OsPep3 and infested with BPH nymphs of the third instar at a density of 15 insects per plant at 12 h after OsPep3 pretreatment. Plants under BPH attacks were sprayed with OsPep3 every 24 h for 10 days before photographing. Scale bar = 2 cm. dpi, day post–infestation. (b) Quantification of the BPH resistance score for different genotypes. Fifteen seedlings were evaluated for each genotype. Data are shown as mean ± SD with individual data points shown as dots. **P < 0.01 (Student’s t–test). (c) BPH prefers to feed on OsPep3–unelicited ZH11 plants in a host choice test. The number of nymphs on each plant was recorded at 48 h post–infestation. Eighteen seedlings were evaluated for each genotype. Data are shown as mean ± SD with individual data points shown as dots. **P < 0.01 (Student’s t–test). (d) Representative image for (c). Scale bar = 0.5 cm.

OsPep3 treatment induces JA accumulation in rice

Both salicylic acid (SA) and JA have been assigned with important roles in rice resistance to BPH (Du et al., 2009; He et al., 2020; Xu et al., 2021). In addition, 12‐oxo‐phytodienoic acid (OPDA), an intermediate metabolite in JA biosynthesis, has also been shown to stimulate rice resistance to BPH (Guo et al., 2014). Therefore, we evaluated OsPep3‐induced changes in the abundances of JA, JA‐isoleucine (JA‐Ile, the bioactive form), OPDA, and SA in the leaf sheaths of ZH11 and ospepr1pepr2 plants. At 24 h post‐treatment, the OsPep3‐treated ZH11 plants were found to accumulate significantly more JA, JA‐Ile and OPDA than mock‐treated plants (Figure 4a–c), whereas no statistically significant difference in SA abundance was detected between OsPep3‐ and mock‐treated plants (Figure 4d). These results implicated that the JA pathway contributes to OsPep3‐induced BPH resistance in rice.
Figure 4

Exogenous application of OsPep3 elicits the accumulation of JA and OPDA in rice leaf sheaths. (a–c) OsPep3 induces the accumulation of JA (a), JA–Ile (b) and OPDA (c) in ZH11 but not in ospepr1pepr2 null plants at 24 h post–treatment. (d) OsPep3 cannot induce a significant change in SA abundance in ZH11 plants at 24 h post–treatment. For (a), (b), (c) and (d), data are shown as mean ± SD with individual data points shown as dots. Different letters indicate significant differences with P < 0.01 (one–way anova with Tukey’s multiple comparisons test).

Exogenous application of OsPep3 elicits the accumulation of JA and OPDA in rice leaf sheaths. (a–c) OsPep3 induces the accumulation of JA (a), JA–Ile (b) and OPDA (c) in ZH11 but not in ospepr1pepr2 null plants at 24 h post–treatment. (d) OsPep3 cannot induce a significant change in SA abundance in ZH11 plants at 24 h post–treatment. For (a), (b), (c) and (d), data are shown as mean ± SD with individual data points shown as dots. Different letters indicate significant differences with P < 0.01 (one–way anova with Tukey’s multiple comparisons test).

OsPep3 treatment induces transcriptional reprogramming in rice

To obtain more molecular clues about OsPep3‐induced BPH resistance in rice, we conducted RNA‐sequencing (RNA‐seq) analysis using the leaf sheaths of ZH11 or ospepr1pepr2 plants at 24 h after OsPep3 or mock treatment. We detected 1,663 upregulated and 1,263 downregulated genes (fold change > 2) induced by OsPep3 in ZH11 plants (Figure 5a) (see Sequence Read Archive database, accession ID: PRJNA766326). We chose to focus on the OsPep3‐upregulated genes since they may provide straightforward mechanistic explanation on the OsPep3‐induced BPH resistance. Among these genes, 723 genes with higher basal expression levels in ospepr1pepr2 plants were excluded from our attention, considering that the ospepr1pepr2 plants were more susceptible to BPH attacks than ZH11 plants (Figure 1e–g). For the remaining genes (Figure 5b), we validated the robustness of the RNA‐seq data by selecting a few defence‐related genes and evaluating their OsPep3‐inducible patterns using quantitative reverse transcription PCR (RT‐qPCR) (Figure 5c). The 940 upregulated genes were then subjected to gene ontology (GO) and Kyoto encyclopaedia of genes and genomes (KEGG) analyses. The GO analysis showed that stress responses, defence responses, cell‐surface receptor signalling and wounding responses were major biological processes (BPs) stimulated by OsPep3, while cellular components mobilized by OsPep3 were overrepresented by those located at the extracellular region and cell periphery (Figure 5d). Moreover, the KEGG analysis highlighted the engagement of many OsPep3‐upregulated genes in the biosynthesis of secondary metabolites, particularly the phenylpropanoid pathway (Figure 5d).
Figure 5

OsPep3 elicits transcriptional reprogramming in rice leaf sheaths. (a) Volcano plot displays differentially regulated genes (DEGs) with fold change (FC) > 2 and P < 0.01 at 24 h after OsPep3 treatment in two biological replicates. FDR, false discovery rate. (b) Hierarchical clustering of OsPep3–upregulated genes at 24 h after OsPep3 treatment. Expression levels of each gene across different samples are shown as Z–scores scaled by the FPKM (fragments per kilobase of transcript per million mapped reads). (c) RT–qPCR validation (orange) of RNA–seq data (blue) using six OsPep3–upregulated genes. Expression levels of these genes in ZH11 plants at 24 h after mock treatment were normalized as 1. RT–qPCR data are shown as mean ± SD of three biological replicates. **P < 0.01 (Student’s t–test). (d) GO and KEGG analyses of OsPep3–upregulated genes. BP, biological process. CC, cellular compartment. Padj, adjusted P value.

OsPep3 elicits transcriptional reprogramming in rice leaf sheaths. (a) Volcano plot displays differentially regulated genes (DEGs) with fold change (FC) > 2 and P < 0.01 at 24 h after OsPep3 treatment in two biological replicates. FDR, false discovery rate. (b) Hierarchical clustering of OsPep3–upregulated genes at 24 h after OsPep3 treatment. Expression levels of each gene across different samples are shown as Z–scores scaled by the FPKM (fragments per kilobase of transcript per million mapped reads). (c) RT–qPCR validation (orange) of RNA–seq data (blue) using six OsPep3–upregulated genes. Expression levels of these genes in ZH11 plants at 24 h after mock treatment were normalized as 1. RT–qPCR data are shown as mean ± SD of three biological replicates. **P < 0.01 (Student’s t–test). (d) GO and KEGG analyses of OsPep3–upregulated genes. BP, biological process. CC, cellular compartment. Padj, adjusted P value. We also looked into individual OsPep3‐induced genes in ZH11 plants with functional annotations. Notably, among the top 15 genes induced by OsPep3 (Figure S7), three genes, Os01g0822900 (OsLTP1.2), Os06g0604200 (OsPLDα4) and Os03g0167000 (OsLTPG2), are involved in lipid metabolism, while four genes, Os04g0107600 (OsADC2), Os07g0526400 (OsPKS15), Os09g0507300 (OsAAO5) and Os08g0140300 (OsTDC1), encode enzymes for the biosynthesis of secondary metabolites. In particular, a role of ascorbate oxidase, encoded by OsAAO5 (Figure 5c and Figure S7), in defending insect herbivores has been proposed (Felton and Summers, 1993). Beyond the top 15, OsMYB30 and OsPAL4, two players exerting positive effects on BPH resistance through promoting phenylpropanoid biosynthesis (He et al., 2020), were found to be upregulated by OsPep3 (Figure 5c). These results suggested potential roles of lipid metabolism and biosynthesis of secondary metabolites, especially phenylpropanoids, in OsPep3‐induced rice resistance to BPH.

OsPep3 treatment elicits metabolomic changes in rice

In parallel to the transcriptome profiling, we also harnessed the same batch of leaf sheath tissues to perform non‐targeted metabolome analysis. We detected 224 and 383 metabolites with increased or decreased abundances (fold change > 2), respectively, in ZH11 plants at 24 h post‐OsPep3 treatment (Figure 6a) (see MetaboLights database, accession ID: MTBLS3518). We focused on the 224 metabolites upregulated by OsPep3 (Figure 6b), since they may have a causal relationship with the OsPep3‐induced BPH resistance. Unfortunately, only 30 of these metabolites have been annotated thus far (Figure S8a). Intriguingly, fatty acids and derivatives, which are extensively involved in plant immunity (Lim et al., 2017), were overrepresented among OsPep3‐upregulated metabolites (Figure 6c). Of note, palmitelaidic acid methyl ester (PAME) and ceramide‐1‐phosphate (C1P) were ranked the first and the second, respectively, among all annotated metabolites induced by OsPep3 (Figure 6d and Figure S8b). PAME is a variant of palmitoleic acid, an unsaturated fatty acid that has been shown to induce defence priming against insect herbivores (Li et al., 2016). C1P is a bioactive phosphorylated sphingolipid that positively regulates cell survival and defence responses (Bi et al., 2014). These findings hinted that fatty acids and derivatives may be key players in OsPep3‐induced BPH resistance in rice.
Figure 6

OsPep3 elicits metabolic changes in rice leaf sheaths. (a) Volcano plot displays differentially produced metabolites with fold change (FC) > 2 and P < 0.01 at 24 h after OsPep3 treatment in five biological replicates. (b) Hierarchical clustering of OsPep3–upregulated metabolites at 24 h post–treatment. The abundances of each metabolite across different samples are shown as Z–scores of their intensity in the metabolome. (c) Fatty acids and derivatives are overrepresented in OsPep3–upregulated metabolites. (d) Palmitelaidic acid methyl ester (PAME) and ceramide–1–phosphate (C1P) represent most highly inducible metabolites by OsPep3. Data are shown as mean ± SD of five biological replicates. **P < 0.01 (Student’s t–test). (e) Joint profiling of metabolomics (left heatmap) and transcriptomics (right heatmap) indicates that the JA biosynthetic pathway is upregulated by OsPep3. The induction fold of each metabolite/gene by OsPep3 is indicated by the colour scale based on the log2 fold change.

OsPep3 elicits metabolic changes in rice leaf sheaths. (a) Volcano plot displays differentially produced metabolites with fold change (FC) > 2 and P < 0.01 at 24 h after OsPep3 treatment in five biological replicates. (b) Hierarchical clustering of OsPep3–upregulated metabolites at 24 h post–treatment. The abundances of each metabolite across different samples are shown as Z–scores of their intensity in the metabolome. (c) Fatty acids and derivatives are overrepresented in OsPep3–upregulated metabolites. (d) Palmitelaidic acid methyl ester (PAME) and ceramide–1–phosphate (C1P) represent most highly inducible metabolites by OsPep3. Data are shown as mean ± SD of five biological replicates. **P < 0.01 (Student’s t–test). (e) Joint profiling of metabolomics (left heatmap) and transcriptomics (right heatmap) indicates that the JA biosynthetic pathway is upregulated by OsPep3. The induction fold of each metabolite/gene by OsPep3 is indicated by the colour scale based on the log2 fold change. By jointly analysing OsPep3‐induced transcriptomic and metabolomic changes in rice, we observed a consensus regarding the upregulation of JA biosynthesis by OsPep3. At the transcript level, most of the genes involved in JA biosynthesis have been upregulated by OsPep3, including OsPLDα4, OsLOX1/6, OsAOS1/2, OsAOC and OsOPR2/7 (Figure 6e). At the metabolic level, the abundances of JA and two intermediate metabolites in its biosynthetic pathway, namely OPDA and 3‐oxo‐2(cis‐2‐pentenyl)‐cyclopentane‐1‐octanoic acid (OPC), were increased to different levels upon OsPep3 elicitation (Figure 6e). These results echoed our earlier observations based on hormone measurements (Figure 4a–c) and supported the notion that the JA pathway contributes to OsPep3‐induced rice resistance to BPH.

Expanded use of OsPep3 in crop protection against fungal and bacterial pathogens

Many OsPep3‐induced genes, such as OsPAL4, OsMYB30, OsRBBI3‐3, OsMAPKK10.2 and OsTHT1 (Figure 5c), have been assigned additional roles in rice resistance to pathogens (Chen et al., 2014; Li et al., 2020; Ma et al., 2021; Shen et al., 2021; Tonnessen et al., 2015), which prompted us to test whether OsPep3 application also improves rice resistance to pathogens. Indeed, we found that OsPep3‐treated ZH11 plants were more resistant than mocked‐treated plants to the fungal pathogen Magnaporthe oryzae, the causal agent of rice blast disease, according to the lesion size and fungal biomass around the infection site (Figure 7a–c). In addition, OsPep3 treatment also rendered ZH11 plants more resistant than untreated plants to the bacterial pathogen Xanthamonas oryzae pv. oryzae (Xoo), the causal agent of rice blight disease, based on the lesion length and bacterial colony counting of infected leaves (Figure 7d–f). These results indicated that exogenous application of OsPep3 also fortifies rice resistance to devastating diseases.
Figure 7

Expanded application of OsPep3 in crop protection. (a) OsPep3 treatment enhances Magnaporthe oryzae resistance in ZH11 plants. Detached leaves of 1–month–old ZH11 plants were pretreated with OsPep3 or mock for 24 h and inoculated with 103 conidia in the presence of OsPep3 for 7 days. Scale bar = 1 cm. (b) Quantification of lesion sizes. Data are shown as mean ± SD of 15 lesions with individual data points shown as dots. **P < 0.01 (Student’s t–test). (c) Quantification of fungal biomass around the infection site. Quantification was based on the qPCR assay of the abundance of fungal Pot2 DNA against that of rice ubiquitin DNA. Data are shown as mean ± SD of three biological replicates. **P < 0.01 (Student’s t–test). (d) OsPep3 treatment enhances Xanthamonas oryzae pv. oryzae (Xoo) resistance in ZH11 plants. Two–month–old rice plants were inoculated with Xoo at OD600 of 0.6 using the leaf–clipping method. OsPep3 or mock was applied by spraying at 12 h before bacterial inoculation and every 12 h after inoculation. Rice blight symptoms were recorded 10 days after inoculation. (e) Quantification of lesion lengths in Xoo–infected leaves. Data are shown as mean ± SD of 20 lesions with individual data points shown as dots. **P < 0.01 (Student’s t–test). (f) Quantification of bacterial growth in Xoo–infected leaves. Data are shown as mean ± SD of 5 leaves with individual data points shown as dots. **P < 0.01 (Student’s t–test). cfu, colony–forming unit. (g) Exogenous application of OsPep3 can elicit ROS burst in wheat. ROS burst was determined for 12 leaves of 14–day–old wheat seedlings using the luminol–based method. flg22 was used as a positive control. (h) Exogenous application of OsPep3 can elicit MAPK activation in wheat. MAPK activation was determined by immunoblotting using anti–ERK antibodies. Rubisco staining indicates equal loading of total proteins.

Expanded application of OsPep3 in crop protection. (a) OsPep3 treatment enhances Magnaporthe oryzae resistance in ZH11 plants. Detached leaves of 1–month–old ZH11 plants were pretreated with OsPep3 or mock for 24 h and inoculated with 103 conidia in the presence of OsPep3 for 7 days. Scale bar = 1 cm. (b) Quantification of lesion sizes. Data are shown as mean ± SD of 15 lesions with individual data points shown as dots. **P < 0.01 (Student’s t–test). (c) Quantification of fungal biomass around the infection site. Quantification was based on the qPCR assay of the abundance of fungal Pot2 DNA against that of rice ubiquitin DNA. Data are shown as mean ± SD of three biological replicates. **P < 0.01 (Student’s t–test). (d) OsPep3 treatment enhances Xanthamonas oryzae pv. oryzae (Xoo) resistance in ZH11 plants. Two–month–old rice plants were inoculated with Xoo at OD600 of 0.6 using the leaf–clipping method. OsPep3 or mock was applied by spraying at 12 h before bacterial inoculation and every 12 h after inoculation. Rice blight symptoms were recorded 10 days after inoculation. (e) Quantification of lesion lengths in Xoo–infected leaves. Data are shown as mean ± SD of 20 lesions with individual data points shown as dots. **P < 0.01 (Student’s t–test). (f) Quantification of bacterial growth in Xoo–infected leaves. Data are shown as mean ± SD of 5 leaves with individual data points shown as dots. **P < 0.01 (Student’s t–test). cfu, colony–forming unit. (g) Exogenous application of OsPep3 can elicit ROS burst in wheat. ROS burst was determined for 12 leaves of 14–day–old wheat seedlings using the luminol–based method. flg22 was used as a positive control. (h) Exogenous application of OsPep3 can elicit MAPK activation in wheat. MAPK activation was determined by immunoblotting using anti–ERK antibodies. Rubisco staining indicates equal loading of total proteins. To date, no Pep has been functionally characterized in wheat. We were wondering whether OsPep3 application is effective for stimulating immune responses in wheat. We found that OsPep3 treatment could also activate ROS burst and MAPK in wheat (Figure 7g,h), albeit to a lower level than those activated by flg22, a potent immunogenic peptide of bacterial flagellin. These findings suggested that OsPep3 is a widely effective immune stimulator for Poaceae crop plants.

Discussion

Although plant defence mechanisms against microbial pathogens have been extensively illustrated, how plants ward off insect foes has been poorly understood, particularly for piercing–sucking insect herbivores (Qi et al., 2018). Unlike chewing herbivores that cause enormous wounding on plant tissues, piercing–sucking insects feed on the phloem sap using the stylet, which minimizes the wounding of host tissues and reduces the contact of plant cells to the insect saliva containing potential HAMPs. This cunning feeding strategy has posed great challenges on the host plants to develop timely and effective defence. Indeed, for BPH, a rice–specific piercing–sucking insect pest, only a mucin–like protein from its saliva has been identified so far as an elicitor of rice immune responses (Shangguan et al., 2018). On the other hand, plants have evolved a smart countermeasure to amplify the invader–induced immunity by producing phytocytokines (Hou et al., 2021). Systemin, the first known phytocytokine, has been found to promote defence responses in Solanaceous plants against the chewing insect herbivore Manduca sexta (Orozco–Cardenas et al., 1993). Later, another class of wounding–induced phytocytokines, plant Peps, has been reported with central roles in defending chewing insect pests (Huffaker et al., 2013; Klauser et al., 2015; Shinya et al., 2018). Unlike systemin that exclusively exists in the Solanaceous family, plant Peps are ubiquitously present across the plant kingdom (Bartels and Boller, 2015), thus bearing increased theoretical and application value. However, it still remains unknown whether plant Peps are important for fighting off piercing–sucking insect herbivores, which cause little wounding upon feeding. In this study, we addressed this open question using the rice–BPH interaction as a model and arrived at a positive answer. Our findings revealed OsPep3 as an essential DAMP of rice for defending BPH, and this notion was supported by multiple lines of evidence. Firstly, OsPep3 was transcriptionally induced in rice tissues suffering BPH attacks (Figure 2e). Secondly, OsPep3 elicitation enhanced rice resistance to BPH (Figure 3). Thirdly, disruption of OsPep3 perception by knockout of OsPEPRs compromised anti–BPH immunity (Figure 1e–g). This study further shed insights on the molecular mechanisms underlying OsPep3–induced BPH resistance in rice. The KEGG analysis of OsPep3–upregulated genes in rice leaf sheaths revealed that the phenylpropanoid pathway is promoted by OsPep3. One of the two final products of phenylpropanoid metabolism is flavonoids (Dong and Lin, 2021), which play crucial roles in defending BPH (Dai et al., 2019; Harun–Or–Rashid et al., 2018). Several flavonoids, including naringenin, sakuranetin, schaftoside, isoschaftoside, rhoifolin and apigenin, have been found to be induced by BPH infestation (Uawisetwathana et al., 2019; Xu et al., 2021). However, we failed to detect the induction of these flavonoids by OsPep3. In addition, OsF3H, which encodes a key enzyme in flavonoid–oriented phenylpropanoid metabolism (Dai et al., 2019; Dong and Lin, 2021), was downregulated by OsPep3. These results indicated that OsPep3–induced BPH resistance is likely independent of flavonoids. The other final product of phenylpropanoid metabolism is lignin, a pivotal component determining the mechanical rigidity of plant secondary cell wall (Dong and Lin, 2021). Lignin has also been thought to enhance BPH resistance in rice (Harun–Or–Rashid et al., 2018; He et al., 2020; Zhang et al., 2017). OsTHT1, which encodes the hydroxycinnamoyl transferase to channel the phenylpropanoid metabolism into lignin biosynthesis (Dong and Lin, 2021), was upregulated by OsPep3 (Figure 5c). Moreover, the OsMYB30–OsPAL4 module, which promotes BPH resistance through lignin biosynthesis (He et al., 2020), was also induced by OsPep3 (Figure 5c). These results suggested that OsPep3 elicitation may facilitate lignin accumulation. Notably, two of the top 15 OsPep3–induced genes, namely OsLTP1.2 and OsLTPG2 (Figure S5), were found to encode lipid transfer proteins that participate in the formation of cuticle and suberin (Tapia et al., 2013), two extracellular barriers protecting plants from biotic stresses. Furthermore, the GO analysis of OsPep3–upregulated genes indicated that a large fraction of these genes encode extracellular components (Figure 5d). Taken together, these results indicated that fortified extracellular defence contributes to OsPep3–induced BPH resistance. The integrated assay of OsPep3–elicited transcriptomic and metabolomic changes in rice leaf sheaths also suggested essential roles of lipid metabolism, especially fatty acids or derivatives, in OsPep3–induced BPH resistance. On the one hand, we found that the JA biosynthetic pathway was transcriptionally upregulated by OsPep3 (Figure 6e) and the abundance of JA was significantly increased after OsPep3 treatment (Figures 4a and 6e). In line with our findings, a recent study has demonstrated that JA biosynthesis can be induced by BPH infestation and disruption of JA biosynthesis or JA–mediated defence pathway impairs BPH resistance (Xu et al., 2021). On the other hand, fatty acids and derivatives were overrepresented in annotated metabolites upregulated by OsPep3. In particular, the unsaturated fatty acid PAME, as the top inducible metabolite by OsPep3 (Figure 6d and Figure S6b), is chemically related to palmitoleic acid that has been documented to have a priming effect on anti–herbivore defence responses in maize when exogenously applied (Li et al., 2016). The fatty acid derivative C1P, as another highly inducible metabolite by OsPep3 (Figure 6d and Figure S6b), has been shown to modulate cell death and immunity in Arabidopsis (Bi et al., 2014). It will be attractive for future studies to investigate whether exogenous application of PAME or C1P also improves BPH resistance in rice. It should be noted that exogenous application of OsPep3 could activate both antixenosis and antibiosis defence mechanisms, which reduced insect settling and feeding, respectively, to defend BPH (Figure 3c,d and Figure S6), whereas knockout of OsPEPR1 and OsPEPR2 failed to exert a prominent effect on insect settling and weight gains (Figures S3 and S4). A plausible explanation for this discrepancy is that the OsPep3–OsPEPR signalling is activated upon BPH infestation but is likely to be subsequently perturbed or weakened by BPH salivary effectors (Cheng et al., 2013a). By contrast, exogenous pretreatment of OsPep3 before BPH infestation not only supplies rice with a high dose of mature elicitors but also maximally induces the defence mechanisms without the perturbation from BPH. These findings underscore the advantages of exogenous application of OsPep3 for rice protection. Overuse of chemical pesticides is currently a prevailing practice in agriculture to control the damage of insect herbivores and pathogens on crops. However, this practice can quickly induce pesticide resistance in those plant opponents. To circumvent this problem, chemical elicitors have recently been invented, which stimulate crop immunity rather than poisoning the pests or pathogens. For instance, exogenous application of furan carbonylhydrazones or bismerthiazol has been demonstrated to improve anti–BPH immunity in rice (Chen et al., 2018; Zhou et al., 2018). Despite the merits of chemical elicitors, their potential adverse impacts on the biodiversity and human health are not fully predictable. In this study, we demonstrated the potential of OsPep3 as an effective immune stimulator in rice (Figure 2c,d) and other Poaceae crops such as wheat (Figure 7g,h). Of note, OsPep3 has particular advantages over chemical elicitors. Firstly, the eliciting activity of OsPep3 is only limited to the Poaceous family (Lori et al., 2015), which minimizes unwanted ecological disturbance. Secondly, OsPep3 is fully digestible for human beings and raises no environmental and food safety concerns. Most importantly, OsPep3 is effective for stimulating rice immunity against chewing (Shinya et al., 2018) or piercing–sucking insect pests (Figure 3) as well as fungal and bacterial pathogens (Figure 7a–f). A potential limitation of OsPep3 in application may be its short lifespan as a peptide. However, this shortcoming can be overcome by developing OsPep3 derivatives with stabilizing chemical modifications or OsPep3–containing nanoparticles (Yao et al., 2018).

Methods

Experimental materials

The rice variety ZH11 (Zhonghua 11) and wheat variety Bainong 207 were used as wild–type plants. Rice plants were routinely grown in a greenhouse with a cycle of 14–h light at 28 °C and 10–h dark at 25 °C. To evaluate the developmental phenotypes, rice seeds of ZH11 or ospepr1pepr2 plants harvested at the same time were surface–sterilized and placed on 1/2 MS agar medium in a plant growth chamber under the conditions described above. A BPH laboratory strain obtained from the Guangdong Academy of Agricultural Sciences, the M. oryzae strain Guy11, and the Xoo strain PXO99A were used in this study.

Generation of plasmids and gene knockout plants

The CRISPR–GE web server (http://skl.scau.edu.cn/targetdesign/) (Xie et al., 2017) was used for designing two gene–specific sgRNAs targeting OsPEPR1 or OsPEPR2 (OsPEPR1–sgRNA1: 5′–TAGCCCTTCTTTCTCTGTCT–3′; OsPEPR1–sgRNA2: 5′–GTGCGCTATACCATAGCTCT–3′; OsPEPR2–sgRNA1: 5′–GCTCAAACTACAACACAATG–3′; OsPEPR2–sgRNA2: 5′–ATCCGCTACAGCATAGCTCT–3′). The binary plasmid pYL–CRISPR/Cas9–OsPEPR1/2 simultaneously expressing these four sgRNAs was constructed according to the Golden Gate ligation procedure described previously (Ma and Liu, 2016). The binary plasmid was transformed into Agrobacterium tumefaciens strain EHA105 cells through electroporation. Agrobacteria containing the plasmid were used for transforming rice callus. Transformed rice callus cells were selected by hygromycin resistance and regenerated into whole plants according to a standard protocol (Hiei et al., 1994). OsPEPR knockout plants were identified by Sanger sequencing of the PCR products spanning the target regions in individual transgenic lines.

Sequence alignment and phylogenetic analyses

Putative plant Pep sequences were obtained by the BLAST analysis (https://blast.ncbi.nlm.nih.gov/) using ZmPep1 (VRRRPTTPGRPREGSGGNGGNHH) as an inquiry sequence. Multiple sequence alignment was performed using the ClustalW algorithm. A phylogenetic tree was generated using the neighbour–joining method via the MEGA software (version 6).

OsPep treatment

OsPep peptides were synthesized by Xinghao Chemical (Wuhan, China) according to the sequences as follows: OsPep1: ARLRPKPPGNPREGSGGNGGHHH; OsPep2: DDSKPTRPGAPAEGSGGNGGAIH; OsPep3: ADSAPQRPGSPAEGAGGNGGAVH; OsPep7: SKPKPEPPGYPREGGGGNGGVVD. The OsPep solution was freshly prepared by dissolving the peptide powder in distilled water to a working concentration of 10 μm before plant application. The detergent silwet L–77 was added to the OsPep solution to a final concentration of 0.05% to facilitate plant penetration. The initial treatment was conducted by submerging the rice leaf sheath into the OsPep solution for 30 s. After BPH infestation, the leaf sheaths were treated by spraying the OsPep solution every 24 h.

ROS burst assay

Twelve leaves from 10–day–old rice or 2–week–old wheat seedlings were used to generate leaf discs of 0.25 cm2 using a hole punch and were incubated in water overnight in a 96–well plate to eliminate the effects of wounding. The next morning water was replaced by 100 μL reaction solution containing 200 μm luminol L–012 (Wako, Japan) and 1 μg horseradish peroxidase (Sigma, St. Louis, MO, USA) supplemented with 10 μm OsPep plus 0.05% silwet L–77 or silwet L–77 only (mock). The luminescence was recorded by a Varioskan Lux luminometer (Thermo, Waltham, MA, USA) for a period of 30 min.

MAPK activation assay

Leaves detached from 10–day–old rice or 2–week–old wheat seedlings were treated with 10 μm OsPep plus 0.05% silwet L–77 or silwet L–77 only (mock) for 15 or 30 min. Treated leaves were ground in liquid nitrogen, and the tissue powder was immediately mixed with the 6 × SDS–PAGE loading buffer and heated at 95 °C for 5 min. Total proteins were resolved in a 10% SDS–PAGE, and MAPK activation was evaluated by immunoblotting using anti–pERK antibodies (Cell Signaling Technology, Beverly, MA, USA).

Protoplast preparation and transfection

Isolation and transfection of rice protoplasts from 10–day–old plants was conducted as previously described (Zhang et al., 2011). Transfected protoplasts were incubated in the dark at room temperature for 12 h for protein expression.

BPH infestation assay

At the four–leaf stage, rice seedlings were infested with BPH nymphs of the third instar at a density of 15 insects per plant. At indicated day post–infestation, individual plants were given a resistance score of 0, 1, 3, 5, 7 or 9 according to the routinely used scoring criteria (Figure S2) (Huang et al., 2001). For the BPH host choice test, two ZH11 seedlings and two ospepr1pepr2 seedlings at the four–leaf stage were grown in a single plastic bucket side–by–side. Forty BPH nymphs of the third instar were released at the centre of the plastic bucket. The number of nymphs on each plant was recorded at 48 h post–infestation. The honeydew and body weight of BPH nymphs were weighed according to a previously described procedure (Pathak et al., 1982). Briefly, thirty BPH nymphs of the third instar were weighed and starved for 2 h. These BPH nymphs were then placed in a pre–weighed Parafilm sachet attached to the leaf sheath. The sachets were removed after 48–h infestation. The BPH nymphs and sachets were weighed separately. The weight difference in the sachets before and after infestation was considered as the honeydew weight, while the change in the insects’ weight was considered as the body weight gain.

RNA–seq and RT–qPCR

Rice leaf sheaths treated with OsPep3 or mock were ground in liquid nitrogen into tissue powder. Total RNA was extracted from tissue powder using the RNApre Pure Plant Plus Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions. For RNA–seq analysis, total RNA was subjected to transcriptome sequencing at the BGI Group (Shenzhen, China). For RT–qPCR, total RNA was converted into first–strand cDNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio, Tokyo, Japan). The qPCR was performed in a LightCycler 96 Instrument (Roche) using TB Green Premix Ex Taq (Takara Bio, Tokyo, Japan). Os18s rRNA was used as the reference gene. The primers used in qPCR are listed in Table S1. The RNA–seq data were analysed using the FastQC algorithm, trimmed using the Trimmomatic algorithm and mapped to Oryza_sativa MSU_7.0 genome via the TopHat2 algorithm. Differential expression analysis was performed using edgeR (Robinson et al., 2010). Differential expression genes (DEGs) were obtained with a cut–off of |log2(FC)| > 1, FDR (false discovery rate) < 0.01. FDR is adjusted P value using the Benjamini–Hochberg’s approach. Volcano plot analysis of DEGs was done in R using the ggplot2 and ggthemes package. Hierarchical clustering was done in R using the pheatmap v.1.0.12 (Pretty Heatmaps) package. Gene ontology (GO) enrichment analysis of the differentially expressed genes was implemented using the g:GOst function on the g:Profiler webserver (Raudvere et al., 2019).

Non–targeted metabolite profiling

Approximately 200 mg of frozen rice leaf sheaths were homogenized in liquid nitrogen and subjected to non–targeted metabolomics analysis at the BGI Group. The BGI’s metabolomic software package metaX and metabolome information analysis process were used for the liquid chromatography–mass spectrometry (LC–MS/MS) data processing, statistical analysis, metabolite classification and function annotation. Molecular masses, retention times and associated peak intensities for each sample were extracted from the raw files. To identify differentially produced metabolites, variable importance in projection score of the first two principal variables in a multivariate PLS–DA model was combined with fold change (FC) and Student’s t–test of univariate analysis. To facilitate the annotation of detected metabolites, the metabolite information (e.g. accurate m/z and possible chemical formula) was searched against different databases, including HMDB, KEGG, m/z Cloud, PubChem and ChemSpider. Metabolite data sets in positive and negative ionization modes were merged to a single data set following the previously proposed method (Calderón–Santiago et al., 2016). The volcano analysis and hierarchical clustering of differentially expressed metabolites were performed using the MetaboAnalyst5.0 software (https://www.metaboanalyst.ca/MetaboAnalyst/).

Phytohormone measurements

Phytohormone measurements were conducted as described earlier (Huang et al., 2021). Briefly, approximately 200 mg of frozen rice leaf sheaths was ground in liquid nitrogen. The powdered samples were dissolved in the extraction buffer (isopropanol: deionized water: HCl, 2: 1: 0.002 [v/v/v]) with internal standards (2H5–JA and 2H4–SA, Olchemin). After gently mixing samples for 30 min, dichloromethane was added. The samples were shaken at 4 °C for 30 min and subsequently centrifuged at 13 000 g for 5 min. The solvent from the lower phase was collected into a fresh tube and dried using a nitrogen evaporator. The samples were dissolved in 60% methanol. Each sample of 10 μL was injected into a C18 column and analysed using the AB SCIEX Triple TOF 5600+ system as described previously (Yuan et al., 2017).

M. oryzae infection assay

The fungal isolate was grown on oat meal agar for producing spores. Spores were collected by flooding the fungal cultures with sterile water, and the spore concentration in the suspension was adjusted to 2 × 105 conidia/mL. Punch inoculation was performed as previously described (Li et al., 2017). Briefly, detached leaves from 1–month–old rice plants were pretreated with 10 μm OsPep3 or mock for 24 h. Spore suspension of 5 μL was dropped at two separate spots on each leaf. The leaves were subsequently kept in a culture dish that contained sterile water supplemented with 0.1% 6–benzylaminopurine and OsPep3 or mock. The lesion sizes were photographed and measured using the Image–Pro Plus 7 (https://www.mediacy.com/imageproplus) at 7 days post–inoculation. Fungal biomass was quantified through the DNA–based qPCR assay of the abundance of M. oryzae Pot2 DNA against that of rice ubiquitin DNA (Park et al., 2012). The primers used in qPCR are listed in Table S1.

Xoo infection assay

The Xoo strain PXO99A was grown on the potato–sucrose medium (HB8712, Hopebiol, Qingdao, China) at 28 °C for 3 days. The bacterial colonies were suspended with sterile water and diluted to OD600 of 0.6 for inoculation. Two–month–old rice plants were inoculated using the leaf–clipping method as previously described (Kauffman et al., 1973). OsPep3 at 10 μm or mock was applied by spraying at 12 h before bacterial inoculation and every 12 h after inoculation. Disease was scored by measuring the lesion length 10 days after inoculation at 28 °C. Bacterial growth in rice leaves was measured by counting the colony–forming units (cfu) as previously described (Sun et al., 2004). Briefly, the infected leaves were detached and sterilized with 75% ethanol and then homogenized in sterile water. The bacteria in resulting homogenates were recovered on the potato–sucrose medium and the colonies were counted.

Statistical analysis

Standard statistical analyses were conducted using the GraphPad Prism 8.0 software, San Diego, CA, USA. For multiple comparisons, the one–way of variance (ANOVA) with the post hoc Tukey test was used. For two–sample unpaired comparisons, Student’s t–test was used.

Conflicts of interest

The authors have filed a patent based on the results reported in this study.

Author contributions

J.–F.L. conceived and supervised this study. W.S. performed most of the experiments. X.Z. conducted hormone measurements. J.L. assisted the assays of OsPep–induced ROS burst and MAPK activation. K.T. assisted bioinformatics analysis. C.L. assisted the Xoo infection assay. W.S., J.–F.L., S.X. and W.Z. analysed the data. J.–F.L. wrote the manuscript. Figure S1 OsPEPR knockout does not cause obvious developmental defect in rice. Figure S2 The criteria used for calculating the BPH resistance score. Figure S3 OsPEPR knockout does not increase rice attractiveness to BPH. Figure S4 BPH nymphs feed equally on ZH11 or OsPEPR knockout plants. Figure S5 Peps from plant species of the same family tend to be more closely related. Figure S6 OsPep3 treatment reduces the feeding of BPH on rice. Figure S7 Top 15 most highly inducible genes by OsPep3 in rice leaf sheaths. Figure S8 Top 10 most highly inducible metabolites by OsPep3 in rice leaf sheaths. Table S1 The qPCR primers used in this study. Click here for additional data file.
  66 in total

Review 1.  Fatty Acid- and Lipid-Mediated Signaling in Plant Defense.

Authors:  Gah-Hyun Lim; Richa Singhal; Aardra Kachroo; Pradeep Kachroo
Journal:  Annu Rev Phytopathol       Date:  2017-08-04       Impact factor: 13.078

2.  A gene cluster encoding lectin receptor kinases confers broad-spectrum and durable insect resistance in rice.

Authors:  Yuqiang Liu; Han Wu; Hong Chen; Yanling Liu; Jun He; Haiyan Kang; Zhiguang Sun; Gen Pan; Qi Wang; Jinlong Hu; Feng Zhou; Kunneng Zhou; Xiaoming Zheng; Yulong Ren; Liangming Chen; Yihua Wang; Zhigang Zhao; Qibing Lin; Fuqing Wu; Xin Zhang; Xiuping Guo; Xianian Cheng; Ling Jiang; Chuanyin Wu; Haiyang Wang; Jianmin Wan
Journal:  Nat Biotechnol       Date:  2014-12-08       Impact factor: 54.908

3.  Damage on plants activates Ca2+-dependent metacaspases for release of immunomodulatory peptides.

Authors:  Tim Hander; Álvaro D Fernández-Fernández; Robert P Kumpf; Patrick Willems; Hendrik Schatowitz; Debbie Rombaut; An Staes; Jonah Nolf; Robin Pottie; Panfeng Yao; Amanda Gonçalves; Benjamin Pavie; Thomas Boller; Kris Gevaert; Frank Van Breusegem; Sebastian Bartels; Simon Stael
Journal:  Science       Date:  2019-03-22       Impact factor: 47.728

4.  Transplastomic Nicotiana benthamiana plants expressing multiple defence genes encoding protease inhibitors and chitinase display broad-spectrum resistance against insects, pathogens and abiotic stresses.

Authors:  Peng-Jen Chen; Rajendran Senthilkumar; Wann-Neng Jane; Yong He; Zhihong Tian; Kai-Wun Yeh
Journal:  Plant Biotechnol J       Date:  2014-01-30       Impact factor: 9.803

Review 5.  Pivoting the plant immune system from dissection to deployment.

Authors:  Jeffery L Dangl; Diana M Horvath; Brian J Staskawicz
Journal:  Science       Date:  2013-08-16       Impact factor: 47.728

6.  Identification and characterization of Bph14, a gene conferring resistance to brown planthopper in rice.

Authors:  Bo Du; Weilin Zhang; Bingfang Liu; Jing Hu; Zhe Wei; Zhenying Shi; Ruifeng He; Lili Zhu; Rongzhi Chen; Bin Han; Guangcun He
Journal:  Proc Natl Acad Sci U S A       Date:  2009-12-14       Impact factor: 11.205

7.  Characterization of heat shock protein 70 transcript from Nilaparvata lugens (Stål): Its response to temperature and insecticide stresses.

Authors:  Kai Lu; Xia Chen; Wenting Liu; Zhichao Zhang; Ying Wang; Keke You; Yue Li; Rongbin Zhang; Qiang Zhou
Journal:  Pestic Biochem Physiol       Date:  2017-02-17       Impact factor: 3.963

8.  Bph32, a novel gene encoding an unknown SCR domain-containing protein, confers resistance against the brown planthopper in rice.

Authors:  Juansheng Ren; Fangyuan Gao; Xianting Wu; Xianjun Lu; Lihua Zeng; Jianqun Lv; Xiangwen Su; Hong Luo; Guangjun Ren
Journal:  Sci Rep       Date:  2016-11-23       Impact factor: 4.379

9.  The Commonly Used Bactericide Bismerthiazol Promotes Rice Defenses against Herbivores.

Authors:  Pengyong Zhou; Xiaochang Mo; Wanwan Wang; Xia Chen; Yonggen Lou
Journal:  Int J Mol Sci       Date:  2018-04-24       Impact factor: 5.923

10.  Overexpression of OsRRK1 Changes Leaf Morphology and Defense to Insect in Rice.

Authors:  Yinhua Ma; Yan Zhao; Xinxin Shangguan; Shaojie Shi; Ya Zeng; Yan Wu; Rongzhi Chen; Aiqing You; Lili Zhu; Bo Du; Guangcun He
Journal:  Front Plant Sci       Date:  2017-10-24       Impact factor: 5.753

View more
  4 in total

Review 1.  Reactive oxygen species in plants: an invincible fulcrum for biotic stress mitigation.

Authors:  Shaily Tyagi; Anshuman Shah; Kesiraju Karthik; Maniraj Rathinam; Vandna Rai; Nidhee Chaudhary; Rohini Sreevathsa
Journal:  Appl Microbiol Biotechnol       Date:  2022-09-05       Impact factor: 5.560

Review 2.  Molecular and Biochemical Mechanisms of Elicitors in Pest Resistance.

Authors:  Saif Ul Malook; Saiqa Maqbool; Muhammad Hafeez; Samantha Chandranath Karunarathna; Nakarin Suwannarach
Journal:  Life (Basel)       Date:  2022-06-06

3.  BoPEP4, a C-Terminally Encoded Plant Elicitor Peptide from Broccoli, Plays a Role in Salinity Stress Tolerance.

Authors:  Anyi Wang; Jingsong Guo; Sibo Wang; Ying Zhang; Fangfang Lu; Jingbin Duan; Zhao Liu; Wei Ji
Journal:  Int J Mol Sci       Date:  2022-03-13       Impact factor: 5.923

4.  Plant elicitor peptide signalling confers rice resistance to piercing-sucking insect herbivores and pathogens.

Authors:  Wenzhong Shen; Xue Zhang; Jiuer Liu; Kehan Tao; Chong Li; Shi Xiao; Wenqing Zhang; Jian-Feng Li
Journal:  Plant Biotechnol J       Date:  2022-02-18       Impact factor: 13.263

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.