Surveillance of antimicrobial-resistant Escherichia coli in Sheltered dogs in the Kanto Region of Japan.

There is a lack of an established antimicrobial resistance (AMR) surveillance system in animal welfare centers. Therefore, the AMR prevalence in shelter dogs is rarely known. Herein, we conducted a survey in animal shelters in Chiba and Kanagawa prefectures, in the Kanto Region, Japan, to ascertain the AMR status of Escherichia coli  (E. coli) prevalent in shelter dogs. E. coli was detected in the fecal samples of all 61 and 77 shelter dogs tested in Chiba and Kanagawa, respectively. The AMR was tested against 20 antibiotics. E. coli isolates derived from 16.4% and 26.0% of samples from Chiba and Kanagawa exhibited resistance to at least one antibiotic, respectively. E. coli in samples from Chiba and Kanagawa prefectures were commonly resistant to ampicillin, piperacillin, streptomycin, kanamycin, tetracycline, and nalidixic acid; that from the Kanagawa Prefecture to cefazolin, cefotaxime, aztreonam, ciprofloxacin, and levofloxacin and that from Chiba Prefecture to chloramphenicol and imipenem. Multidrug-resistant bacteria were detected in 18 dogs from both regions; β-lactamase genes (blaTEM, blaDHA-1, blaCTX-M-9 group CTX-M-14), quinolone-resistance protein genes (qnrB and qnrS), and mutations in quinolone-resistance-determining regions (gyrA and parC) were detected. These results could partially represent the AMR data in shelter dogs in the Kanto Region of Japan.

Introduction

Companion animals may be reservoirs and spillover hosts for resistant bacteria[1-5], raising concerns of health risks posed by resistant bacteria harbored by companion animals to humans[6-9]. Infection with drug-resistant bacteria not only prolongs treatment periods but is also life-threatening for the elderly and individuals with a weakened immune system. A global action plan concerning bacterial drug resistance was adopted at the World Health Organization general meeting in 2015[10]. Subsequently, in 2016, the Japanese Government presented the antimicrobial drug resistance (AMR) action plan[11]. In 2019, the United Nations Interagency Coordination Group on Antimicrobial Resistance released a report calling for urgent action to avoid an AMR crisis[12]. The report included the following aims: (a) monitoring AMR and administration of antimicrobial drugs, (b) identification of indicators of change in drug resistance, and (c) further expansion and development of the action plan. To accomplish these aims, AMR surveillance in several different fields is required, including human and veterinary medicine, agriculture, animal husbandry, and wild animal populations.

In Japan, sheltered dogs and cats should undergo microbiological testing for parasites, protozoans, and viruses before adoption[13]; however, an AMR surveillance system for dogs and cats in shelters has not been established. Therefore, the prevalence of AMR in shelter dogs is rarely known. In this study, we conducted a survey in two animal shelter centers in the Kanto Region to ascertain the status of AMR in Escherichia coli carriage in shelter dogs.

As medicines for companion animals in Japan include antibiotic agents specific for both animals and humans, various agents must be tested. In Japan, public and large-scale AMR surveys in livestock and human medicine are ongoing, including the Japanese Veterinary Antimicrobial Resistance Monitoring System (JVARM) managed by the Ministry of Agriculture, Forestry and Fisheries of Japan (MAFF), and the Japan Nosocomial Infections Surveillance (JANIS) managed by the Japan Ministry of Health, Labor, and Welfare. We considered that it is desirable to employ the same antibacterial agents that are being used by the JVARM and JANIS for AMR monitoring in this study. These results will make up for the lack of AMR data in shelter dogs in Japan.

Results

Antimicrobial drug susceptibility

E. coli was detected in the feces of all 138 dogs tested (61 from Chiba, 77 from Kanagawa). The following 20 antibiotics were selected for monitoring drug resistance in E. coli: ampicillin (ABPC), piperacillin (PIPC), tazobactam/piperacillin (TAZ/PIPC), cefazolin (CEZ), cefmetazole (CMZ), cefotaxime (CTX), ceftazidime (CAZ), cefepime (CFPM), aztreonam (AZT), imipenem (IPM), meropenem (MEPM), streptomycin (SM), kanamycin (KM), gentamicin (GM), amikacin (AMK), tetracycline (TC), ciprofloxacin (CPFX), levofloxacin (LVFX), nalidixic acid (NA), and chloramphenicol (CP). The breakpoint of resistance was based on Clinical and Laboratory Standards Institute (CLSI) M100-S24 criteria[14].

Drug-susceptibility testing in the 61 E. coli isolates from Chiba revealed that the isolates derived from 10 dogs (16.4%) were resistant to at least one antibacterial drug among ABPC, PIPC, IPM, SM, KM, TC, NA, and CP (Table 1). None of the isolates exhibited resistance to TAZ/PIPC, CEZ, CMZ, CTX, CAZ, CFPM, AZT, MEPM, GM, AMK, CPFX, or LVFX. Some isolates exhibited intermediate resistance to CEZ, AZT, MEPM, AMK, and LVFX.

Table 1

Drug susceptibility of Escherichia coli isolated from shelter dogs in the Kanto Region, Japan.

Antimicrobial agent	Monitoring in JVARM and/or JANIS		CLSI breakpoint (mm)a		AMR (%)
					This study								Previous study
					Chiba (n = 61)				Kanagawa (n = 77)				healthy dogsb	ill dogsb
	JVARM	JANIS	I	R	I	95% CI	R	95% CI	I	95% CI	R	95% CI	R (%)	R (%)
Ampicillin	○	○	14–16	≤ 13	1.6	0–9.6	11.5	5.4–22.1	6.5	2.5–14.7	11.7	6.1–21.0	33.8	55.3
Piperacillin		○	18–20	≤ 17	1.6	0–9.6	9.8	4.2–20.2	2.6	0.2–9.5	7.8	3.3–16.3	N	N
Tazobactam/Piperacillin		○	18–20	≤ 17	0.0		0.0		1.3	0–7.7	0.0		N	N
Cefazolin	○	○	20–22	≤ 19	21.3	12.8–33.3	0.0		29.9	20.8–40.9	7.8	3.3–16.3	19.2	31.2
Cefmetazole		○	13–15	≤ 12	0.0		0.0		1.3	0–7.7	0.0		N	N
Cefotaxime	○	○	23–25	≤ 22	0.0		0.0		5.2	1.6–13.0	1.3	0–7.7	13.2	26.1
Ceftazidime		○	18–20	≤ 17	0.0		0.0		3.9	0.9–11.3	0.0		N	N
Cefepime		○	−	≤ 18	-		0.0		-		0.0		N	N
Aztreonam		○	18–20	≤ 17	1.6	0–9.6	0.0		0.0		2.6	0.2–9.5	N	N
Imipenem		○	20–22	≤ 19	0.0		1.6	0–9.6	1.3	0–7.7	0.0		N	N
Meropenem		○	20–22	≤ 19	1.6	0–9.6	0.0		0.0		0.0		0.0	0.0
Streptomycin	○		12–14	≤ 11	29.5	19.5–42.0	4.9	1.1–14.0	66.2	55.1–75.8	13.0	7.0–22.5	19.2	29.6
Kanamycin	○		14–17	≤ 13	16.4	9.0–27.8	4.9	1.1–14.0	16.9	10.0–26.9	2.6	0.2–9.5	5.3	6.5
Gentamicin	○		13–14	≤ 12	0.0		0.0		1.3	0–7.7	0.0		3.3	14.1
Amikacin		○	15–16	≤ 14	4.9	1.1–14.0	0.0		2.6	0.2–9.5	0.0		N	N
Tetracycline	○		12–14	≤ 11	1.6	0–9.6	9.8	4.2–20.2	0.0		2.6	0.2–9.5	16.6	28.1
Ciprofloxacin	○		16–20	≤ 15	0.0		0.0		5.2	1.6–13.0	2.6	0.2–9.5	18.5	43.2
Levofloxacin		○	0.25–1	≥ 2	3.3	0.2–11.8	0.0		7.8	3.3–16.3	2.6	0.2–9.5	N	N
Nalidixic acid	○		14–18	≤ 13	3.3	0.2–11.8	1.6	0–9.6	0.0		5.2	1.6–13.0	27.8	61.8
Chloramphenicol	○		13–17	≤ 12	1.6	0–9.6	6.6	2.1–16.1	1.3	0–7.7	0.0		4.6	12.6

95% CI 95% confidence interval, I intermediate, R resistant, N not subject to survey, JVARM Japanese Veterinary Antimicrobial Resistance Monitoring System, JANIS Japan Nosocomial Infections Surveillance, CLSI Clinical and Laboratory Standards Institute, AMR antimicrobial resistance.

aDisk diffusion zone diameter interpretive criteria (mm). Only LVFX was tested using the broth microdilution method; minimum inhibitory concentration (MIC) interpretive criteria (μg/mL).

bFY 2018 antimicrobial resistance monitoring survey of bacteria derived from healthy companion animals (dogs and cats), Ministry of Agriculture, Forestry and Fisheries of Japan (MAFF).

Drug-susceptibility testing in the 77 E. coli isolates from Kanagawa revealed that the isolates derived from 20 dogs (26.0%) were resistant to at least one antibacterial drug among ABPC, PIPC, CEZ, CTX, AZT, SM, KM, TC, CPFX, and NA (Table 1). None of the isolates exhibited resistance to TAZ/PIPC, CMZ, CAZ, CFPM, IPM, MEPM, GM, AMK, LVFX, or CP. Some isolates exhibited intermediate resistance to TAZ/PIPC, CMZ, CAZ, IPM, GM, AMK, LVFX, and CP.

ABPC-, PIPC-, SM-, KM-, TC-, and NA-resistant E. coli were commonly found in dogs from Chiba and Kanagawa prefectures. CEZ-, CTX-, AZT-, and fluoroquinolone (CPFX and LVFX)-resistant E. coli were found only in Kanagawa Prefecture. CP- and IPM-resistant E. coli were found only in Chiba Prefecture.

The chi-square test of sex-related differences in the ratio of susceptible (S), intermediate (I), and resistant (R) results of the antimicrobial susceptibility test revealed no significant differences between males and females for any of the antibacterial agents.

Multidrug-resistant E. coli was detected in 18 dogs, with resistance to as many as six drugs in 1 dog and five drugs in 5 dogs. The patterns of multidrug resistance are shown in Table 2a.

Table 2

Pattern of multi-drug resistance and detected antimicrobial resistance genes in E. coli.

	Dog sample number
	Chiba								Kanagawa
	16C1	16C26	16C37	16C42	16C43	16C44	17C2	17C16	16K18	16K21	17K2	17K8	17K12	17K20	17K27	17K36	17K49	17K55
(a) Pattern of multi-drug resistance in E. coli
Antibiotic
Ampicillin	R	R	R	R	R	R		R	R	R	R	R	R	R	R		R	R
Piperacillin	I	R	R	R		R		R	R	I		I	R	R	R		R	R
Tazobactam/Piperacillin												I
Cefazolin		I		I			I	I	R	R	R	R	R	I	I	I	I	R
Cefmetazole										I
Cefotaxime									R	I	I	I
Ceftazidime										I		I				I
Cefepime
Aztreonam							I					R				R
Imipenem							R
Meropenem							I
Streptomycin	I		I		R	R		R	I	I	I	I	R	R		R	I
Kanamycin	R	R		R										R		I
Gentamicin														I
Amikacin
Tetracycline	R	R		R	R	R							R	R
Ciprofloxacin															R	I	R
Levofloxacin		I		I					R						I		R
Nalidixic acid							R		R								R
Chloramphenicol	R	R		R	R
(b) Detected antimicrobial resistance genes in E. coli
Resistance mechanism
β-lactamase	N.T	bla TEM	bla TEM	bla TEM	N.D	bla TEM	N.D	N.D	bla CTX-M-9 group CTX-M-14	bla DHA-1	N.D	N.D	bla TEM	bla TEM	bla TEM	N.D	bla TEM	bla TEM
Aminoglycoside resistance 16S rRNA methylases	N.T	N.D	N.D	N.D	N.D	N.D		N.D	N.D	N.D	N.D	N.D	N.D	N.D		N.D	N.D
Aminoglycoside modifying enzyme	N.T	N.D	N.D	N.D	N.D	N.D		N.D	N.D	N.D	N.D	N.D	N.D	N.D		N.D	N.D
Mutation of the quinolone resistance-determining regions		N.D		N.D			N.D		83S → L, 87D → Y in gyrA 80S → I in parC						N.D	N.D	83S → L, 87D → N in gyrA 80S → I in parC
Quinolone resistance protein		qnrS		qnrS			qnrB		N.D						N.D	N.D	N.D

I intermediate, R resistant, N.D. not detected, N.T. not tested.

Detection of antimicrobial resistance genes

Drug-resistance genes detected in E. coli isolates that showed multidrug resistance are shown in Table 2b. In 17 isolates (originally 18 samples, but one sample could not be tested due to poor growth) that showed resistance or intermediate resistance to any of the β-lactams reagents, blaTEM (9 samples) and blaDHA-1 (1 sample) were detected. In five third-generation cephalosporin (CTX and CAZ)-resistant or intermediate-resistant isolates, the blaCTX-M-9 group CTX-M-14 (1 sample) was detected. No carbapenemase gene was detected in isolates resistant to IPM. No aminoglycoside resistant 16S rRNA methylases genes and aminoglycoside-modifying enzyme genes were detected in 14 aminoglycoside (SM, KM, and GM)-resistant or intermediate-resistant isolates (originally 15 samples, but one sample could not be tested due to poor growth). In seven quinolone-resistant or intermediate-resistant isolates, qnrB (1 sample) and qnrS (2 samples) were detected. Mutations in quinolone-resistance-determining regions (QRDR), 83 serine (S) and 87 aspartic acid (D) of the gyrA sequence and 80S of the parC sequence (2 samples), were detected. The first sample showed mutations of 83S to leucine (L) and 87D to tyrosine (Y) in gyrA and 80S to isoleucine (I) in parC. In the second sample, 83S was mutated to L and 87D was mutated to asparagine (N) in gyrA, and 80S to isoleucine (I) in parC. blaTEM was commonly detected in Chiba and Kanagawa prefectures. qnrB and qnrS were detected only in Chiba Prefecture, and the blaCTX-M-9 group CTX-M-14, blaDHA-1, and quinolone-resistant mutations were detected only in Kanagawa Prefecture.

Discussion

Drug-resistant E. coli was detected in some of the shelter dogs surveyed in this study. In addition, resistance genes related to the resistance mechanism were identified. First, we compared drug-susceptibility testing results with data available in Japan. Most of the canine AMR data currently reported in Japan are from animal patients who visited veterinary clinics for the treatment of some diseases. Other than those released by the MAFF in 2020[15], almost no AMR survey data are available for non-patient companion animals. Table 1 compares the results of our study with the drug-resistance rates of dog rectal swab-isolated E. coli reported by the MAFF. The MAFF survey also included dogs taken to a veterinary hospital in 2017 (ill dogs) and 2018 (healthy dogs), which overlaps with our survey period (2016–2017). Regarding common antibacterial agents tested in our study and the MAFF survey (ABPC, CEZ, CTX, MEPM, SM, KM, GM, TC, CPFX, NA, and CP), the antibiotic resistance rate observed in sheltered dogs was mostly lower than that in healthy dogs in the MAFF survey. In the samples obtained from Chiba, the 95% confidence interval (95% CI) range of the antibiotic resistance rates against ABPC, CEZ, CTX, MEPM, SM, GM, CPFX, and NA in sheltered dogs was lower than that in healthy dogs in the MAFF survey (Table 1). The 95% CI range of the resistance rates against KM, TC, and CP in sheltered dogs overlapped with that in healthy dogs in the MAFF survey. In the samples obtained from Kanagawa, the 95% CI range of the antibiotic resistance rates against ABPC, CEZ, CTX, MEPM, GM, TC, CPFX, NA, and CP in sheltered dogs was lower than that in healthy dogs in the MAFF survey (Table 1). The 95% CI range of the resistance rates against KM and SM in sheltered dogs overlapped with that in healthy dogs in the MAFF survey. In the MAFF survey, the resistance rates in healthy dogs were lower than those in sick dogs[15]. The 95% CI range of the resistance rates against KM and CP in the samples from Chiba and against KM in the samples from Kanagawa overlapped with that in the sick dogs in the MAFF survey (Table 1). The use of β-lactam antibiotics and fluoroquinolone antibiotics in veterinary medicine has been reported to promote an increase in the number of drug-resistant E. coli isolates[1,16]. Sheltered dogs include abandoned and stray dogs; presumably, these dogs are less exposed to veterinary medical facilities and the administration of antibacterial drugs than dogs in households. This may explain the lower drug-resistance rate observed in our study than in the MAFF survey.

Next, the results of the identification of drug-resistance genes were compared with data from Japan and other countries. Several types of β-lactamase genes, QRDR mutations, and quinolone-resistant protein genes were detected in E. coli from shelter dogs. β-Lactamase genes, blaTEM, blaCTX-MTX-M-14, and blaDHA, were detected. These are genes that are reportedly detected in the intestinal bacteria of humans, farm animals, and companion animals[17-21]. A 2016 study of sheltered dogs and cats in Osaka, Japan, reported that many of these resistance genes are detected in cephalosporin-resistant E. coli[22]. As quinolone-resistance mechanisms, QRDR mutations and quinolone-resistance proteins (qnrB and qnrS) were detected. Furthermore, β-lactamase genes, which are also involved in resistance mechanisms, have been detected in humans, farm animals, and companion animals[17,23-25]. The quinolone-resistant mechanisms have been predominantly detected in a survey of E. coli in shelter dogs and cats in Osaka from 2016 to 2017[26]. Therefore, the drug-resistance mechanism in E. coli detected in this study was of the type that has been reportedly detected in the intestinal bacteria of dogs in Japan and abroad.

In conclusion, the rates of resistance to various antibiotics among the E. coli isolated from shelter dogs in the animal welfare centers in Chiba and Kanagawa prefectures were mostly lower than those in the healthy and sick domestic dogs in Japan, surveyed at almost the same time[15]. The detected resistance genes presented the same trend as those reported in shelter dogs in the same years in Japan[22,26]. As several studies have already mentioned, drug-resistant bacteria in companion animals can be a health risk to humans[6-9]. AMR surveillance in companion animals, including shelter dogs, for which there is a lack of data, needs to be widely conducted to accurately assess the AMR prevalence in Japan. The present results will make up for the lack of AMR data in shelter dogs.

Methods

Sampling of dog feces

This study was conducted in accordance with the principles of the ARRIVE guidelines. Feces from sheltered dogs were used, and no invasive treatment was performed on the dogs; therefore, the study did not require ethics approval.

The required sample size (n) was calculated at a 95% confidence level using the formula and parameters below. The proportion of AMR (P) in the population was estimated as 10%, based on the results of the preliminary survey. The margin of error (δ) was 0.08. The required sample size was estimated to be 54.

Between 2016 and 2017, we collected feces from 61 and 77 dogs housed in two public animal welfare centers in Chiba and Kanagawa prefectures, in the Kanto Region of Japan. None of the dogs exhibited any specific veterinary health abnormalities in their medical data. The age was not known for most animals, but samples were generally collected from adult dogs. In Chiba, the number of female and male dogs was 23 and 34, respectively; sex information was not available for 4 dogs. In Kanagawa, the number of female and male dogs was 25 and 38, respectively; sex information was not available for 14 dogs. In Chiba, the number of dogs belonging to different breeds was as follows: 45 hybrids, 6 Shiba Inu, 3 Beagle, 2 Toy Poodle, and 2 other breeds; breed information was not available for 3 dogs. In Kanagawa, it was: 17 hybrids, 8 Shiba Inu, 6 Toy Poodle, 5 Beagle, 4 Miniature Dachshund, and 23 other breeds; breed information was not available for 14 dogs. In Chiba, the dogs were introduced into animal welfare centers for the following reasons: 51 dogs were captured, including stray dogs; 5 dogs were abandoned; and information was not available for 5 dogs. In Kanagawa, the reasons were: 17 dogs were lost; 2 dogs were abandoned; and information was not available for 58 dogs.

The fecal samples were collected using a sterilized swab from naturally excreted feces. The portion in contact with the ground was not collected. Duplicate samples from the same animal were not collected. The fecal samples were preserved in Carry-Blair transport medium (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan), stored at 4 °C, and transported to the laboratory for E. coli culture immediately.

Detection of E. coli

The fecal samples were resuspended in sterilized saline solution and smeared onto an XM-G agar plate (Nissui Pharmaceutical Co., Ltd.) using a platinum loop. The plates were cultured under aerobic conditions at 35 °C for 20 h. After incubation, β-glucuronidase-positive colonies (a biochemical characteristic of E. coli) were selected and purified in nutrient agar (Eiken Chemical Co., Ltd., Tokyo, Japan). The selected colonies were identified as E. coli by polymerase chain reaction according to an established method[27].

Drug-susceptibility profile testing

The disk diffusion method, based on the performance standards issued by the CLSI[14], was used to test the susceptibility of E. coli isolates toward all drugs except LVFX. Mueller–Hinton agar and antimicrobial susceptibility test discs (Sencsi-Disc) were purchased from BD Biosciences (Franklin Lakes, NJ, USA). The dry Eiken plate (Eiken Chemical Co., Ltd.), which uses the broth microdilution method based on the performance standards issued by the CLSI, was used for susceptibility testing of only LVFX (Table 1). Results of the antimicrobial susceptibility test were indicated as S, I, or R. E. coli ATCC25922 and Pseudomonas aeruginosa ATCC27853 (both from American Type Culture Collection, Manassas, VA, USA) were used as control strains.

Chromosomal DNA and plasmid DNA extraction

PrepManUltra sample preparation reagent (Thermo Fisher Scientific, Waltham, MA, USA) was used for chromosomal DNA extraction. The Mini Plus Plasmid DNA Extraction System (Viogen-Bio Tek Corporation, Taipei, Taiwan) was used for plasmid DNA extraction.

Detection of drug-resistance genes by PCR and DNA sequencing

Eighteen samples of multidrug-resistant E. coli were subjected to genetic testing to predict the mechanism of drug resistance. One of the strains (sample No. 16C1) presented poor growth; therefore, 17 samples were tested. E. coli that showed resistance or intermediate resistance to β-lactam antibiotics were analyzed for blaTEM, blaSHV, and AmpC (bla CMY/MOX, bla CMY/LAT, bla DHA, bla ACC, bla ACT-1/MIR-1, and bla FOX) genes[28,29]. In addition to this, we analyzed the CTX-M genes (bla CTX-M-1-group, bla CTX-M-2-group, blaCTX-M-8-group, and bla CTX-M-9-group) in E. coli that showed third-generation cephalosporin resistance or intermediate resistance[30] and carbapenemase genes (bla IMP-1, bla IMP-2, bla VIM-2, bla KPC-2, bla GES, and bla NDM-1) in carbapenem-resistant E. coli[31-35]. Aminoglycoside antibiotic resistance and intermediate E. coli were analyzed for aminoglycoside resistance 16S rRNA methylases genes (armA and rmtB) and aminoglycoside-modifying enzyme genes (Aac(6′)-Ib, Ant(3″)-Ia, Aph(3′)-Ia, and Aac(3)-II)[36,37]. Quinolone-resistant and intermediate-resistant E. coli were analyzed for quinolone-resistance genes (qnrA, qnrB, qnrC, qnrD, qnrS, qepA, oqxAB, and aac(6')-lb-cr)[38]. The antibiotic resistance genes mentioned above were analyzed using the extracted plasmid DNA as a template to amplify the target region by PCR, followed by sequencing to decipher the nucleotide sequence and homology search by BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi).). PCR and DNA sequencing analysis using chromosomal DNA as the template were performed to examine mutations in QRDR in quinolone-resistant and intermediate-resistant strains. In the DNA gyrase subunit A gene (gyrA), the mutations at 83S and 87D were analyzed[39]. In topoisomerase IV gene (parC), the mutations at 80S and 84 glutamic acid (E) were analyzed[40]. The primers used for the amplification of each gene and the references are shown in Table 3. The PCR conditions were based on the conditions described in the references, and the Multiplex PCR Kit (Takara Bio, Kyoto, Japan) was used for PCR. The ProFlex PCR System (Thermo Fisher Scientific) was used as the thermal cycler for PCR. The PCR amplification product was treated with Illustra ExoProStar (Cytiva, Marlborough, MA, USA) to remove unwanted nucleotides. The primers used for sequencing were the primers used for PCR amplification. DNA sequencing was outsourced to a specialized external organization (Fasmac Co., Ltd., Kanagawa, Japan). The nucleotide sequences were determined by the direct sequencing of PCR products, performed by Sanger sequencing on a 3730xl DNA Analyzer (Thermo Fisher Scientific) using the BigDye Terminator and BigDye XTerminator Purification Kit (Thermo Fisher Scientific)[41].

Table 3

Primers used for amplification of drug-resistance genes.

Resistance mechanisms	Gene	Primer name	Sequence [5' → 3']	References no
β-lactamase	bla TEM	TEM_F	TCGTGTCGCCCTTATTCCCTTTTT	[28]
		TEM_R	GCGGTTAGCTCCTCCGGTCCTC
	bla SHV	SHV_F	GTGGATGCCGGTGACGAACAGC	[28]
		SHV_R	TGGCGCAAAAAGGCAGTCAATCCT
	bla CTX-M-1-group	CTX-1_F	CCCATGGTTAAAAAATCACTG	[30]
		CTX-1_R	CCGTTTCCGCTATTACAAAC
	bla CTX-M-2-group	CTX-2_F	ATGATGACTCAGAGCATTCGC	[30]
		CTX-2_R	TCGCTCCATTTATTGCATCA
	blaCTX-M-8-group	CTX-8_F	ATGTTAATGACGACAGCCTGTG	[30]
		CTX-8_R	CCGGTTTTATCCCCGACA
	bla CTX-M-9-group	CTX-9_F	GATTGACCGTATTGGGAGTTT	[30]
		CTX-9_R	TATTGAGAGTTACAGCCCTTCG
	bla IMP-1	IMP1_F	CTACCGCAGCAGAGTCTTTG	[31]
		IMP1_R	AACCAGTTTTGCCTTACAAT
	bla IMP-2	IMP2_F	GTGTATGCTTCCTTTGTAGC	[32]
		IMP2_R	CAATCAGATAGGCGTCAGTGT
	bla VIM-2	VIM_F	ATGGTGTTTGGTCGCATATC	[33]
		VIM_R	TGGGCCATTCAGCCAGATC
	bla KPC-2	KPC_F	ATGTCACTGTATCGCCGTCT	[34]
		KPC_R	TTTTCAGAGCCTTACTGCCC
	bla GES	GES_F	GTTTTGCAATGTGCTCAACG	[34]
		GES_R	TGCCATAGCAATAGGCGTAG
	bla NDM-1	NDM1_F	CTGAGCACCGCATTAGCC	[35]
		NDM1_R	GGGCCGTATGAGTGATTGC
	bla CMY/MOX	MOXM_F	GCTGCTCAAGGAGCACAGGAT	[29]
		MOXM_R	CACATTGACATAGGTGTGGTGC
	bla CMY/LAT	CITM_F	TGGCCAGAACTGACAGGCAAA	[29]
		CITM_R	TTTCTCCTGAACGTGGCTGGC
	bla DHA	DHAM_F	AACTTTCACAGGTGTGCTGGGT	[29]
		DHAM_R	CCGTACGCATACTGGCTTTGC
	bla ACC	ACCM_F	AACAGCCTCAGCAGCCGGTTA	[29]
		ACCM_R	TTCGCCGCAATCATCCCTAGC
	bla ACT-1/MIR-1	EBCM_F	TCGGTAAAGCCGATGTTGCGG	[29]
		EBCM_R	CTTCCACTGCGGCTGCCAGTT
	bla FOX	FOXM_F	AACATGGGGTATCAGGGAGATG	[29]
		FOXM_R	CAAAGCGCGTAACCGGGATTGG
Aminoglycoside resistance 16S rRNA methylases	armA	armA_F	GGTGCGAAAACAGTCGTAGT	[36]
		armA_R	TCCTCAAAATATCCTCTATGT
	rmtB	rmtB_F	ATGAACATCAACGATGCCCT	[36]
		rmtB_R	CCTTCTGATTGGCTTATCCA
Aminoglycoside modifying enzyme	Aac(6′)-Ib	Aac(6′)-I-F	AAACCCCGCTTTCTCGTAGC	[37]
		Aac(6′)-I-R	AAACCCCGCTTTCTCGTAGC
	Ant(3″)-Ia	Ant(3″)-F	CCGGTTCCTGAACAGGATC	[37]
		Ant(3″)-R	CCCAGTCGGCAGCGACATC
	Aph(3′)-Ia	Aph(3′)-F	CAAGATGGATTGCACGCAGG	[37]
		Aph(3′)-R	TTCAGTGACAACGTCGAGCA
	Aac(3)-II	Aac(3)-II-F	GCTCGGTTGGATGACAAAGC	[37]
		Aac(3)-II-R	AGGCGACTTCACCGTTTCTT
Quinolone resistance protein	qnrA	qnrA_F	AGAGGATTTCTCACGCCAGG	[38]
		qnrA_R	GCAGCACTATKACTCCCAAGG
	qnrB	qnrB_F	GGMATHGAAATTCGCCACTG	[38]
		qnrB_R	TTTGCYGYYCGCCAGTCGAA
	qnrC	qnrC_F	GGGTTGTACATTTATTGAATC	[38]
		qnrC_R	TCCACTTTACGAGGTTCT
	qnrD	qnrD_F	CGAGATCAATTTACGGGGAATA	[38]
		qnrD_R	AACAAGCTGAAGCGCCTG
	qnrS	qnrS_F	GCAAGTTCATTGAACAGGCT	[38]
		qnrS_R	TCTAAACCGTCGAGTTCGGCG
	qepA	qepA_F	CTGCAGGTACTGCGTCATG	[38]
		qepA_R	CGTGTTGCTGGAGTTCTTC
	oqxA	oqxA_F	GACAGCGTCGCACAGAATG	[38]
		oqxA_R	GGAGACGAGGTTGGTATGGA
	oqxB	oqxB_F	CGAAGAAAGACCTCCCTACCC	[38]
		oqxB_R	CGCCGCCAATGAGATACA
	aac(6′)-Ib	aac_F	TTGCGATGCTCTATGAGTGGCTA	[38]
		aac_R	CTCGAATGCCTGGCGTGTTT
Mutation of the quinolone resistance-determining regions	gyrA	STGYRA_F	TGTCCGAGATGGCCTGAAGC	[39]
		STGYRA_R	CGTTGATGACTTCCGTCAG
	parC	parC_F	TGTATGCGATGTCTGAACTG	[40]
		parC_R	CTCAATAGCAGCTCGGAATA

Statistical analysis

The sex differences in the rate of S, I, and R were evaluated using the chi-square test. SPSS (version 19, IBM Japan, Tokyo, Japan) was used for the analysis. The statistical significance level was set to 5%.

The 95% CI of resistance rates were calculated using the Agresti-Coull method.