| Literature DB >> 35058782 |
Huan Zhou1,2,3, Xingyu Zhu1,2, Yan Yao4, Yue Su1,3, Jing Xie1, Minhui Zhu1,2, Cuixia He1,2, Jiaxiang Ding1,3, Yuanyuan Xu1,2, Rongfang Shan1,2, Ying Wang1,2, Xiangdi Zhao1,2, Yuzhou Ding1, Bingyan Liu1, Zhonghuan Shao1, Yuanyuan Liu1, Tao Xu4, Yunqiu Xie1.
Abstract
Objective: To clarify the molecular mechanism of TMEM88 regulating lipid synthesis and metabolism cytokine in NAFLD.Entities:
Keywords: AML-12 cells; FFA; TMEM88; Wnt/β-catenin; lipid metabolism
Year: 2022 PMID: 35058782 PMCID: PMC8764240 DOI: 10.3389/fphar.2021.798735
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primer sequences for quantitative real-time reverse transcription polymerase chain reaction.
| Gene | Primer pair | |
|---|---|---|
| TMEM88 | F:5′-GCGCTAGCATGGCGGATGGCCCCAGG -3′ | R:5′-GCGCGGCCGCTTAGGCTTCATTTGTCTTTTCTTCAG-3′ |
| SREBP-1c | F:5′-GCAGCAACGGGACCATTCT -3′ | R:5′- CCCCATGACTAAGTCCTTCAACT -3′ |
| PPAR-α | F:5′- AACATCGAGTGTCGAATATGTGG -3′ | R:5′- CCGAATAGTTCGCCGAAAGAA -3′ |
| FASN | F:5′- GGAGGTGGTGATAGCCGGTAT -3′ | R:5′- TGGGTAATCCATAGAGCCCAG -3′ |
| ACOX-1 | F:5′- TAACTTCCTCACTCGAAGCCA -3′ | F:5′- AGTTCCATGACCCATCTCTGTC -3′ |
| β-actin | F:5′-GCCAACACAGTGCTGTCTGG-3′ | R:5′-CTCAGGAGGAGCAATGATCTTG-3′ |
FIGURE 1TMEM88 expression was suppressed in NAFLD model. (A) The H&E stain in liver tissues. Fat vacuoles and intercellular spaces dilatation were appeared in NAFLD liver tissues, while the normal liver tissues indicated that normal lobular architecture. (B) Immunohistochemistry indicated that the expression of TMEM88 was reduced in MCD-fed mice liver tissues of (C). The serum levels of ALT and AST in the MCD-fed group were increased. (D,E) RNA and protein results showed that compared with the normal group, TMEM88 was inhibited in MCD-fed mice. (Data are represented by at least three independent mean ± SD, *p < 0.05, **p < 0.01 vs normal group).
FIGURE 2Expression level of lipid metabolism cytokine in MCD-fed mice. (A,B) The mRNA and protein expression levels of FASN and SERBP-1C were increased. PPAR-α and ACOX-1 expression were decreased in NAFLD liver tissues. (Data are represented by at least three independent mean ± SD, *p < 0.05, **p < 0.01 vs normal group).
FIGURE 3FFA inhibited TMEM88 expression in AML-12 cells. (A) The oil red stains in AML-12 cells and FFA-induced AML-12 cells. The results showed that fat granules appear in the FFA-induced cell model. (B) Viability of AML-12 cells at different FFA concentrations. (C) TMEM88 protein expression level was significantly reduced, after being induced with 2 mM FFA. (D) A significant reduction of the expression level of TMEM88 protein was significantly reduced after FFA was stimulated with 24 h. (E) TMEM88 mRNA expression levels in FFA-induced AML-12 cells after pEGFP-C1-TMEM88 and TMEM88 siRNA transfection. (F) TMEM88 protein expression levels in FFA-induced AML-12 cells after transfected with pEGFP-C1-TMEM88 and TMEM88 siRNA. (The data are represented by at least three independent mean ± SD, *p < 0.05, **p < 0.01 vs normal group. # p < 0.05, ## p < 0.01 vs control group).
FIGURE 4Silencing or overexpression of TMEM88 regulated the lipid metabolism in FFA-induced AML-12 cells (A) When TMEM88 was overexpressed, the expression levels of FASN and SREBP-1c decreased. In contrast, (B) When TMEM88 was silenced, the expression levels of FASN and SREBP-1c were upregulated. (Data are represented by at least three independent mean ± SD, *p < 0.05 vs normal group, # p < 0.05, ## p < 0.01 vs control group).
FIGURE 5Silencing or overexpression of TMEM88 regulated the lipid metabolism in FFA-induced AML-12 cells. (A) The results of RT-qPCR and Western blotting showed that transfection of TMEM88 siRNA downregulated the expression levels of PPAR-α and ACOX-1. Conversely, (B) pEGFP-C1-TMEM88 upregulated the expression levels of PPAR-α and ACOX-1. (The data are represented by at least three independent mean ± SD, *p < 0.05 vs normal group, # p < 0.05 vs control group).
FIGURE 6TMEM88 inhibited the proliferation of AML-12 cells stimulated by FFA. (A) Edu staining detected the effect of TMEM88 on the proliferation of AML-12 cells stimulated by FFA. The image of AML-12 cells stained by Edu (red) represents cell proliferation, and Hochest (blue) was used to mark the cell nucleus.
FIGURE 7Apoptosis of AML-12 cells induced was inhibited by FFA. (A,B) Flow cytometer results indicated that the expression of TMEM88 was positively correlated with AML-12 cell apoptosis. (The data are represented by at least three independent mean ± SD, *p < 0.05, **p < 0.01 vs control group).
FIGURE 8Expression of β-catenin and related signaling pathways in FFA-induced AML-12 cells. (A,B) The Wnt/β-catenin, c-myc, and cyclin D1 signaling pathways were elevated in FFA-induced AML-12 cells. (C) The downregulated of β-catenin can promote lipid metabolism. (The data are represented by at least three independent mean ± SD, *p < 0.05 vs control group, # p < 0.05 vs siRNA+β-catenin inhibitor group).