Literature DB >> 35035251

Construction of a CRISPR/Cas9-Mediated Genome Editing System in Lentinula edodes.

Suyun Moon1, Jee Young An2, Yeon-Jae Choi3, Youn-Lee Oh4, Hyeon-Su Ro3, Hojin Ryu1.   

Abstract

CRISPR/Cas9 genome editing systems have been established in a broad range of eukaryotic species. Herein, we report the first method for genetic engineering in pyogo (shiitake) mushrooms (Lentinula edodes) using CRISPR/Cas9. For in vivo expression of guide RNAs (gRNAs) targeting the mating-type gene HD1 (LeA1), we identified an endogenous LeU6 promoter in the L. edodes genome. We constructed a plasmid containing the LeU6 and glyceraldehyde-3-phosphate dehydrogenase (LeGPD) promoters to express the Cas9 protein. Among the eight gRNAs we tested, three successfully disrupted the LeA1 locus. Although the CRISPR-Cas9-induced alleles did not affect mating with compatible monokaryotic strains, disruption of the transcription levels of the downstream genes of LeHD1 and LeHD2 was detected. Based on this result, we present the first report of a simple and powerful genetic manipulation tool using the CRISPR/Cas9 toolbox for the scientifically and industrially important edible mushroom, L. edodes.
© 2021 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group on behalf of the Korean Society of Mycology.

Entities:  

Keywords:  CRISPR/Cas9; HD1; Lentinula edodes; gene editing

Year:  2021        PMID: 35035251      PMCID: PMC8725921          DOI: 10.1080/12298093.2021.2006401

Source DB:  PubMed          Journal:  Mycobiology        ISSN: 1229-8093            Impact factor:   1.858


Lentinula edodes is one of the most widely cultivated edible mushrooms in the world and has great value as a food, seasoning, and pharmacological ingredient. In addition, it has shown promise as a potential cell factory capable of producing a variety of valuable enzymes and organic substances [1,2]. Over the course of domestication of L. edodes, several genetic traits including high yield, faster growth rate, color, and specific temperature optima for fruiting body formation have been selected [3]. Despite its importance in the food and industrial markets, proper tools for genetic manipulation, such as genome editing, have not been developed in this important mushroom for use in the research and industrial fields. The CRISPR/Cas9 system, one of the most powerful and revolutionary genome editing tools, has been used to precisely manipulate the genome of various organisms [4]. In this genome editing system, 20-bp of gRNA recognizes a target sequence that follows a 5′-NGG motif, called a protospacer-adjacent motif (PAM), and Cas9 endonuclease induces a double-strand break (DSB) 3-4 nucleotides upstream of the PAM. This genomic DNA cleavage event is usually repaired by either the nonhomologous end-joining (NHEJ) or homologous recombination (HR) DNA repair system. NHEJ allows for NHEJ-mediated gene disruption with base-pair insertions or deletions, which often results in mutations at the target site due to errors during the repair process. The HR system introduces precise genome editing with appropriate donor DNA. This methodology has recently been successfully used in numerous eukaryotic organisms [5-7]. However, relative to animals or plants, only anecdotal cases of genome editing by CRISPR have been reported in mushroom-forming fungi, including Coprinopsis cinerea [8], Cordyceps militaris [9], Schizophyllum commune [10], Ganoderma lucidum [11], Pleurotus eryngii [12], and Pleurotus ostreatus [13]. The limited availability of genome editing techniques for useful mushroom species has been an obstacle that has prevented advances in the field of genetic and molecular breeding research using fungi. In this study, we successfully developed and used the CRISPR/Cas9 genome editing system in L. edodes. By identifying the appropriate U6 and active GPD promoters from the L. edodes genome, we constructed a generic CRISPR/Cas9 plasmid toolkit. Using a PEG-mediated protoplast transformation method, we confirmed that the genome editing toolbox successfully induces target genome editing in this mushroom. To prepare proper fungal mycelial materials, the L. edodes cultivar strain Sanjo705 was provided by the Forest Mushroom Research Center (https://www.fmrc.or.kr/). Monokaryotic strains (referred to as Sanjo705-3 and Sanjo705-13) isolated from the spores of Sanjo705 were used as the recipient strains for fungal transformation of CRISPR/Cas9 constructs and further mating assays. The vegetative mycelia of L. edodes were cultured on potato dextrose agar (PDA) and grown at 25 °C in the absence of light. For identification of a U6 gene promoter-like sequence and subsequent gRNA design, Homo sapiens RNU6-1 (GenBank X07425.1) was used as the query to search for homologs in the L. edodes genomic database. A 98.2% identical match was found and named LeU6 snRNA. A 500-bp sequence upstream of the pLeU6 mRNA coding region was aligned with the promoter sequences of H. sapiens RNU6-1 (hRNU6-1). Sequence comparison between hRNU6-1 and LeU6s was carried out by the T-Coffee multiple alignment algorithm in SnapGene® software. To mutate HD1, guide RNAs were designed based on their location in the gene and their GC content. Eight pairs of gRNA spacer sequences are listed in Table 1.
Table 1.

DNA sequences of gRNA spacer used in this study.

gRNA nameForward sequence (5′ to 3′)Reverse sequence (5′ to 3′)
gRNA-1GATTGCTCGCTAGCTATCGGTGTCAAAACTGACACCGATAGCTAGCGAGC
gRNA-2GATTGACTTCTCTGTGATGCCTTCTAAACAGAAGGCATCACAGAGAAGTC
gRNA-3GATTGTTGTAGTTGTAAATCCAAGAAAACTCTTGGATTTACAACTACAAC
gRNA-4GATTGTCCTCCTCCCAACTCCCAAGAAACCTTGGGAGTTGGGAGGAGGAC
gRNA-5GATTGAGGATGGGAGGTTGCCACTTAAACAAGTGGCAACCTCCCATCCTC
gRNA-6GATTGTAGGATGGGAGGTTGCCACTAAACAGTGGCAACCTCCCATCCTAC
gRNA-7GATTGACATCCCGCCCTCCTACACCAAACGGTGTAGGAGGGCGGGATGTC
gRNA-8GATTGTTGGAGAGGAGCCAGGTGTAAACACACCTGGCTCCTCTCCAAC

Additional sequences for ligation with linearized vector by AarI are highlighted in bold.

DNA sequences of gRNA spacer used in this study. Additional sequences for ligation with linearized vector by AarI are highlighted in bold. For plasmid construction, cloning of desirable DNA fragments into the vector backbone was performed using T4 DNA ligase and standard ligation protocols (Enzynomics, Daejeon, Korea). The backbone plasmid, pHAtC, was acquired from Addgene (plasmid # 78098). The promoter sequences for L. edodes glyceraldehyde-3-phosphate dehydrogenase (gpd) and U6 were amplified using the primer pairs pLegpd-F (5′-AAGGCCTTCGATATCAGTCAGATTGTCA-3′) with pLegpd-R (5′-GACTAGTGGCCTGAATAGACATGGAAT-3′) and pLeU6-F (5′-GGAATTCCACTTCGCCGATGCGAAATA-3′) with pLeU6-R (5′-CCGCTCGAGACACCTGCCTCCAATCATTGATGAACTACTTAACAATCAG-3′), respectively. After the U6 promoter was cloned into the XhoI–EcoRI site of pHAtC, the plasmid was linearized using StuI and SpeI, and the gpd promoter sequence was ligated between these restriction sites. The annealed oligo DNA fragments corresponding to the HD1 gRNA target were inserted into the AarI site between pLeU6 and the gRNA scaffold sequence to yield a sgRNA/Cas9 binary vector for use in L. edodes. Isolation and transformation of L. edodes protoplasts were performed as described previously [14]. Briefly, the mycelia cultured in potato dextrose broth (PDB) for 10 days were digested in a 2.5% Lysing Enzyme (Sigma-Aldrich, St. Louis, MO, USA) solution to isolate protoplasts. The protoplasts were suspended in 0.6 M sucrose and adjusted to a final concentration of approximately 107 cells/mL. For fungal transformation, 106 protoplast cells were incubated with 20 µg plasmid DNA on ice for 5 min. Next, 100 µL of PTC solution (40% polyethylene glycol 4000, 10 mM Tris-HCl, pH 7.5, and 50 mM CaCl2) was added. After incubation at room temperature for 5 min, 600 µL of 0.6 M sucrose was added and mixed by inverting. Plasmids containing eight different guide DNA sequences were pooled into two groups (gRNA-1, gRNA-2, and gRNA-3 or gRNA-4, gRNA-5, gRNA-6, gRNA-7, and gRNA-8) and used for transformation. After a month of incubation on regeneration plates, each transformed mycelium was isolated and cultured on PDA for 10 d. Transformed protoplasts were spread on regeneration plates (PDA containing 0.6 M sucrose and 30 µg/mL hygromycin B). Genomic DNA extracted from each transformant was used as a template for amplification of the hygromycin phosphotransferase (hpt) and HD1 genes. The primer pairs HPT-F (5′- GATGCCTCCGCTCGAAGTAGCG-3′) with HPT-R (5′-GCATCTCCCGCCGTGCAC-3′) and HD1-F (5′-TCGTCTACTCACCTCCCTCG-3′) with HD1-R (5′- TCCGCGTCTTATACTTCGGC-3′) were used for HPT or HD1 amplification, respectively. The PCR products for HD1 from each transformant were analyzed using Sanger sequencing. To confirm the mating phenotype of hd1-Cas9 strains, PDA was used for cocultivation with a paired mating strain (SJ705-3). Sections of agar containing hyphae were placed close to each other on PDA plates and incubated at 25 °C for 2–3 weeks. For microscopic analysis, the dikaryotic mycelia produced were scraped into 100 µL of water and were disrupted by vortexing. The mycelia were stained with an equivalent mixture of 10% potassium hydroxide and calcofluor white (Sigma-Aldrich). The stained mycelia were examined under a Nikon Eclipse Ti-U (or PhotoFluor LM-75 for fluorescence) inverted microscope. Images were captured using a Nikon DS-Ri2 camera with NIS Elements software. L. edodes was grown in 50 mL of PDB for 10 d at 25 °C. The mycelia were collected by centrifugation for 10 min and were ground in liquid nitrogen to obtain a mycelial powder. Total RNA was extracted from the ground mycelia using the TaKaRa MiniBEST Universal RNA Extraction Kit (Takara Bio, Shiga, Japan). The obtained RNA was used for cDNA synthesis using the TOPscript cDNA Synthesis Kit (Enzynomics, Daejeon, Korea). Real-time PCR (qPCR) analyses of the target gene were performed using FastStart Essential DNA Green Master (Roche, Basel, Switzerland) and specific primer sets [15]. The qPCR conditions were as follows: 5 min at 95 °C for initial denaturation followed by 40 cycles of 30 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. Relative expression was calculated based on the difference in Cq value (2–ΔΔCq) between a target gene and a reference gene (β-tubulin). To characterize the LeU6 promoter, a region conserved between the human and yeast RNU6 gene was examined in the B17 monokaryon genome [16]. Five putative RNU6 sequences (LeU6-2, -3, -5, -8, and -9) were identified, and the sequences are highly conserved (Figure 1(A)). To identify an effective U6 promoter, the region 500 bp upstream of the LeU6 transcription start site (TSS) was examined for elements such as a TATA-box. Two out of five potential promoters (pLeU6-8 and pLeU6-9) contain TATA-box-like consensus sequences (5′-TATA(A/T)A(A/T)-3′) around the −50 bp range (Figure 1(B)). Therefore, pLeU6-9 was chosen as the promoter for sgRNA expression.
Figure 1.

Comparison between human U6 and Lentinula edodes U6 small nuclear RNAs. (A) Multiple sequence alignment between human and L. edodes U6 gene. HsU6, human U6. 5 highly-conserved sequences were identified in scaffold 2, 3, 5, 8 and 9 in B17 genome [16]. (B) Putative TATA box in pLeU-8 and pLeU-9 promoter region (red box). TSS, Transcriptional Start Site (blue arrow).

Comparison between human U6 and Lentinula edodes U6 small nuclear RNAs. (A) Multiple sequence alignment between human and L. edodes U6 gene. HsU6, human U6. 5 highly-conserved sequences were identified in scaffold 2, 3, 5, 8 and 9 in B17 genome [16]. (B) Putative TATA box in pLeU-8 and pLeU-9 promoter region (red box). TSS, Transcriptional Start Site (blue arrow). Using the identified LeU6 promoter, we constructed a simple CRISPR/Cas9 genome editing plasmid vector system (Figure 2(A)). To properly express the Cas9 protein, we used a constitutively active Legpd promoter [14]. The mating type genes in L. edodes, a heterothallic basidiomycete, consist of two unlinked loci, identified as LeAs (HD1 and HD2) and LeBs [17,18]. We targeted the gene LeHD1 for genome editing, designed eight gRNAs, and constructed sgRNA expression vectors (Figure 2(B)). We then pooled the resultant eight vectors into two groups and transformed them into the protoplasts of monokaryotic L. edodes (SJ 705). To select for transformed protoplasts, we grew the regenerated transformants on hygromycin-containing PDA plates. The genomes of the selected transformants were further confirmed after PCR amplification of the HPT gene, and Sanger sequencing analysis of the sgRNA target regions was performed (Figure 2(C)). Over 100 transformants were selected and initially screened using the PCR product size of the HD1 gene (Figure 3(A)). Among the tested transformants, we selected two CR-Lehd1 mutants with a slightly smaller PCR product size (hd1-1 and hd1-2) (Figure 3(A)). Sanger sequencing identified a 2-bp (hd1-1) and 33-bp (hd1-2) deletion mutation for the two hd1 alleles (Figure 3(B)), which indicates that successful genome editing by the CRSPR/Cas9 system with three active sgRNAs (gRNA1, 2 and 7) occurred in the L. edodes genome.
Figure 2.

Establishment of CRISPR/Cas9 gene editing system through plasmid DNA transformation in Lentinula edodes protoplasts. (A) Schematic diagram of the sgRNA/Cas9 binary vector. pLegpd, promoter of a glycerol-3-phosphate dehydrogenase gene from L. edodes. pNOS, promoter of a nospaline synthase gene. HPT, the hygromycin phosphotransferase gene. (B) Target sites for eight sgRNAs targeting HD1. The gene structure (upper) and partial abbreviate sequence (lower) of HD1 were shown. The homeodomain and sgRNAs were represented as a black box and arrows, respectively. PAM sites (5′-NGG-3′) were indicated red at the end of each spacer sequence. (C) Experimental design and workflow of the CRISPR/Cas9 gene-editing via PEG mediated DNA transformation.

Figure 3.

Targeted mutagenesis of HD1 gene using CRISPR/Cas9 system. (A) PCR amplification of HD1 and HPT gene in genomic DNA of wild type and transformants, hd1-2 and hd1-1. (B) Sanger sequencing of the wild type and HD1 transformants. Locations that cleaved by CAS9 endonuclease and mutated were shown in red boxes and arrowheads. Dashes indicate deleted nucleotides, bolded and underlined sequences represent spacer sequence and PAM motif of sgRNA, respectively. (C) Mating assay and dikaryotic clamp cell connection of hd1 mutants. Dikaryotic hyphae were stained with a calcofluor white. Scale bar = 20um. (D) Real-time qRT-PCR analysis of CLP1, ZNF2, priA, HD1 and HD2 transcript levels in the hd1-1 mutant. Error bars indicate SE of the mean (n = 3; **p < 0.01; Student’s t-test).

Establishment of CRISPR/Cas9 gene editing system through plasmid DNA transformation in Lentinula edodes protoplasts. (A) Schematic diagram of the sgRNA/Cas9 binary vector. pLegpd, promoter of a glycerol-3-phosphate dehydrogenase gene from L. edodes. pNOS, promoter of a nospaline synthase gene. HPT, the hygromycin phosphotransferase gene. (B) Target sites for eight sgRNAs targeting HD1. The gene structure (upper) and partial abbreviate sequence (lower) of HD1 were shown. The homeodomain and sgRNAs were represented as a black box and arrows, respectively. PAM sites (5′-NGG-3′) were indicated red at the end of each spacer sequence. (C) Experimental design and workflow of the CRISPR/Cas9 gene-editing via PEG mediated DNA transformation. Targeted mutagenesis of HD1 gene using CRISPR/Cas9 system. (A) PCR amplification of HD1 and HPT gene in genomic DNA of wild type and transformants, hd1-2 and hd1-1. (B) Sanger sequencing of the wild type and HD1 transformants. Locations that cleaved by CAS9 endonuclease and mutated were shown in red boxes and arrowheads. Dashes indicate deleted nucleotides, bolded and underlined sequences represent spacer sequence and PAM motif of sgRNA, respectively. (C) Mating assay and dikaryotic clamp cell connection of hd1 mutants. Dikaryotic hyphae were stained with a calcofluor white. Scale bar = 20um. (D) Real-time qRT-PCR analysis of CLP1, ZNF2, priA, HD1 and HD2 transcript levels in the hd1-1 mutant. Error bars indicate SE of the mean (n = 3; **p < 0.01; Student’s t-test). For proper mating of two comparative monokaryotic strains of L. edodes, the heterodimeric HD1/2 complex controls downstream events including nuclear pairing, clamp connection, and coordination of nuclear division [19]. Because we successfully obtained two putative loss-of-function alleles of HD1, we next tested the mating processes of the hd1 mutants with a comparative monokaryotic strain (SJ705-3). Surprisingly, all of the loss-of-function CR-hd1 mutants exhibited a normal mating phenotype with well-established clamp connections (Figure 3(C)). However, the downstream target genes of the HD1/2 complex in the mating processes, including CLP1 and priA, were significantly downregulated in the hd1-1 mutant mycelial tissue (Figure 3(D)). The 2-bp deletion in the hd1-1 mutant also resulted in the suppression of HD1 transcription, but not that of HD2 or ZNF2 (Figure 3(D)). These results suggest that the transcription of critical mating-related genes was impaired by the CRISPR/Cas9-mediated deletion mutation in the HD1 gene. In addition, other mating-related systems are likely integrated into the canonical HD1/2-mediated transcriptional network to ensure proper mating occurs in L. edodes. In this study, we present the first development of an efficient CRISPR/Cas9-based genome editing tool kit for the important edible mushroom, L. edodes. The identified endogenous LeU6 promoter drives the expression of sgRNAs in L. edodes cells, and the Cas9 proteins are targeted to the sgRNA genome binding sites to produce double-strand breaks (DSBs). In addition, our PEG-mediated protoplast transformation system can be efficiently used for the high throughput screening of active sgRNAs in this mushroom. Based on the system reported in this study, future studies can focus on developing marker-free gene mutagenesis using a Cas9/sgRNA ribonucleoprotein (RNP) complex. Furthermore, CRISPR/Cas9-assisted gene replacement via homology-directed repairs could be used for proper gene insertion into the genome. These biotechnological approaches will be necessary for the future development of mushroom breeding technologies.
  18 in total

1.  Cloning of the Lentinula edodes B mating-type locus and identification of the genetic structure controlling B mating.

Authors:  Lin Wu; Arend van Peer; Wenhua Song; Hong Wang; Mingjie Chen; Qi Tan; Chunyan Song; Meiyan Zhang; Dapeng Bao
Journal:  Gene       Date:  2013-09-09       Impact factor: 3.688

Review 2.  Recent advances in genome editing of stem cells for drug discovery and therapeutic application.

Authors:  Jaesuk Lee; Delger Bayarsaikhan; Govigerel Bayarsaikhan; Jin-Soo Kim; Elizabeth Schwarzbach; Bonghee Lee
Journal:  Pharmacol Ther       Date:  2020-02-13       Impact factor: 12.310

Review 3.  Development of fungal cell factories for the production of secondary metabolites: Linking genomics and metabolism.

Authors:  Jens Christian Nielsen; Jens Nielsen
Journal:  Synth Syst Biotechnol       Date:  2017-02-28

4.  Genome editing in the mushroom-forming basidiomycete Coprinopsis cinerea, optimized by a high-throughput transformation system.

Authors:  Shigeo S Sugano; Hiroko Suzuki; Eisuke Shimokita; Hirofumi Chiba; Sumihare Noji; Yuriko Osakabe; Keishi Osakabe
Journal:  Sci Rep       Date:  2017-04-28       Impact factor: 4.379

5.  Efficient CRISPR-Cas9 Gene Disruption System in Edible-Medicinal Mushroom Cordyceps militaris.

Authors:  Bai-Xiong Chen; Tao Wei; Zhi-Wei Ye; Fan Yun; Lin-Zhi Kang; Hong-Biao Tang; Li-Qiong Guo; Jun-Fang Lin
Journal:  Front Microbiol       Date:  2018-06-12       Impact factor: 5.640

Review 6.  CRISPR/Cas9 genome editing technology in filamentous fungi: progress and perspective.

Authors:  Runjie Song; Qing Zhai; Lu Sun; Enxia Huang; Yu Zhang; Yanli Zhu; Qingyun Guo; Yanan Tian; Baoyu Zhao; Hao Lu
Journal:  Appl Microbiol Biotechnol       Date:  2019-07-22       Impact factor: 4.813

7.  High-throughput targeted gene deletion in the model mushroom Schizophyllum commune using pre-assembled Cas9 ribonucleoproteins.

Authors:  Peter Jan Vonk; Natalia Escobar; Han A B Wösten; Luis G Lugones; Robin A Ohm
Journal:  Sci Rep       Date:  2019-05-21       Impact factor: 4.379

8.  Efficient genome editing with CRISPR/Cas9 in Pleurotus ostreatus.

Authors:  Tatpong Boontawon; Takehito Nakazawa; Chikako Inoue; Keishi Osakabe; Moriyuki Kawauchi; Masahiro Sakamoto; Yoichi Honda
Journal:  AMB Express       Date:  2021-02-20       Impact factor: 3.298

Review 9.  The CRISPR/Cas Genome-Editing Tool: Application in Improvement of Crops.

Authors:  Surender Khatodia; Kirti Bhatotia; Nishat Passricha; S M P Khurana; Narendra Tuteja
Journal:  Front Plant Sci       Date:  2016-04-19       Impact factor: 5.753

10.  Investigation of Mating Pheromone-Pheromone Receptor Specificity in Lentinula edodes.

Authors:  Sinil Kim; Byeongsuk Ha; Minseek Kim; Hyeon-Su Ro
Journal:  Genes (Basel)       Date:  2020-05-04       Impact factor: 4.096

View more
  2 in total

1.  CRISPR/Cas9 using a transient transformation system in Ceriporiopsis subvermispora.

Authors:  Takehito Nakazawa; Chikako Inoue; Dong Xuan Nguyen; Moriyuki Kawauchi; Masahiro Sakamoto; Yoichi Honda
Journal:  Appl Microbiol Biotechnol       Date:  2022-07-29       Impact factor: 5.560

2.  Establishment of CRISPR/Cas9 Genome-Editing System Based on Dual sgRNAs in Flammulina filiformis.

Authors:  Xiaotian Liu; Jianghan Dong; Jian Liao; Li Tian; Hao Qiu; Tao Wu; Feng Ge; Jing Zhu; Liang Shi; Ailiang Jiang; Hanshou Yu; Mingwen Zhao; Ang Ren
Journal:  J Fungi (Basel)       Date:  2022-06-30
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.