Cécile Ribot1, Cédric Soler1, Aymeric Chartier1, Sandy Al Hayek2, Rima Naït-Saïdi1, Nicolas Barbezier1, Olivier Coux3, Martine Simonelig1. 1. mRNA Regulation and Development, Institute of Human Genetics, UMR9002 CNRS-Univ Montpellier, Montpellier, France. 2. GReD Laboratory, Clermont-Auvergne University, INSERM U1103, CNRS UMR6293, Clermont-Ferrand, France. 3. Ubiquitin-proteasome system and cell cycle control, Montpellier Cell Biology Research Center, UMR5237 CNRS-Univ Montpellier, Montpellier, France.
Abstract
Oculopharyngeal muscular dystrophy (OPMD) is a late-onset disorder characterized by progressive weakness and degeneration of specific muscles. OPMD is due to extension of a polyalanine tract in poly(A) binding protein nuclear 1 (PABPN1). Aggregation of the mutant protein in muscle nuclei is a hallmark of the disease. Previous transcriptomic analyses revealed the consistent deregulation of the ubiquitin-proteasome system (UPS) in OPMD animal models and patients, suggesting a role of this deregulation in OPMD pathogenesis. Subsequent studies proposed that UPS contribution to OPMD involved PABPN1 aggregation. Here, we use a Drosophila model of OPMD to address the functional importance of UPS deregulation in OPMD. Through genome-wide and targeted genetic screens we identify a large number of UPS components that are involved in OPMD. Half dosage of UPS genes reduces OPMD muscle defects suggesting a pathological increase of UPS activity in the disease. Quantification of proteasome activity confirms stronger activity in OPMD muscles, associated with degradation of myofibrillar proteins. Importantly, improvement of muscle structure and function in the presence of UPS mutants does not correlate with the levels of PABPN1 aggregation, but is linked to decreased degradation of muscle proteins. Oral treatment with the proteasome inhibitor MG132 is beneficial to the OPMD Drosophila model, improving muscle function although PABPN1 aggregation is enhanced. This functional study reveals the importance of increased UPS activity that underlies muscle atrophy in OPMD. It also provides a proof-of-concept that inhibitors of proteasome activity might be an attractive pharmacological approach for OPMD.
Oculopharyngeal muscular dystrophy (OPMD) is a late-onset disorder characterized by progressive weakness and degeneration of specific muscles. OPMD is due to extension of a polyalanine tract in poly(A) binding protein nuclear 1 (PABPN1). Aggregation of the mutant protein in muscle nuclei is a hallmark of the disease. Previous transcriptomic analyses revealed the consistent deregulation of the ubiquitin-proteasome system (UPS) in OPMD animal models and patients, suggesting a role of this deregulation in OPMD pathogenesis. Subsequent studies proposed that UPS contribution to OPMD involved PABPN1 aggregation. Here, we use a Drosophila model of OPMD to address the functional importance of UPS deregulation in OPMD. Through genome-wide and targeted genetic screens we identify a large number of UPS components that are involved in OPMD. Half dosage of UPS genes reduces OPMD muscle defects suggesting a pathological increase of UPS activity in the disease. Quantification of proteasome activity confirms stronger activity in OPMD muscles, associated with degradation of myofibrillar proteins. Importantly, improvement of muscle structure and function in the presence of UPS mutants does not correlate with the levels of PABPN1 aggregation, but is linked to decreased degradation of muscle proteins. Oral treatment with the proteasome inhibitor MG132 is beneficial to the OPMD Drosophila model, improving muscle function although PABPN1 aggregation is enhanced. This functional study reveals the importance of increased UPS activity that underlies muscle atrophy in OPMD. It also provides a proof-of-concept that inhibitors of proteasome activity might be an attractive pharmacological approach for OPMD.
Protein aggregation represents a pathological hallmark in many neurodegenerative diseases, including Alzheimer disease, Parkinson disease, Huntington disease and amyotrophic lateral sclerosis, among others. A key feature of all these diseases is the accumulation of abnormally processed and misfolded proteins that form aggregates and partly lose their physiological roles [1].Oculopharyngeal muscular dystrophy (OPMD) is one of these proteinopathies in which the mutant protein accumulates as aggregates in diseased nuclei. OPMD is a rare autosomal dominant muscular dystrophy that starts in the late fifties. It is characterized by progressive weakness of specific muscles, leading to eyelid drooping (ptosis), swallowing difficulties (dysphagia), and proximal limb weakness [2,3]. OPMD is due to short expansions of a GCN repeat in the gene encoding poly(A) binding protein nuclear 1 (PABPN1) [4]. Triplet expansion in PABPN1 leads to extension of a polyalanine tract at the N-terminus of the protein from 10 alanines in the normal protein, to 11 to 18 alanines in patients [5,6]. Alanine-expanded PABPN1 form nuclear aggregates in muscle fibres, which are a pathological hallmark of the disease [7].PABPN1 is a nuclear protein at steady-state and has several molecular functions in RNA processing and surveillance. First identified for its role in nuclear polyadenylation, a reaction in which PABPN1 stimulates poly(A) polymerase and controls poly(A) tail length [8-12], it is also involved in alternative polyadenylation by binding to proximal weak poly(A) sites and preventing their utilization [13]. More recently, PABPN1 was found to be involved in nuclear RNA decay through the recruitment of the exosome or the PARN deadenylase [14,15]. These decay functions of PABPN1 include polyadenylation-dependent processing and turnover of long non-coding RNAs and small nucleolar RNAs [16,17], nuclear surveillance through hyperadenylation and decay of RNAs retained in the nucleus [18], and 3’-end maturation of the human telomerase RNA [19-21].Defects in one or several of these functions are expected to be the initial trigger of OPMD. Consistent with this, a general shift towards proximal poly(A) site utilization and upregulation of shorter mRNAs produced through this poly(A) site shift have been described in a mouse model of OPMD [13,22]. More recently, using Drosophila and mouse models of OPMD, we showed that a primary defect in OPMD is in nuclear cleavage and polyadenylation. This defect is general and leads in turn to specific poly(A) tail shortening of mRNAs encoding mitochondrial proteins, because this class of mRNAs are more actively deadenylated by the CCR4-NOT deadenylation complex [23]. This molecular defect leads to reduced levels of mitochondrial proteins in OPMD patient muscles, resulting in decreased mitochondrial activity and is among the earliest defects in OPMD pathogenesis, occurring in presymptomatic patient muscles [23]. Decreased levels of mitochondrial proteins as well as poly(A) tail shortening was also found in another OPMD mouse model that closely reproduces Pabpn1 mutation in OPMD patients, i.e. Pabpn1-17ala/Pabpn1 at the endogenous Pabpn1 locus [24].Polyalanine expansions in PABPN1 induces its aggregation. However, although PABPN1 aggregates are a key feature of OPMD, how these aggregates contribute to the disease remains poorly understood. mRNAs, as well as several RNA binding proteins, including hnRNP proteins and poly(A) polymerase, are recruited to PABPN1 aggregates [25-28]. In addition, more recent studies have shown that wild-type PABPN1 is also sequestered in aggregates [13], thus resulting in reduced levels of soluble protein that might contribute to the pathology through a loss of function mechanism [24,29]. In favor of this model, some of the molecular defects in OPMD are consistent with a loss of function of PABPN1 [13,23]. In addition, reducing PABPN1 aggregation load through either oral treatment with anti-aggregation drugs, or expression of anti-PABPN1 intrabody improves muscle function in Drosophila and mouse OPMD models [30-34].Importantly, HSP70 and components of ubiquitin-proteasome system (UPS), i.e. ubiquitin and subunits of the proteasome, are also recruited to PABPN1 nuclear aggregates [25], suggesting that mutant forms of PABPN1 are targeted by the ubiquitin-proteasome degradation pathway. In lines with this, the stability of both wild-type and alanine-expanded PABPN1 in cultured cells was shown to depend on the UPS, and an E3 ubiquitin ligase specific to PABPN1, ARIH2 has been identified [35,36].In another study, an integrated RNA profiling analysis including Drosophila and mouse models of OPMD as well as patient samples showed that the UPS was the most consistently and significantly deregulated pathway in OPMD [37]. These data suggested the contribution of UPS-dependent protein homeostasis in OPMD pathogenesis. UPS function in protein homeostasis relies on an enzymatic cascade of ubiquitination and degradation steps. Ubiquitination requires ubiquitin that is first activated by the ubiquitin-activating enzyme E1 and then transferred to an E2-conjugating enzyme. Ubiquitin is subsequently conjugated to target proteins through the action of E3 ligases that are responsible for target specificity. Processing of poly-ubiquitinated (poly-Ub) proteins involves deubiquitinating enzymes (DUBs) that can remove ubiquitin from them and the proteasome that degrade the poly-Ub targets into small peptides [38]. Consistent deregulation in OPMD animal models and patient samples was found for E3 ligases, DUBs and proteasome subunits, with E3 ligases being mostly upregulated [37].In neurodegenerative proteinopathies, insufficient clearance of misfolded proteins through protein quality control pathways such as autophagy and the UPS, is recognized to be a major cause of pathogenesis [1]. Increasing protein clearance by enhancing activity of protein degradation pathways, either with small molecules or genetically, can reduce neurodegeneration in animal models [1,39].In contrast, here we show, using a Drosophila model of OPMD, that muscle weakness and degeneration in OPMD depends on increased proteasomal activity. Specific expression of alanine-expanded mammalian PABPN1 in Drosophila muscles reproduces the main features of OPMD: progressive muscle weakness and degeneration resulting in Drosophila wing position defects, and accumulation of mutant PABPN1 in nuclear aggregates in affected muscles [31,40]. Here, we have used an OPMD Drosophila model induced by mesodermal expression of alanine-expanded PABPN1 to perform a genome-wide genetic screen with large deletions that cover most of the Drosophila genome. This screen and a secondary screen focused on UPS components identified a large number of UPS mutants as suppressors of OPMD defects. We showed that both proteasome activity and levels of ubiquitinated myofibrillar proteins are increased in OPMD Drosophila muscles. Accordingly, myofibrillar protein levels were reduced in OPMD muscles. Finally, reducing proteasomal activity using oral pharmacological treatment reduced OPMD wing position defects, although the PABPN1 aggregation load was increased. We propose that deregulation of the UPS has a major contribution to OPMD pathogenesis. This deregulation leads to increased proteasomal activity and degradation of myofibrillar proteins. Importantly, the role of the UPS in OPMD is not linked to modulation of PABPN1 aggregates, but rather to myofibrillar protein homeostasis. These results indicate that reducing proteasome activity using pharmacological treatments might be beneficial for OPMD, and have important implications for the development of therapies in muscular dystrophies.
Results
A genome-wide genetic screen to identify suppressors of OPMD in Drosophila
We previously established that expression of alanine-expanded mammalian PABPN1 (PABPN1-17ala) in Drosophila muscles using the UAS/Gal4 system and the muscle-specific driver Myosin heavy chain-Gal4 (Mhc-Gal4), led to wing position defects resulting from affected muscle activity and progressive degeneration [40]. This hybrid model expressing the mammalian protein has proven useful to identify molecular pathways relevant to OPMD in patients [23]. To more broadly identify molecular pathways involved in OPMD, we set up a genome-wide genetic screen in Drosophila, based on this hybrid OPMD model. Recording defective wing position in adult flies is a long process, unsuitable for a large screen, therefore we established a lethality screen to speed up screening. Expression of UAS-PABPN1-17ala with the 24B-Gal4 driver that specifically expresses Gal4 in the mesoderm from embryonic stages [41], leads to larval lethality at 22°C with only 5 to 15% of individuals surviving to pupal stage (Fig 1A). We characterized muscle defects in UAS-PABPN1-17ala/+; 24B-Gal4/+ individuals, using phalloidin staining to visualize Actin in late embryonic and third instar larval stages. No major defects were visible in the musculature of UAS-PABPN1-17ala/+; 24B-Gal4/+ late embryos (S1A Fig), showing that muscles developed normally and were maintained throughout embryogenesis following expression of PABPN1-17ala in the mesoderm. In contrast, the body-wall musculature of third instar larvae was very affected. First, 100% of UAS-PABPN1-17ala/+; 24B-Gal4/+ third instar larvae were paralyzed and smaller than 24B-Gal4/+ control larvae (n>100). Second, phalloidin staining of body-wall muscles revealed a generalized muscle atrophy (100% of UAS-PABPN1-17ala/+; 24B-Gal4/+ larval hemi-segments (n = 38) versus 0% of 24B-Gal4/+ controls (n = 28)) (S1B Fig). Third, phalloidin staining also revealed a large number of other morphological defects, including splitted, very thin and broken muscles (S1B and S1C Fig). Muscle defects in larvae resembled those described in adult OPMD muscles [40] (see below). In addition, these defects were progressive from embryonic to larval stages, as in the case of PABPN1-17ala expression in adults. Therefore, embryonic expression of PABPN1-17ala with 24B-Gal4 is a relevant model to screen for suppressors of OPMD phenotypes.
Fig 1
Overview of the genetic screen to identify suppressors of larval lethality induced by expression of PABPN1-17ala in the mesoderm.
(A) Genotypes of individuals generated for screening and for negative and positive controls. Deficiencies leading to at least 30% of individuals surviving to pupal stage were considered to be suppressor. (B) Genes and suppressive regions identified in the screen. Each chromosome arm (X, 2L, 2R, 3L, 3R) is depicted with suppressor genes and suppressive regions (R). Suppressive regions are regions identified using deficiencies and for which the specific suppressor genes could not be identified following the screen pipeline. (C) List of suppressor genes identified in the screen classified using Gene Ontology. Mutant alleles are listed in S1 Table.
Overview of the genetic screen to identify suppressors of larval lethality induced by expression of PABPN1-17ala in the mesoderm.
(A) Genotypes of individuals generated for screening and for negative and positive controls. Deficiencies leading to at least 30% of individuals surviving to pupal stage were considered to be suppressor. (B) Genes and suppressive regions identified in the screen. Each chromosome arm (X, 2L, 2R, 3L, 3R) is depicted with suppressor genes and suppressive regions (R). Suppressive regions are regions identified using deficiencies and for which the specific suppressor genes could not be identified following the screen pipeline. (C) List of suppressor genes identified in the screen classified using Gene Ontology. Mutant alleles are listed in S1 Table.Large deficiencies from the Drosophila deficiency kit (Bloomington Drosophila Stock Center) covering most of the genome were heterozygously introduced into the UAS-PABPN1-17ala/+; 24B-Gal4/+ background, and deficiencies leading to at least 30% of individuals surviving to pupal stage were considered as suppressor (Fig 1A). This threshold was determined using a positive control line UAS-NLS-3F5 expressing an anti-PABPN1 intrabody that we have shown to be very efficient in preventing OPMD defects in Drosophila [31] (Fig 1A). In total 252 large deficiencies were screened covering about 87% of the genome and 63 deficiencies were found to be suppressor (S2A Fig). Suppressor genes within these deficiencies were identified as follows. For each large deficiency found to be suppressor, the same screen was applied with smaller deficiencies spanning the large deficiency to identify smaller suppressive regions (S1 Table). 92 smaller deficiencies were screened allowing to narrow down 27 suppressive genomic regions (S1 Table and S2B Fig). Then, the same screen was applied again with heterozygous mutants or RNAi of candidate genes localized in suppressive regions (S1 Table). Candidate genes were determined based on their reported relationships with OPMD and/or PABPN1, their higher expression in OPMD Drosophila muscles compared to wild type [31], and with the help of Endeavour-HighFly, a software application for the computational prioritization of candidate genes [42]. In total, 142 mutant genes were tested allowing to identify 46 suppressor genes of OPMD phenotypes in Drosophila and pinpoint several molecular pathways involved in OPMD (Fig 1B and 1C and S1 Table). Importantly, among these pathways, a number have previously been shown to contribute to OPMD. Although this was not unexpected since a number of candidate genes to be analyzed were selected based on their previous links with OPMD, this nonetheless validated the screen. The most prominent pathways (i.e. with the higher number of genes): "Mitochodrion" and "mRNA deadenylation" (Fig 1C) were previously demonstrated to play a key role in OPMD pathogenesis [23]. "mRNA processing" and "Translation" were other identified pathways consistent with the molecular functions of PABPN1. The "Hsp70/Hsp90" pathway that came up in the screen was also previously shown to contribute to OPMD [40]. Finally, another notable pathway that was identified by several genes was "Proteasome/Proteolysis" that we also previously reported to be highly deregulated in OPMD animal models and patients [37].Overall, the genome-wide genetic screen based on survival of lethal expression of PABPN1-17ala allowed to identify a large number of new genes and pathways contributing to OPMD pathogenesis.
Functional implication of the UPS in OPMD
Although the UPS was shown to be consistently deregulated in OPMD animal models and in patients [37], its functional implication in OPMD has not been addressed in vivo. Consistent with upregulation of a number of UPS components in OPMD during disease progression [23,37], results of the genetic screen suggested that decreasing the gene dosage of UPS components might be beneficial for OPMD in Drosophila (Fig 1C). Strikingly, mutants of three subunits of the proteasome, Rpn3, Rpn10 and Rpn11 were found to reduce OPMD phenotypes. To address more thoroughly the functional involvement of the UPS in OPMD, we performed a second screen based again on the rescue of UAS-PABPN1-17ala/+; 24B-Gal4/+ larval lethality, but targeted on UPS components. Heterozygous mutants of UPS components were introduced into the UAS-PABPN1-17ala/+; 24B-Gal4/+ background, and survival to pupal stage was recorded. In total 31 components of the UPS were tested, including E2 ubiquitin conjugating-enzymes, E3 ubiquitin ligases, deubiquitinating enzymes and subunits of both the regulatory and core particles of the proteasome (Fig 2A and 2B). 24 of the 31 (77%) tested genes were found to be suppressors of OPMD and the positive genes fell into both the ubiquitination and degradation steps of protein processing by the UPS (Fig 2A and 2B and S2 Table). Deubiquitinating enzymes that act oppositely to ubiquitin ligases were not expected to be identified as OPMD suppressors. Nevertheless, the scny gene that encodes the Usp36 deubiquitinating enzyme was recorded as suppressor (Fig 2A). This might reflect its recently reported role in stabilizing Myc protein, another suppressor of OPMD (Fig 1C), and in regulating an E3 ubiquitin ligase [43].
Fig 2
Results of the genetic screen targeted towards the UPS to identify suppressors of larval lethality induced by expression of PABPN1-17ala in the mesoderm.
(A) Results of the UPS screen. Mutant alleles are listed in S2 Table. They were used in the screen as heterozygote, as indicated in Fig 1A. (B) Schematic representation of the UPS. UPS components that were found to be positive in the screen are depicted in green. Subunits of the proteasome that were tested in the screen and had no suppressor effect are depicted in grey.
Results of the genetic screen targeted towards the UPS to identify suppressors of larval lethality induced by expression of PABPN1-17ala in the mesoderm.
(A) Results of the UPS screen. Mutant alleles are listed in S2 Table. They were used in the screen as heterozygote, as indicated in Fig 1A. (B) Schematic representation of the UPS. UPS components that were found to be positive in the screen are depicted in green. Subunits of the proteasome that were tested in the screen and had no suppressor effect are depicted in grey.These results reveal a functional role of the UPS in OPMD pathogenesis and indicate that decreasing UPS activity is beneficial for OPMD in the Drosophila model.
UPS mutants reduce OPMD muscle weakness and degeneration
To further understand the role of UPS in OPMD pathogenesis, we selected five UPS components and analyzed the effects of mutants on adult muscles. Rpn10 and Rpn11 are subunits of the 19S regulatory particle of the proteasome. Prosβ4 is a subunit of the proteasome 20S core particle. The proteasome maturation protein, Pomp coordinates the assembly of the 20S core proteasome complex and is required for production of newly formed proteasome [44-47]. Mind bomb 2 (Mib2) is a E3 ubiquitin ligase specific to muscles whose E3-RING-finger domains are required for myoblast fusion in the embryo, and development of thoracic indirect flight muscles (IFMs) in adult flies [48,49]. In addition, although Mib2 direct targets have not been identified, Mib2 was shown to physically interact with the Z-band-localized nonmuscle myosin [48]. Mutants of these five UPS components were selected to analyze their effect on OPMD phenotypes in adults. All mutants were homozygous lethal. We checked using RT-qPCR that the levels of the corresponding mRNA were reduced in heterozygous mutant flies (S3A and S3B Fig). This was the case for all mutants except for Rpn10. However, this Rpn10 mutant allele contains a P-element insertion in the coding sequence just downstream of the start codon (S3A Fig). Therefore, although Rpn10 mRNA levels were not decreased, the coding capacity is expected to be strongly affected in this mutant. We used the Act88F-PABPN1-17ala stock that we previously described [23] as an OPMD model in adults. This stock specifically expresses alanine-expanded PABPN1 in adult IFMs, leading to 50–60% of flies with abnomal wing posture at day 6 of adulthood (Fig 3A and 3B) [23]. We previously reported that wing posture defects (wings held up or down) in OPMD fly models reflected both affected muscle function prior to the appearance of altered sarcomeric structure, and muscle degeneration [40]. The Act88F-PABPN1-17ala stock was crossed with mutants of the five selected UPS components. The presence of all five heterozygous mutants significantly reduced the percentage of flies with wing posture defects to between 34 and 6% (Fig 3B). Because the UPS mutants affect all tissues, we used the UAS/Gal4 system to validate the muscle-specificity of their suppressor effect by knocking-down Pomp in muscles. Reduced expression of Pomp in Act88F-PABPN1-17ala/+ flies, following activation of UAS-Pomp-RNAi with the muscle-specific driver Mhc-Gal4, decreased the percentage of flies with defective wing posture (S3C Fig).
Fig 3
Decrease of muscle weakness and degeneration with mutants of UPS components.
(A) Genotypes and abbreviations used in Figs 3–6. (B) Percentages of flies with abnormal wing position were scored at day 6 or day 11 of adulthood at 25°C. Flies were scored from three to five independent crosses; the numbers of scored flies are indicated (n). **** p-value <0.0001, using the χ2 test. (C) Indirect flight muscles in wild-type and OPMD adult thoraxes visualized under polarized light at day 11. Six dorso-longitudinal muscles (DLMs) and seven dorso-ventral muscles (DVMs) were visualized and scored per hemi-thorax. White arrows and stars indicate very thin and broken or degenerating muscles, respectively, in OPMD fly thoraxes. (D) Quantification of affected muscles (as shown in the OPMD panel in C) in the different genotypes. The numbers of scored DLMs or DVMs are indicated (n). ****p-value <0.0001, **p-value <0.01, using the χ2 test. (E) Immunostaining of wild-type and OPMD DLMs with anti-Kettin (magenta) and anti-Mhc (green) to visualize myofibrils and sarcomeric structure. The three categories of defects are exemplified from OPMD DLMs. Scale bar: 15 μm. (F) Quantification of wild-type and affected DLMs in the three categories in the different genotypes at days 6 and 11. The numbers of scored muscles are indicated (n). ****p-value <0.0001, **p-value <0.01, using the Fisher’s exact test.
Decrease of muscle weakness and degeneration with mutants of UPS components.
(A) Genotypes and abbreviations used in Figs 3–6. (B) Percentages of flies with abnormal wing position were scored at day 6 or day 11 of adulthood at 25°C. Flies were scored from three to five independent crosses; the numbers of scored flies are indicated (n). **** p-value <0.0001, using the χ2 test. (C) Indirect flight muscles in wild-type and OPMD adult thoraxes visualized under polarized light at day 11. Six dorso-longitudinal muscles (DLMs) and seven dorso-ventral muscles (DVMs) were visualized and scored per hemi-thorax. White arrows and stars indicate very thin and broken or degenerating muscles, respectively, in OPMD fly thoraxes. (D) Quantification of affected muscles (as shown in the OPMD panel in C) in the different genotypes. The numbers of scored DLMs or DVMs are indicated (n). ****p-value <0.0001, **p-value <0.01, using the χ2 test. (E) Immunostaining of wild-type and OPMD DLMs with anti-Kettin (magenta) and anti-Mhc (green) to visualize myofibrils and sarcomeric structure. The three categories of defects are exemplified from OPMD DLMs. Scale bar: 15 μm. (F) Quantification of wild-type and affected DLMs in the three categories in the different genotypes at days 6 and 11. The numbers of scored muscles are indicated (n). ****p-value <0.0001, **p-value <0.01, using the Fisher’s exact test.
Fig 6
Myofibrillar proteins are more ubiquitinated and degraded in OPMD than in wild-type muscles.
(A) Western blot of protein extracts from thoracic muscles of wild-type and OPMD (Act88F-PABPN1-17ala/+) flies at days 3 and 6 revealed with anti-ubiquitin, showing the levels of polyubiquitinated proteins. α-Tubulin was used as a loading control. Quantification was performed using the ImageJ sofware with four biological replicates. Error bars represent SD. *p-value <0.05 using the unpaired Student’s t-test. (B) Western blot of myofibrillar proteins extracted from thoracic muscles of wild-type and OPMD (Act88F-PABPN1-17ala/+) flies at days 3, 6 and 11 revealed with anti-ubiquitin, showing the levels of polyubiquitinated proteins. α-Tubulin was used as a loading control. Quantification was performed using the ImageJ sofware with three to five biological replicates. Error bars represent SD. **p-value <0.01, *p-value <0.05, using the unpaired Student’s t-test. (C, D) Western blots of myofibrillar proteins extracted from thoracic muscles of wild-type and OPMD (Act88F-PABPN1-17ala/+) flies at days 3, 6 and 11 revealed with (C) anti-Actin or (D) anti-Mhc, showing the lower levels of Actin and Mhc in OPMD muscles. α-Tubulin was used as a loading control. Quantification was performed using ImageJ with four to eight biological replicates. Error bars represent SD. ****p-value <0.0001, **p-value <0.01, *p-value <0.05, using the unpaired Student’s t-test. (E) Western blots of myofibrillar proteins extracted from thoracic muscles of wild-type, OPMD, and OPMD with heterozygous UPS mutant flies at day 3, revealed with anti-Actin (top panel) and anti-Mhc (bottom panel). Genotypes are indicated in Fig 3A. The ribosomal protein RpL10Ab was used as a loading control. Quantification was performed using ImageJ with three biological replicates. Error bars represent SD. ****p-value <0.0001, **p-value <0.01, *p-value <0.05 using the unpaired Student’s t-test. OPMD was compared to wild type (WT), whereas the OPMD with heterozygous UPS mutant genotypes were compared to OPMD; the lack of stars for these genotypes indicates a lack of statistical significance.
To better evaluate the predictive value of the larval lethality screen on adult OPMD defects at the level of individual genes, we tested the suppressor effect in adults of the Prosβ1 heterozygous mutant that scored negative in the lethality screen (Fig 2A and S2 Table). Prosβ1 heterozygous mutant reduced the percentage of Act88F-PABPN1-17ala/+ flies with wing posture defects, revealing a suppressor effect of this mutant in adults (S3D Fig). This suggested that the number of UPS components having a suppressor effect on OPMD phenotypes based on the larval lethality screen was yet underestimated.OPMD defects are progressive and the percentage of Act88F-PABPN1-17ala/+ flies with abnormal wing posture increased to 81% at day 11 (Fig 3B). The significant rescue of wing posture defects in presence of the five UPS component mutants was maintained at day 11 (Fig 3B).We have previously reported that expression of PABPN1-17ala in thoracic muscles induces progressive muscle degeneration that can be recorded by visualizing IFMs under polarized light [30,40]. These muscles are composed of six dorso-longitudinal muscles (DLMs) involved in downward wing movements, and seven dorso-ventral muscles (DVMs) involved in upward wing movements (Fig 3C). We analyzed muscle degeneration in Act88F-PABPN1-17ala/+ flies at day 11 in the absence or presence of UPS heterozygous mutants by counting the number of affected DLMs and DVMs per thorax. In the absence of UPS mutants, 78% of DLMs and 50% of DVMs were altered in PABPN1-17ala expressing flies at day 11 (Fig 3C and 3D). In the presence of heterozygous mutants for the five UPS components, the percentages of both affected DLMs and DVMs were significantly reduced, with a stronger effect for DLMs (Figs 3D and S4A).We then studied OPMD muscle defects and rescue with UPS mutants at the level of sarcomere organization using immunostaining to visualize Mhc and Kettin (also known as Titin), a large Actin-binding protein that accumulates in Z discs. Immunostaining of adult IFMs revealed a series of defects in Act88F-PABPN1-17ala/+ flies related to defects observed upon knock-down of genes encoding myofibrillar components or involved in muscle organization [50]. We classified these defects under three categories: weakly affected, affected and strongly affected muscles (Fig 3E). The "weakly affected" phenotype corresponded to a slight mislocalization of Mhc to Z bands, and Kettin outside Z bands. In "affected" muscles, the sarcomeric structure was still visible, however, both Mhc and Kettin were highly delocalized, in Z bands and at the sarcomere periphery for Mhc, and outside Z bands in aggregates and at the sarcomere periphery for Kettin. In addition, myofibrils were thiner suggesting atrophy. The "strongly affected" phenotype corresponded to irregular or degenerated myofibrils and a complete loss of sarcomeric organization. Quantification of muscles with these three phenotype categories at day 6 and day 11 of adulthood confirmed the progressivity of muscle defects in OPMD flies with a higher percentage of muscles being strongly affected at day 11 and no muscles in the weakly affected category (Fig 3F). Muscle quantification in the presence of UPS heterozygous mutants revealed that all five mutants significantly reduced muscle defects at day 6, leading to lower percentages of strongly affected muscles and increased percentages of weaker phenotypes. This positive effect was still visible at day 11 although to a lower extent.Because OPMD defects in Drosophila depends on the levels of PABPN1-17ala, we verified using western blots, that the reduced wing position defects and muscle degeneration in the presence of UPS heterozygous mutants were not due to decreased levels of PABPN1-17ala (S4B Fig).Taken together, these results reveal that the UPS plays a key role in muscle defects in OPMD.
Increased proteasome activity in OPMD muscles
The overexpression of UPS components at the transcriptomic level in OPMD muscles [37], as well as the genetic rescue of OPMD muscle defects in the presence of UPS heterozygous mutants strongly suggest an increase of proteasome level and activity in OPMD muscles. We confirmed this hypothesis by directly measuring the chymotrypsin-like activity of the proteasome using in vitro assays. The chymotrypsin-like activity that is a proxy for proteasome levels in vitro, was significantly increased by approximately two-fold in Act88F-PABPN1-17ala/+ thoracic muscles compared to wild type muscles at both day 3 and day 6 (Fig 4A). Consistent with this, in gel assays to visualize proteasome assembly and activity, revealed higher level of active 26S proteasome in OPMD thoracic muscles compared to wild type, at day 3 and day 6 (Fig 4B). Furthermore, western blots also uncovered increased amounts of proteasome subunits in OPMD thoracic muscles at both day 3 and day 6 (S5A Fig). Measurements of the chymotrypsin-like activity in OPMD muscles in the presence of heterozygous mutants of proteasome subunits showed that it was reduced to wild-type levels by the Rpn10 mutation, although this reduction was not observed with mutants of the other proteasome subunits, Rpn11 and Prosβ4 (Fig 4A). This different outcome with the Rpn10 mutant might result from the specific role of this subunit in promoting 26S proteasome stability and thus proteasome disassembly upon reduction of Rpn10 levels [51-53]. When chymotrypsin-like activity was measured in thoracic muscles with the same heterozygous mutants but independently of PABPN1-17ala expression, a decrease was also observed with the Rpn10 mutant only (S5B Fig). Finally, as expected the chymotrypsin-like activity was not affected by heterozygous mutation of mib2 that encodes an E3-ubiquitin ligase (Figs 4A and S5B).
Fig 4
Proteasome activity is higher in OPMD than wild-type thoracic muscles.
(A) The proteasome chymotrypsin-like activity in protein extracts from thoracic muscles was measured using hydrolysis of the N-succinyl-leucine-leucine-valine-tyrosine-7-amino-4-methylcoumarin (Suc-LLVY-AMC) through AMC fluorescence, at day 3 and day 6 of adulthood. Quantifications were from wild-type, OPMD (Act88F-PABPN1-17ala/+) and OPMD with heterozygous UPS mutant thoracic muscles. Means of three biological replicates quantified three times. Error bars represent SEM. ****p-value <0.0001, ns: non significant compared to OPMD, using the unpaired Student’s t-test. F.U.: fluorescent units. (B) In-gel assay of proteasome assembly and activity. Proteasome complexes were separated using native gel electrophoresis. The gel was then incubated in the proteasome substrate Suc-LLVY-AMC and proteasome activity was visualized by the release of fluorescent AMC. (C) Immunostaining of IFMs with anti-p62 (green) and anti-ubiquitin (red) at day 3. White arrows point to each class of aggregates. Class I, II and III aggregates are exemplified from OPMD, Rpn10; OPMD and Pomp; OPMD IFMs, respectively. Note that small p62 foci do not systematically colocalize with ubiquitin whereas large aggregates do. Scale bar: 1 μm. (D) Quantification of the three classes of p62 aggregates in the different genotypes at day 3 of adulthood. ****p-value <0.0001, ***p-value <0.001, using the Fisher’s exact test.
Proteasome activity is higher in OPMD than wild-type thoracic muscles.
(A) The proteasome chymotrypsin-like activity in protein extracts from thoracic muscles was measured using hydrolysis of the N-succinyl-leucine-leucine-valine-tyrosine-7-amino-4-methylcoumarin (Suc-LLVY-AMC) through AMC fluorescence, at day 3 and day 6 of adulthood. Quantifications were from wild-type, OPMD (Act88F-PABPN1-17ala/+) and OPMD with heterozygous UPS mutant thoracic muscles. Means of three biological replicates quantified three times. Error bars represent SEM. ****p-value <0.0001, ns: non significant compared to OPMD, using the unpaired Student’s t-test. F.U.: fluorescent units. (B) In-gel assay of proteasome assembly and activity. Proteasome complexes were separated using native gel electrophoresis. The gel was then incubated in the proteasome substrate Suc-LLVY-AMC and proteasome activity was visualized by the release of fluorescent AMC. (C) Immunostaining of IFMs with anti-p62 (green) and anti-ubiquitin (red) at day 3. White arrows point to each class of aggregates. Class I, II and III aggregates are exemplified from OPMD, Rpn10; OPMD and Pomp; OPMD IFMs, respectively. Note that small p62 foci do not systematically colocalize with ubiquitin whereas large aggregates do. Scale bar: 1 μm. (D) Quantification of the three classes of p62 aggregates in the different genotypes at day 3 of adulthood. ****p-value <0.0001, ***p-value <0.001, using the Fisher’s exact test.Although quantification of the chymotrypsin-like activity in vitro can inform on active proteasome levels, it does not provide an accurate quantification of proteasome activity in vivo. Specifically, this in vitro assay is based on peptide degradation independently of ubiquitination and does not fully assess the complex process that leads to the degradation of a protein substrate by the proteasome in vivo [54]. We, therefore, used a previously reported in vivo assay to evaluate proteasome activity in OPMD thoracic muscles in the presence or absence of proteasome subunit heterozygous mutants. The autophagy receptor p62 binds ubiquitin and forms aggregates with ubiquitinated proteins upon accumulation of these proteins [55,56]. In particular, p62 was shown to form large ubiquitin-containing aggregates in the Drosophila fat body when proteasome activity was impaired through downregulation of various proteasome subunits [57]. We used this assay and quantified p62-ubiquitin aggregates using immunostaining of OPMD IFMs either or not heterozygous mutant for the proteasome subunits Rpn10, Rpn11 and Prosβ4, or the Pomp proteasome chaperone. Large p62-ubiquitin aggregates (class III: diameter >1.9 μm and reaching up to 4 μm) formed in the presence of all heterozygous mutants, whereas they were not found in OPMD muscles alone. In addition, the number of intermediate aggregates (class II: diameter 1.5 to 1.9 μm) increased in the presence of heterozygous mutants compared to OPMD alone (Fig 4C and 4D). These data are consitent with impaired proteasome activity in heterozygous mutants of proteasome subunits and Pomp.We conclude that OPMD is associated with increased proteasomal content and activity in muscles that substantially contributes to OPMD defects.
Reduced OPMD muscle defects by UPS mutants do not correlate with levels of PABPN1 aggregation
Deregulation of the UPS has previously been proposed to contribute to OPMD through the modulation of PABPN1-17ala aggregation [35-37]. However, this hypothesis has been tested in cell models of OPMD, but not in vivo, in animal models. Furthermore, nuclear aggregates of alanine-expanded PABPN1 in cell cultures do not display the dense fibrillar structure of those in OPMD patients and animal models [7,25,40,58], indicating that PABPN1 aggregates in cell models do not accurately reproduce aggregates in OPMD patients. To address whether the UPS mutants reduced degeneration of OPMD muscle through altering PABPN1-17ala aggregation, we analyzed PABPN1 nuclear aggregates in Act88F-PABPN1-17ala/+ thoracic muscles in the absence or presence of the UPS heterozygous mutants at day 11. We found that Rpn11, Prosβ4 and Pomp heterozygous mutants reduced PABPN1-17ala aggregation. For all three mutants, the number of nuclei with an aggregate was significantly lower, and the size of aggregates was also reduced in the presence of Pomp (Fig 5A–5D). In contrast, Rpn10 heterozygous mutants increased PABPN1-17ala aggregation; indeed the size of aggregates were bigger in the presence of this mutant (Fig 5C and 5D). Enhanced PABPN1 aggregation in the Rpn10 mutant background was consistent with reduced proteasomal activity measured in vitro using the chymotrypsin-like activity (Fig 4A). Finally, PABPN1-17ala aggregation was not affected by mib2 heterozygous mutant (Fig 5B–5D), in agreement with the proposed link of this E3 ubiquitin ligase with proteins involved in sarcomeric structure, rather than PABPN1.
Fig 5
PABPN1 aggregation in the presence of UPS hererozygous mutants does not correlate with OPMD muscle defects.
(A) Example of a PABPN1 nuclear aggregate. Immunostaining of IFMs from OPMD (Act88F-PABPN1-17ala/+) adult flies with anti-PABPN1 (green), showing nuclei with and without a nuclear aggregate. DNA was visualized with DAPI (blue). Scale bar: 2 μm. (B) Percentages of nuclei with PABPN1 nuclear aggregates in OPMD IFMs at day 11. Immunostaining of thoracic muscles with anti-PABPN1 and DAPI were used to visualize and score aggregates. The number of scored nuclei is indicated (n). ****p-value <0.0001, **p-value <0.01, ns: non significant, using the χ2 test. (C, D) Quantification of PABPN1 nuclear aggregate areas. Each aggregate was delimited in a focal plan and the surface was calculated using ImageJ. (C) Mean values of areas with SD are indicated in arbitrary units. The number of scored aggregates is indicated (n). (D) The distribution of cross-sectional areas is presented as box plots. The boxes represent 50% of the values; the horizontal lines within the boxes correspond to medians. **p-value <0.01, ns: non significant, using the unpaired Student’s t-test. Quantifications in B-D were from two independent experiments.
PABPN1 aggregation in the presence of UPS hererozygous mutants does not correlate with OPMD muscle defects.
(A) Example of a PABPN1 nuclear aggregate. Immunostaining of IFMs from OPMD (Act88F-PABPN1-17ala/+) adult flies with anti-PABPN1 (green), showing nuclei with and without a nuclear aggregate. DNA was visualized with DAPI (blue). Scale bar: 2 μm. (B) Percentages of nuclei with PABPN1 nuclear aggregates in OPMD IFMs at day 11. Immunostaining of thoracic muscles with anti-PABPN1 and DAPI were used to visualize and score aggregates. The number of scored nuclei is indicated (n). ****p-value <0.0001, **p-value <0.01, ns: non significant, using the χ2 test. (C, D) Quantification of PABPN1 nuclear aggregate areas. Each aggregate was delimited in a focal plan and the surface was calculated using ImageJ. (C) Mean values of areas with SD are indicated in arbitrary units. The number of scored aggregates is indicated (n). (D) The distribution of cross-sectional areas is presented as box plots. The boxes represent 50% of the values; the horizontal lines within the boxes correspond to medians. **p-value <0.01, ns: non significant, using the unpaired Student’s t-test. Quantifications in B-D were from two independent experiments.Strikingly, muscle degeneration was reduced in the presence of Rpn10 heterozygous mutant (Fig 3B–3D) despite increased PABPN1 aggregation. These data show that the reduction of muscle degeneration in the presence of UPS mutants can be uncoupled from reduced PABPN1 aggregation.
Myofibrillar proteins are more ubiquitinated and degraded in OPMD muscles
The UPS is a key regulator of muscle mass. Since the implication of the UPS in OPMD pathogenesis could be uncoupled from PABPN1 aggregation, we analyzed the UPS contribution to the degradation of myofibrillar proteins. First, the levels of ubiquitinated proteins in wild type and OPMD thoracic muscles were analyzed by western blots and found to be significantly higher in OPMD muscles at day 3 and day 6 of adulthood (Fig 6A). To specifically assess ubiquitination of myofibrillar proteins, western blots were performed using extracts enriched in myofibrillar proteins from wild type and OPMD thoracic muscles. Myofibrillar proteins were more ubiquitinated in OPMD muscles at days 3, 6 and 11 (Fig 6B).
Myofibrillar proteins are more ubiquitinated and degraded in OPMD than in wild-type muscles.
(A) Western blot of protein extracts from thoracic muscles of wild-type and OPMD (Act88F-PABPN1-17ala/+) flies at days 3 and 6 revealed with anti-ubiquitin, showing the levels of polyubiquitinated proteins. α-Tubulin was used as a loading control. Quantification was performed using the ImageJ sofware with four biological replicates. Error bars represent SD. *p-value <0.05 using the unpaired Student’s t-test. (B) Western blot of myofibrillar proteins extracted from thoracic muscles of wild-type and OPMD (Act88F-PABPN1-17ala/+) flies at days 3, 6 and 11 revealed with anti-ubiquitin, showing the levels of polyubiquitinated proteins. α-Tubulin was used as a loading control. Quantification was performed using the ImageJ sofware with three to five biological replicates. Error bars represent SD. **p-value <0.01, *p-value <0.05, using the unpaired Student’s t-test. (C, D) Western blots of myofibrillar proteins extracted from thoracic muscles of wild-type and OPMD (Act88F-PABPN1-17ala/+) flies at days 3, 6 and 11 revealed with (C) anti-Actin or (D) anti-Mhc, showing the lower levels of Actin and Mhc in OPMD muscles. α-Tubulin was used as a loading control. Quantification was performed using ImageJ with four to eight biological replicates. Error bars represent SD. ****p-value <0.0001, **p-value <0.01, *p-value <0.05, using the unpaired Student’s t-test. (E) Western blots of myofibrillar proteins extracted from thoracic muscles of wild-type, OPMD, and OPMD with heterozygous UPS mutant flies at day 3, revealed with anti-Actin (top panel) and anti-Mhc (bottom panel). Genotypes are indicated in Fig 3A. The ribosomal protein RpL10Ab was used as a loading control. Quantification was performed using ImageJ with three biological replicates. Error bars represent SD. ****p-value <0.0001, **p-value <0.01, *p-value <0.05 using the unpaired Student’s t-test. OPMD was compared to wild type (WT), whereas the OPMD with heterozygous UPS mutant genotypes were compared to OPMD; the lack of stars for these genotypes indicates a lack of statistical significance.We then directly quantified the levels of the contractile proteins Actin and Mhc in wild type and OPMD thoracic muscles at days 3, 6 and 11. Both Actin and Mhc amounts were reduced in OPMD muscles compared to wild type at the three time points (Fig 6C and 6D). Importantly, Actin and Mhc degradation was recorded at day 3, when muscles were only slightly affected (S6 Fig), revealing that myofibrillar protein degradation preceded strong muscle degeneration. To address the functional importance of this degradation of myofibrillar proteins in OPMD pathogenesis, we addressed whether myofibrillar protein levels were restored in OPMD thoracic muscles at day 3, in the presence of heterozygous UPS mutants. Strikingly, both Actin and Mhc levels showed a strong tendency to increase in OPMD muscles in the presence of all UPS mutants, although this increase was not statistically significant for all mutants due to some variability (Fig 6E). Actin and Mhc levels could reach wild-type levels in OPMD muscles in the presence of Rpn10, Pomp and mib2 heterozygous mutants.These results are consistent with an important role of the UPS in myofibrillar protein degradation in OPMD muscle defects and indicate that the implication of the UPS in OPMD pathogenesis involves its function in the degradation of myofibrillar proteins.
Pharmacological inhibition of proteasomal activity reduces OPMD muscle defects
To confirm the importance of the UPS in OPMD, we tested the effect of oral treatment with the inhibitor of proteasomal activity, MG132. The drug or the DMSO solvent alone were provided in the food from larval stages. First, the toxicity of MG132 was analyzed using wild-type larvae by recording the percentage of survival to adulthood of larvae fed with drug-supplemented food. MG132 was found to be non-toxic up to 600 μM in the food (Fig 7A). The drug was then provided at the increasing concentrations of 400, 500 and 600 μM to Act88F-PABPN1-17ala/+ individuals from larval stage up to the day of recording at adulthood. Wing posture defects were quantified from day 3 to day 11. Oral treatment with MG132 compared with DMSO alone, significantly reduced wing position defects at all time points and with the three concentrations, with a slightly stronger effect at 600 μM (Fig 7B). We then analyzed the effect of 600 μM of MG132 on PABPN1-17ala aggregation. Strikingly, MG132 treatment led to an increase of PABPN1-17ala aggregation that was visible through an increase of both the percentage of nuclei having an aggregate (15% at day 11 following MG132 treatment versus 11% in the presence of DMSO alone) (Fig 7C), and the size of aggregates (Fig 7D and 7E). We verified using western blots that the level of PABPN1-17ala was not affected by the MG132 treatment (Fig 7F). The enhancement of PABPN1 aggregation in the presence of MG132 was consistent with the reported regulation of PABPN1-17ala aggregation by the UPS in cell cultures [35,36]. Importantly, these in vivo data allowed to uncouple the UPS effect on PABPN1-17ala aggregation and its role in muscle degeneration in OPMD. Although, as expected PABPN1 aggregation load was higher upon reduction of proteasomal activity, defects in wing position that reflect muscle weakness and degeneration were decreased.
Fig 7
Pharmacological inhibition of the proteasome with MG132 reduces OPMD muscle defects.
(A) Toxicity of increasing concentrations of MG132 in DMSO or DMSO alone provided in the food to wild-type larvae. The percentage of flies reaching adulthood is represented. For each concentration, 240 individuals from three independent experiments were scored. (B) Quantification of wing posture defects of OPMD (Act88F-PABPN1-17ala/+) flies following oral treatment with DMSO alone or MG132 at increasing concentrations from first instar larval stage. Wing position defects were scored every day from day 3 to day 11 of adulthood. The numbers of scored flies from two independent experiments were: 299 to 383 for 0.2% DMSO; 103 to 142 for 400 μM MG132; 100 to 135 for 500 μM MG132; 83 to 137 for 600 μM MG132. ****p-value <0.0001, ***p-value <0.001, **p-value <0.01, *p-value <0.05, using the χ2 test. (C) Percentages of nuclei with PABPN1 nuclear aggregates in OPMD IFMs at day 11 of adulthood, following oral treatment from first instar laval stage with DMSO alone or MG132 at 600 μM. Immunostaining of thoracic muscles with anti-PABPN1 and DAPI were used to visualize and score aggregates. The number of scored nuclei is indicated (n). **p-value <0.01, using the χ2 test. (D, E) Quantification of PABPN1 nuclear aggregate cross-sectional areas. Each aggregate was delimited in a focal plan and the surface was calculated using ImageJ. (D) Mean values of areas with SD are indicated in arbitrary units. The number of scored aggregates is indicated (n). (E) The distribution of cross-sectional areas is presented as box plots. The boxes represent 50% of the values; the horizontal lines within the boxes correspond to medians. *p-value <0.05, using the unpaired Student’s t-test. Quantifications in C-E were from two independent experiments. (F) Western blot of thoracic extracts revealed with anti-PABPN1 showing that the total amounts of PABPN1 are not affected by feeding with MG132. α-Tubulin was used as a loading control.
Pharmacological inhibition of the proteasome with MG132 reduces OPMD muscle defects.
(A) Toxicity of increasing concentrations of MG132 in DMSO or DMSO alone provided in the food to wild-type larvae. The percentage of flies reaching adulthood is represented. For each concentration, 240 individuals from three independent experiments were scored. (B) Quantification of wing posture defects of OPMD (Act88F-PABPN1-17ala/+) flies following oral treatment with DMSO alone or MG132 at increasing concentrations from first instar larval stage. Wing position defects were scored every day from day 3 to day 11 of adulthood. The numbers of scored flies from two independent experiments were: 299 to 383 for 0.2% DMSO; 103 to 142 for 400 μM MG132; 100 to 135 for 500 μM MG132; 83 to 137 for 600 μM MG132. ****p-value <0.0001, ***p-value <0.001, **p-value <0.01, *p-value <0.05, using the χ2 test. (C) Percentages of nuclei with PABPN1 nuclear aggregates in OPMD IFMs at day 11 of adulthood, following oral treatment from first instar laval stage with DMSO alone or MG132 at 600 μM. Immunostaining of thoracic muscles with anti-PABPN1 and DAPI were used to visualize and score aggregates. The number of scored nuclei is indicated (n). **p-value <0.01, using the χ2 test. (D, E) Quantification of PABPN1 nuclear aggregate cross-sectional areas. Each aggregate was delimited in a focal plan and the surface was calculated using ImageJ. (D) Mean values of areas with SD are indicated in arbitrary units. The number of scored aggregates is indicated (n). (E) The distribution of cross-sectional areas is presented as box plots. The boxes represent 50% of the values; the horizontal lines within the boxes correspond to medians. *p-value <0.05, using the unpaired Student’s t-test. Quantifications in C-E were from two independent experiments. (F) Western blot of thoracic extracts revealed with anti-PABPN1 showing that the total amounts of PABPN1 are not affected by feeding with MG132. α-Tubulin was used as a loading control.These results strongly reinforce the notion that the contribution of the UPS to OPMD pathogenesis is independent of the level of PABPN1-17ala aggregation, but depends instead on its increased activity against muscle proteins. Moreover, they provide a proof-of-concept that pharmacological treatment reducing proteasomal activity might be beneficial for OPMD.
Discussion
In this paper, we functionally address the role of the UPS in OPMD pathogenesis using Drosophila OPMD models. Genetic screens have identified a large number of UPS components involved in the different steps of UPS-dependent protein degradation, including ubiquitin conjugating-enzymes, ubiquitin ligases and proteasome subunits, as contributing to OPMD. The genetic data reveal that decreasing the gene dosage of UPS components reduce OPMD muscle defects, suggesting that elevated UPS activity play an important role in OPMD pathogenesis. Molecularly, we find that the rescue of muscle defects in the presence of mutants for proteasome subunits can be uncoupled from reduced PABPN1-17ala aggregation. In contrast, the presence of these mutants consistently decreases the degradation of myofibrillar proteins. These data reveal that deregulation of the UPS in OPMD does not contribute to pathogenesis through PABPN1 aggregation, but through activated degradation of muscle proteins.Proteasome dysfunction has been described to be a major contributor of pathogenesis in several neurodegenerative diseases that involve protein aggregation, leading to the actual accumulation of aggregates [1,59]. Proteasome activity is known to decline with age, and this decline might participate in accumulation of pathological misfolded proteins. In addition, a common mechanism of proteasome inhibition has been reported to depend on small misfolded protein oligomers that stabilizes the proteasome in its closed gate conformation, thus preventing its activity [59,60]. Although some level of proteasome inhibition by a similar mechanism involving PABPN1 oligomers is likely in OPMD, our functional data indicate that this inhibition is counteracted by other molecular events (e.g. enhanced expression of UPS genes) that result in increased UPS activity towards myofibrillar proteins and eventually muscle atrophy (see Fig 8 for a model). Indeed, we found that myofibrillar organization and sarcomeric structure were progressively lost in OPMD muscles, and that these defects along with the loss of sarcomeric proteins were reduced in the presence UPS heterozygous mutants.
Fig 8
Model of the UPS involvement in OPMD pathogenesis.
PABPN1-17ala is present under three forms in OPMD muscles: soluble monomers, oligomers, and aggregates produced from oligomers. Oligomers can be degraded by the 26S proteasome; however, they tend to inhibit it by plugging its channel. PABPN1-17ala expression triggers oxidative stress by reducing mitochondrial activity. This, together with proteasome plugging with PABPN1-17ala oligomers lead to increased proteasome levels through transcriptional activation. Other UPS components important for myofibrillar protein degradation would also be activated, leading with higher proteasome levels to enhanced degradation of myofibrillar proteins and pathology. In the presence of heteozygous mutants of proteasome subunits, proteasome levels might increase through transcriptional compensatory regulation [81]. However, proteasomes are less active than normal, leading to decreased degradation of myofibrillar proteins. Nevertheless, the gain in overall proteasome activity might allow for more degradation of PABPN1-17ala oligomers and thus lower aggregation. In the presence of Rpn10 heterozygous mutant, proteasome assembly would be affected, leadind to decreased overall activity. Consequently both myofibrillar protein and oligomer degradation would be reduced, resulting in more myofibrillar proteins and enhanced PABPN1-17ala aggregation. Similarly, oral treatment with MG132 reducing the overall proteasome degradative capacity, would lead to improvement of myofibrillar protein levels, together with decreased degradation of PABPN1-17ala oligomers and thus more aggregates.
Model of the UPS involvement in OPMD pathogenesis.
PABPN1-17ala is present under three forms in OPMD muscles: soluble monomers, oligomers, and aggregates produced from oligomers. Oligomers can be degraded by the 26S proteasome; however, they tend to inhibit it by plugging its channel. PABPN1-17ala expression triggers oxidative stress by reducing mitochondrial activity. This, together with proteasome plugging with PABPN1-17ala oligomers lead to increased proteasome levels through transcriptional activation. Other UPS components important for myofibrillar protein degradation would also be activated, leading with higher proteasome levels to enhanced degradation of myofibrillar proteins and pathology. In the presence of heteozygous mutants of proteasome subunits, proteasome levels might increase through transcriptional compensatory regulation [81]. However, proteasomes are less active than normal, leading to decreased degradation of myofibrillar proteins. Nevertheless, the gain in overall proteasome activity might allow for more degradation of PABPN1-17ala oligomers and thus lower aggregation. In the presence of Rpn10 heterozygous mutant, proteasome assembly would be affected, leadind to decreased overall activity. Consequently both myofibrillar protein and oligomer degradation would be reduced, resulting in more myofibrillar proteins and enhanced PABPN1-17ala aggregation. Similarly, oral treatment with MG132 reducing the overall proteasome degradative capacity, would lead to improvement of myofibrillar protein levels, together with decreased degradation of PABPN1-17ala oligomers and thus more aggregates.The loss of muscle mass or atrophy also strongly depends on protein degradation by the UPS and a key actor of UPS-mediated atrophy is the E3 ubiquitin ligase MuRF1/TRIM63 that is directly involved in the degradation of myofibrillar proteins [61,62]. Molecular analyses of a mouse model of OPMD in which PABPN1-17ala is specifically expressed in muscles, have shown that atrophy plays a key role in OPMD pathogenesis [63]. Transcriptomic analyses of OPMD mouse muscles at three time points have identified muscle atrophy as one of the strongly deregulated pathways, one third of the genes progressively deregulated with time being associated with atrophy. These data were confirmed by histological and functional studies that also revealed progressive atrophy quantified through the reduction of muscle mass and associated with a reduction of the muscle strength. In addition, atrophy was confirmed in pharyngeal muscles of OPMD patients [64]. Importantly, in this mouse OPMD model, muscle atrophy correlates with increased levels of MuRF1/TRIM63 mRNA and increased proteasomal activity, thus suggesting that enhanced UPS-dependent muscle protein degradation does contribute to OPMD pathogenesis [63]. Furthermore, this notion is reinforced by studies of the Pabpn1-17ala/Pabpn1 OPMD mouse model that reproduces the disease genotype of OPMD patients [24]. These mice show a mild myopathic phenotype and reproduce the early mitochondrial defects, previously identified in the Drosophila model and confirmed in OPMD patients [23]. Strikingly, a proteomic analysis of the rectus femoris muscle from this mouse model revealed that, whereas depleted proteins were enriched in mitochondrial proteins, more abundant proteins were most significantly enriched for terms related to the proteasome complex (“proteasome”, “proteasome accessory complex”) [24]. The capacity of UPS mutants to reduce OPMD muscle defects in Drosophila demonstrates the functional importance in OPMD pathogenesis of increased UPS activity that leads to enhanced degradation of myofibrillar proteins. It should be noted that an homologue of MuRF1/TRIM63 is not present in the Drosophila genome [62]; therefore, the contribution of this E3 ubiquin ligase in OPMD could not be analyzed in Drosophila.Intriguingly, increased UPS activity might be a common mechanism leading to atrophy in various myopathies. An increased proteasome activity together with higher levels of Atrogin-1 mRNA that encodes a muscle specific E3 ubiquitin ligase were reported to contribute to muscle weakness and atrophy in a mouse model of myotonic dystrophy type 1 [65]. In this model, increased expression of UPS genes was recorded at an early time point preceding the onset of muscle weakness, consistent with the implication of higher proteasome activity in the pathogenesis [65]. Such an early UPS gene upregulation was also reported in the Pabpn1-17ala/Pabpn1 OPMD mouse model [24].The molecular basis of UPS gene upregulation in OPMD is currently unknown. A direct role of PABPN1 in alternative polyadenylation of UPS genes has been proposed, and a change in poly(A) site usage was shown to correlate with increased levels of Atrogin-1 mRNA [66]. However, the mouse and cell models used in this study involved solely a downregulation of Pabpn1 that, although likely contributing, does not completely explain OPMD pathology [24]. Alternative polyadenylation was not globally affected in the Pabpn1-17ala/Pabpn1 mouse model pointing to the implication of other molecular mechanisms underlying UPS gene upregulation in OPMD. Regarding the proteasome, its level is known to increase upon proteotoxic stress through enhanced transcription. In mammals, this enhancement is mediated by the transcription factors Nrf1 -activated upon proteasome impairment- and Nrf2 -activated upon oxidative stress- [67,68], and this function of Nrf2 is conserved in Drosophila [69,70]. Interestingly, oxidative stress through mitochondrial dysfunction is one of the earliest defects in OPMD [23]. In addition, reactive oxygen species were shown to enhance proteasome activity in a Drosophila model of amyotrophic lateral sclerosis (i.e. mutant of the gene encoding superoxide dismutase 1) [71]. Therefore, it is likely that oxidative stress contributes to proteasome upregulation in OPMD. Furthermore, PABPN1 oligomers might also participate in this process through proteasome inhibition [59,60] and subsequent activation of the proteasome stress response (Fig 8). This sequence of events might participate in the progressivity of the disease as proteasome upregulation would be the consequence of defects arising earlier. Thus, we propose the following molecular model contributing to OPMD progression. Reduced mitochondrial activity due to defective polyadenylation and poly(A) tail shortening of mRNAs encoding subunits of the respiratory chain arises early in OPMD, leading to oxidative stress [23,24]. This, together with accumulation of PABPN1 oligomers that might slowly build up in patients would induce proteasome upregulation via transcriptional activation. Higher levels of proteasome and other UPS components would lead to increased ubiquitination and degradation of myofibrillar proteins, resulting in turn in muscular atrophy (Fig 8).An important information from our study is the proof-of-concept that drug treatment decreasing proteasome activity is beneficial for OPMD in an animal model. We find that oral treatment with MG132 significantly reduces OPMD muscle defects quantified through the number of flies showing affected wing position. This improvement of muscle function is not linked to reduced PABPN1-17ala aggregation, since aggregation is enhanced following MG132 treatment. The proteasome was reported to regulate PABPN1 stability, therefore, this increase in PABPN1-17ala aggregation after MG132 treatment was expected. These data reinforce the notion that aggregates per se are not likely to be the major trigger of OPMD pathogenesis. In addition, aggregates might also be protective by titrating misfolded PABPN1 and/or toxic oligomers, as it has been shown for other proteinopathies [72]. Other conditions have been reported where improvement of muscle function in OPMD animal models is uncoupled from the decrease of PABPN1 aggregation [23]. In particular, acting directly to increase muscle mass through myostatin inhibition in a mouse model of OPMD, improves muscle function without decreasing PABPN1 aggregation [73]. A number of proteasome inhibitors are approved drugs that are routinely used in clinic for the treatment of myeloma and lymphoma [74]. Our data provide the first evidence that pharmacological inhibition of proteasome activity might represent a new therapeutic approach for OPMD.
Materials and methods
Drosophila stocks and genetics
w was used as control. Flies were raised at 25°C unless specified otherwise. The stock w; UAS-PABPN1-17ala; 24B-Gal4/ TM6B, tubP-Gal80, Tb was generated to perform the screens. Deficiency (Df) and mutant stocks were obtained from the Bloomington Drosophila Stock Center and the Vienna Drosophila Resource Center. The lists of Df and mutant alleles are provided in S1 and S2 Tables. w; UAS-PABPN1-17ala; 24B-Gal4/ TM6B, tubP-Gal80, Tb females were crossed to Df/Balancer or mutant/Balancer males at 22°C. For each experiment, control crosses were performed alongside experimental crosses with females of the same genotype and either w, Canton-S or w; UAS-LacZ males for negative controls, and w; UAS-3F5 males for positive controls. 3F5 is an anti-PABPN1 nanobody whose expression in muscles reduces OPMD muscle defects [31]. Five days after mating, males and females were discarded and crosses were kept at the same temperature until pupa formation. Pupae were scored in the tube and the percentage of [Tb+] pupae was determined. Crosses with negative control males produced 5–15% [Tb+] pupae. Experimental crosses producing >30% [Tb+] pupae identified suppressive Df. The suppressive regions within large Df were identified by setting up similar crosses with smaller Df spanning the large suppressive Df. These smaller Df were choosen using cytologically or molecularly characterized Df breakpoints, as well as the CytoSearch tool from FlyBase. The suppressor genes within suppressive regions were identified by setting up again similar crosses with mutant alleles, or exceptionally RNAi, of candidate genes. Candidate genes were determined using literature as well as Endeavour-HighFly, a sofware for computational prioritization of candidates genes [42]. Suppressor genes were identified by the presence of >30% [Tb+] pupae in the cross progeny. Mutant alleles of UPS components were analyzed using the same approach. The stock w; Act88F-PABPN1-17ala, Mhc-Gal4 was used to express Pomp RNAi in OPMD muscles. The Pomp stock carries Pomp RNAi at the attP2 site (P{y[+t7.7] v[+t1.8] = TRiP.GLC01750}attP2). The stock containing the landing site attP2 alone (P{caryP}attP2) was used as a control.
Preparation of drug supplemented medium and analysis of drug toxicity
Drug supplemented food was prepared as follows. Instant Drosophila medium (Carolina Biological Supply Company) was reconstituted in each vial with a solution of 1% yeast in water, supplemented with either increasing concentrations of MG132 (Santa Cruz Biotechnology sc-201270) diluted in DMSO (dimethyl sulphoxide, Sigma D2650), or DMSO alone. Each vial contained 5 ml or 2.5 ml of reconstituted medium, to raise larvae or adults, respectively. Individuals were fed with the drug from larval stages as follows: 70 to 80 first instar larvae were transferred per vial and developed in the same vial up to adulthood. 20 adults were transferred per vial in new vials with the same concentration of drug. Adults were transferred every three days to new vials containing fresh drug-supplemented food. To determine drug toxicity, 80 first instar larvae were transferred into vials containing drug- or DMSO alone-supplemented medium. Individuals reaching adulthood were scored.
Analysis of wing posture and adult musculature
Analysis of abnormal wing posture and visualization of thorax muscles under polarized light were performed as described previously [40]. Muscles were scored from two to three independent crosses.
Immunostaining and visualization of muscle structure
Embryonic and larval musculature was revealed using staining with phalloidin-ATTO 633 (Sigma 68825) 1:500. Staged embryos and dissected larval muscles were prepared according to standard procedure [75]. Dissection and immunostaining of adult fly hemi-thoraxes to analyze sarcomeric structure were performed as previously described [76]. The following primary antibodies were used: mouse anti-Mhc (DHSB, 3E8-3D3) 1:50; rat anti-Kettin (Abcam, ab50585) 1:500. Immunostaining of adult IFMs to quantify aggregates were performed as previously reported [40]. Dilutions of primary antibodies were as follows: rabbit anti-PABPN1 1:1000; rat anti-p62 (a gift from S. Gaumer) 1:500; mouse mono- and polyubiquitinated conjugates monoclonal antibody (FK2, Enzo Life Sciences) 1:500. DNA was labeled with 1 μg/ml DAPI (Sigma-Aldrich). Confocal sections were acquired using a Leica SP8 confocal scanning microscope. PABPN1 nuclear aggregates were identified based on anti-PABPN1 staining and the lack of DAPI staining; their surfaces were measured using ImageJ. Quantification of p62 aggregates was performed as follows. Images were analyzed using the Analyze Particules tool in ImageJ. The parameters for particule surface and circularity were set up to identify three classes of aggregates: Class I, diameter >0.25 and <1.5 μm; Class II, diameter 1.5–1.9 μm; Class III diameter >1.9 μm; circularity range allows identification of elongated polygon to perfect circle.
Western blots
Western blots of adult indirect flight muscles were performed as reported previously [40]. For all western blots, the protein used as a loading control was revealed on the same western blot. Regular protein samples were prepared by direct grinding of dissected thoraxes in Laemmli buffer, followed by 5 min incubation at 95°C. Myofibrillar proteins were extracted from dissected thoracic muscles as follows. Muscles from ten thoraxes were dissected in 300 μL of lysis buffer (5 mM Tris pH 7.5, 5 mM EDTA, 1 mM PMSF, protease inhibitor cocktail (10 μL/mL of lysis buffer), 10 mM NEM, 1% Triton X100) [77] and centrifuged at 10,000 g and 4°C for 10 min. After removal of the supernatant containing the cytoplasmic fraction, the pellet enriched in myofibrillar proteins was resuspended in 100 μL of lysis buffer and sonicated with five cycles of 30 sec ON/30 sec OFF sonication using the Bioruptor Pico. Myofibrillar protein extracts were conserved at -80°C before loading with Laemmli buffer on acrylamide gels. Antibody dilutions for western blots were as follows: rabbit anti-PABPN1 [78] 1:2500; mouse anti-Ubiquitin Ubi-1 (13–1600, Life Technology) 1:1000; rat anti-myosin (MAC 147, Abcam ab51098) 1:10; mouse anti-α-tubulin (T5168, Sigma-Aldrich) 1:5000; rabbit anti-RpL10Ab [79] 1:5000; rabbit anti-Rpn11 [80] 1:300; rabbit anti-Prosα2 [80] 1:500; mouse anti-Prosα7 (PW8110, Enzo Life Sciences) 1:1000.
Proteasome activity in vitro assays
Proteasome activity was analyzed using the fluorescent substrate N-succinyl-leucine-leucine-valine-tyrosine-7-amino-4-methylcoumarin (Suc-LLVY-AMC, I-1395, Bachem), specific for the chymotrypsin-like peptidase activity of the proteasomes. The samples were prepared from 10 thoraxes dissected on dry ice and lysed in 120 μL of ice-cold buffer (50 mM Tris-HCl pH 8.0, 0.5% IGEPAL, 5 mM MgCl2, 1 mM ATP, 1 mM DTT, 0.5 mM EDTA, 10% glycerol and complete protease inhibitor mixture (11697498001, Roche)). The lysis was achieved by three cycles of grinding with a pestle during 1 min on ice followed by 5 min homogenization at 4°C on a rotator. Lysates were centrifuged at 16,000 g for 20 min at 4°C to remove debris, and the supernatants were transferred to new tubes. Protein concentration was measured using Bradford assay and BSA as a reference. Chymotrypsin-like protease activity was measured as follows. 50 μg of protein extracts were incubated in 50 μL of assay buffer (20 mM Tris-HCl pH7.5, 5 mM MgCl2, 10% glycerol, 0.5 mM EDTA, 1 mM ATP, 1 mM DTT, 0.2 mM Suc-LLVY-AMC) in a black flat-bottom 96-well plate (Greiner bio-one). Fluorescence of the released 7-amido-4-methylcoumarin (AMC) was measured at 380 nm excitation wavelength and 440 nm emission wavelength, every 5 min for 60 min at 37°C using a Fluostar Optima 96-well plate reader. The reaction was quenched by the addition of sodium dodecyl sulfate (SDS) to a final concentration of 1%. Fluorescence was recorded as arbitrary units and measurements at 20 min are shown. Measurements were from three biological replicates quantified in triplicate. For the zymogram of chymotrypsin-like proteasome activity in native gels, 15 μg of protein extracts were loaded onto 3.8% acrylamide native gels. Electrophoresis was performed for 3 to 4 h at 150 V in migration buffer (90 mM Tris-base, 90 mM boric acid, 0.1 mM EDTA, 0.5 mM ATP, 5 mM MgCl2, 0.5 mM DTT). The chymotrypsin-like proteasome activity was visualized by incubating gels for 20 min at 37°C in 100 μM Suc-LLVY-AMC in migration buffer. The fluorescence was visualized using an UV imaging system.
RT-qPCR
RT-qPCR were performed as previously described [23]. The primers were as follows.Rpn10: TCAGTGGCAAAGTGACAAGC; GTTGGAAAGTAGTCTCCGTTGRpn11: TGAGCACTGTTCCATCAACG; TCGGGCGTCATTTTCTCCTCProsβ4: CGCCCGATCCATTATAGTGAT; TTGCGCATCTTGTACAACGCPomp: CCCTCAAGATGGGCATGGAG; TGTTCTCGGGCAAGTTCATGmib2: CAAATTGAGCCAACCAAACGC; AACGTCCGATTTCGCAAACGsop: CACCCCAATAAAGTTGATAGACCT; ACCACCACGAGAGCCAAAT
Statistical analyses
All statistical analyses were performed using GraphPad Prism software (GraphPad, La Jolla, CA, USA).
Results of the genome-wide screen.
(XLSX)Click here for additional data file.
List of UPS genes tested in the second screen and results of the screen.
(XLSX)Click here for additional data file.
Numerical values of data in Figs 4, 5 and 7.
(XLSX)Click here for additional data file.
Charaterization of the PABPN1-17ala/+; 24B-Gal4/+ OPMD model.
(A) Musculature of late PABPN1-17ala/+; 24B-Gal4/+ and control 24B-Gal4/+ embryos visualized using phalloidin staining. No major muscle defects were visible (n = 46 and 52 PABPN1-17ala/+; 24B-Gal4/+ and control embryos, respectively). Scale bar: 10 μm. (B) Musculature of PABPN1-17ala/+; 24B-Gal4/+ and control 24B-Gal4/+ third instar larvae visualized using phalloidin staining. Three adjacent hemi-segments are shown. Arrows point to very thin muscles, arrowheads to splitted muscles, and stars to broken muscles. All muscles in OPMD larvae are thiner than in control larvae. Scale bar: 100 μm. (C) Quantification of affected muscles visualized in B. The number of hemi-segments with defective muscle fibers described in B were scored. Note that in 24B-Gal4/+ control larvae, a single muscle fiber was defective per affected hemi-segment. ****p-value <0.0001 using the χ2 test.(PDF)Click here for additional data file.
Number and location of suppressive deficiencies identified in the genome-wide screen.
(A) Number of positive deficiencies from the Deficiency kit, identified in the genome-wide OPMD screen, per chromosome arm. The Deficiency kit from the Bloomington Drosophila Stock Center corresponds to a set of large deficiencies covering most of the Drosophila genome. (B) Localization of suppressive regions identified in the genome-wide OPMD screen, per chromosome arm. Suppressive regions were identified using large deficiencies from the Deficiency kit and smaller deficiencies spanning the large positive deficiencies.(PDF)Click here for additional data file.
Characterization of UPS mutants.
(A) Schematic representation of UPS gene mutations used from Fig 3. The depicted mutations correspond to P-element or piggyBac insertions, except for mib2. Thin lines indicate intergenic regions and introns, open boxes represent UTRs and black boxes represent coding sequences. (B) Quantification of mRNA levels in the corresponding heterozygous mutant compared to wild type using RT-qPCR. RNAs were prepared from thoraxes of the indicated genotypes at day 6. sop was used as a control mRNA. Quantification in triplicates of three biological replicates. *p-value <0.05, ns: non significant, using the unpaired Student’s t-test. (C) Decrease of wing position defects following expression of Pomp RNAi in muscles with Mhc-Gal4. Left panel: Percentages of flies with abnormal wing position were scored at day 6; the numbers of scored flies are indicated (n). attP2 is the insertion site in which Pomp-RNAi was introduced and the stock bearing attP2 alone was used as control. **** p-value <0.0001, using the χ2 test. Right panel: quantification of Pomp mRNA levels using RT-qPCR. Legend is as in B. **p-value <0.01, using the unpaired Student’s t-test. (D) Effect of Prosβ1 heterozygous mutant in OPMD adult flies. Percentages of flies with abnormal wing position were scored at day 6; the numbers of scored flies are indicated (n). **** p-value <0.0001, using the χ2 test. Abbreviations and genotypes used in C and D are indicated.(PDF)Click here for additional data file.
Decrease of muscle degeneration with mutants of UPS components.
(A) IFMs in OPMD flies in the presence of UPS heterozygous mutants visualized under polarized light at day 11. IFMs are less affected in all genotypes compared to OPMD IFMs alone. Quantification of affected muscles is shown in Fig 3D. (B) Western blots of thoracic extracts revealed with anti-PABPN1 showing that the total amount of PABPN1 is not affected by mutants of the UPS components. α-Tubulin was used as a loading control.(PDF)Click here for additional data file.
Quantification of proteasome subunits in wild-type and OPMD muscles and of proteasome chymotrypsin-like activity in wild type and UPS heterozygous mutants.
(A) Western blots of protein extracts from thoracic muscles of wild-type and OPMD (Act88F-PABPN1-17ala/+) flies at days 3 and 6 revealed with antibodies against three proteasome subunits: Prosα2, Prosα7 and Rpn11. α-Tubulin was used as a loading control. Quantification was performed using the ImageJ sofware with three to four biological replicates. Error bars represent SD. ****p-value <0.0001, ***p-value <0.001, **p-value <0.01, *p-value <0.05, using the unpaired Student’s t-test. (B) Proteasome chymotrypsin-like activity of protein extracts from wild-type and heterozygous UPS mutant thoracic muscles, at day 3 and day 6 of adulthood. Chymotrypsin-like activity was quantified by measuring AMC fluorescence following hydrolysis of Suc-LLVY-AMC. Means of three biological replicates quantified three times. Error bars represent SEM. ****p-value <0.0001, *p-value <0.05, ns: non significant, using the unpaired Student’s t-test.(PDF)Click here for additional data file.
Weak defects in OPMD (Act88F-PABPN1-17ala/+) thoracic muscles at day 3.
(A) IFMs in wild-type and Act88F-PABPN1-17ala/+ thoraxes visualized under polarized light at day 3. Six DLMs and seven DVMs were scored per hemi-thorax. The white arrow indicates a slight defect in a DLM, which is representative of the weak defects visible at that time. (B) Quantification of affected muscles. The numbers of scored DLMs or DVMs are indicated (n). No defects were observed in indirect flight muscles of wild-type flies (n = 54 DLMs and 105 DVMs).(PDF)Click here for additional data file.24 May 2021Dear Dr Simonelig,Thank you very much for submitting your Research Article entitled 'Activation of the ubiquitin-proteasome system contributes to oculopharyngeal muscular dystrophy through muscle atrophy' to PLOS Genetics.The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time.Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsPlease be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.Yours sincerely,Bingwei LuAssociate EditorPLOS GeneticsGregory BarshEditor-in-ChiefPLOS GeneticsReviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: In this manuscript, Ribot et al. examine the role that increased proteasome activity plays in a drosophila model of oculopharyngeal muscular dystrophy, which is due to polyA tract expansion in the PABPN1 nuclear protein. The authors designed a screen based on genomic deficiencies to identify modifiers of developmental lethality induced by expression of PABPN1 in skeletal muscle. They identify components of the ubiquitin proteasome as responsible for muscle degeneration induced by PABPN1. The authors went on to test the impact of heterozygous mutations for some components of the proteasome and associated proteins and found that they rescue muscle degeneration (as estimated with histological analyses and assessment of wing positioning). They also test whether MG132, a proteasome inhibitor, can reduce PABPN1-induced muscle degeneration and found it to be the case. The authors also report that preservation of muscle integrity occurs independently from PABPN1 aggregates, and suggest that proteasome hyperactivation (induced by mutant PABPN1) is the key reason for muscle degeneration.Overall, this manuscript provides a sound take-home message given that while the proteasome is needed to degrade aggregation-prone proteins and for normal protein turnover, it is also known to cause muscle atrophy when overactive. Therefore it is not surprising that preventing its overt activation may be protective for muscle mass in certain conditions such as oculopharyngeal muscular dystrophy.This reasonable take-home message is however not completely supported by the data included in this manuscript. There are a number of inconsistencies that weaken the manuscript and some assays do not appear robust, as explained in detail here below. In particular, most of the figures in the manuscript (Figure 3 onward) are based on the use of a series of heterozygous mutants for proteasome components (Rpn10, Rpn11, ProsB4, Pomp) and for an E3 ligase (mib) which are used as tools to inhibit the proteasome. The authors find that in all cases these heterozygous mutants can rescue PABN1-induced muscle degeneration (Figure 3,5,6). However, whereas Rpn10 heterozygous mutants reduce proteasome activity (Fig. 4A), heterozygous mutants of Rpn11, ProsB4, Pomp, and mib do not affect the proteolytic activity of the proteasome (Fig. 4). On this basis, there is currently little evidence to conclude that proteasome inhibition is responsible for reducing muscle degeneration induced by PABPN1 as only Rpn10 heterozygous mutants seem to impact proteasome function. Moreover, it remains unknown how heterozygous mutations of Rpn11, ProsB4, Pomp, and mib2 rescue muscle degeneration via mechanisms unrelated from proteasome function.Specific comments:Figures 1-2: these figures report schemes that summarize the results of the screen. It would be better to provide a summary with quantitative data, particularly for selected proteasome genes shown in Figure 2.Figure 2: It is surprising to see several E3 ligases that rescue PABPN1-induced degeneration. E3 have normally specific set of target proteins and therefore normally have unique biological functions. Likewise, because DUBs can oppose E3 function by removing polyubiquitin chains, it is surprising to see that they score like E3s. It would be helpful if the author could show the quantitative data and provide information on the controls used in these experiments.Figures 3-4: The authors use a series of heterozygous mutants for proteasome components (Rpn10, Rpn11, ProsB4, Pomp) and an E3 ligase (mib) to test whether they can be used to inhibit the proteasome. They find that in all cases these heterozygous mutants can rescue PABN1-induced muscle degeneration (Figure 3).However, whereas Rpn10 heterozygous mutants reduce proteasome activity (Fig. 4A), heterozygous mutations of Rpn11, ProsB4, Pomp, and mib do not affect the proteolytic activity of the proteasome (Fig. 4). On this basis, how do the authors explain the rescue of muscle degeneration by heterozygous mutations of Rpn11, ProsB4, Pomp, and mib2? There is currently little basis to conclude that proteasome inhibition is responsible for reducing muscle degeneration induced by PABPN1 as only Rpn10 heterozygous mutants seem to impact proteasome function.Moreover, if not by impacting the proteasome, how would heterozygous mutations of Rpn11, ProsB4, Pomp, and mib rescue PABPN1-induced muscle degeneration?The heterozygous mutants for proteasome components here used have not been characterized molecularly. What is the evidence that they reduce the mRNA or protein levels of the targeted genes (Rpn10, Rpn11, ProsB4, Pomp, and mib2)? qRT-PCR analysis should be sufficient to address this point.The authors use whole-body heterozygous mutants for proteasome components. The conclusions would be strengthened by using transgenic modulation (such as RNAi) of these or other proteasome components targeted to skeletal muscle.Experiments with isogenic genetic background would be useful to avoid confounding effects deriving from genetic background mutations. At present, it seems that all experiments have been done with varied genetic backgrounds which could impact the outcome of these experiments.Figure 5: In this figure, the authors have scored the number of nuclei with PABPN1aggregates. They report that PABPN1 aggregates slightly increase in response to proteasome inhibition and on this basis argue that the aggregates per se are not the cause of muscle atrophy. While this reviewer agrees with this notion, the supporting data is weak.Specifically, changes in the number of nuclei with aggregates as well as in the nuclear aggregate cross-sectional area appear minor, even if statistical significant (which is due to the high number of nuclei scored).There is also some inconsistency across interventions: in Fig. 5D the nuclear aggregate cross-sectional area increases for Rpn10-/+, does not change for Prosb4-/+, and decreases for Pomp+/-. As these mutations are all supposed to affect the proteasome, it is puzzling on why they would score differently. But most importantly, why do the authors continue to use all these mutants? From studies in Fig. 4, they know that only Rpn10 mutants affect the proteolytic activity of the proteasome so I do not see any basis to employ other heterozygous mutants to inhibit the proteasome if in fact they do not.There is inconsistencies in the impact of these proteasome mutations on “the percentage of nuclei with aggregates“ (Fig. 5B) versus the “nuclear aggregate cross-sectional area” (Fig. 5D). One would expect these two estimates to be largely overlapping but they are not.Based on the results in Fig. 4 that have shown an effect on proteasome activity only for Rpn10 mutations, I would have expected only Rpn10 mutations to score and that other mutants would have no effect. Instead Fig. 5B reports no effect of Rpn10-/+ on the percentage of nuclei with aggregates.The authors should provide an explanation for these inconsistencies and use more robust (biochemical) methods to detect aggregate versus oligomeric PABPN1 if they want to draw conclusions on how inhibiting the proteasome affects PABPN1 aggregation.Comment: PABPN1 aggregation is described as a deleterious aspect. While that is certainly a disease biomarker that indicates loss of function of PABPN1, it has been shown in other contexts that it is actually protective that aggregation-prone proteins are sequestered in defined compartments (aggregates or aggresomes), in order to reduce their interaction with native proteins. There are indeed several studies in other diseases showing that oligomers can be more toxic than larger aggregates.Figure 6: same issues as above. The authors use heterozygous mutants for proteasome components that do not impact proteasome function (as demonstrated in Fig. 4) but they draw conclusions from these experiments as if these mutants would be inhibiting proteasome function.Figure 7: The authors show that feeding larvae with a proteasomal inhibitor (up to 600uM of MG132) reduces wing positioning defects due to mutant PABPN1. Why is this drug provided from larval development, what is the rationale for this? In fact, because there is no feeding through pupal development and because most larval muscle are histolyzed during pupal development, it is unlikely that larval feeding of MG132 has a direct impact in preserving myofibrils as these are degraded anyway during the pupal stages of development, apart for persistent muscles. Moreover the PABPN1 transgene seems to be expressed under the control of Act88F, which is not expressed in larval muscles. On this basis, it is unclear how feeding MG132 at the larval stages will impact aggregation and toxicity of PABPN1 in adult muscles at day 1. What is the reason of this larval feeding regimen? Are the same results obtained with MG132 feeding restricted to adult flies?Reviewer #2: The authors use a Drosophila model of oculopharyngeal muscular dystrophy (OPMD), made by expression of a mutant mammalian poly(A) binding protein nuclear 1 (PABPN1) protein containing an expanded polyalanine tract, to follow up on previous transcriptomic work showing a deregulated ubiquitin-proteasome system (UPS). OPMD is a complex muscle disease, wherein multiple functions are affected due to the presence of the mutant protein. Here the authors focus on protein degradation and PABPN1 aggregation. They used both targeted and genome-wide genetic screening for improved muscle function to identify specific UPS components whose downregulation reduces myofibrillar protein degradation. These do not consistently reduce PABPN1 aggregation. This contrasts with previous work showing that reducing PABPN1 aggregation improves muscle function. Further, inhibition of the proteasome yields similar results, suggesting a potential therapeutic approach for disease treatment. This is a well-done paper containing a tremendous amount of experimental data, with a strong genetic component. The following comments should be considered by the authors:1. It would be helpful to provide more rationale for the Drosophila model. Why is the mammalian mutant PABPN used instead of a mutant Drosophila protein? Where is the mutant gene expressed and by what methodology? This may have been established in previous papers, but is important enough an issue to mention here. Further, it would be useful to point out that while it is a hybrid model, the screen may prove valuable for therapeutic use in that it is actually testing how defects affiliated with the mammalian protein can be suppressed.2. While the genome-wide screen seems extremely effective in identifying suppressors, the fact that the suppressors were in previously identified pathways is not particularly surprising. This is because the investigators tested candidate genes (at least partially) based upon those with reported relationships with OPMD and/or PABPN1. This should be pointed out in the paper.3. The finding that reduction in expression of 77% of tested UPS genes suppressed lethality was impressive. Do the authors care to speculate why the remaining 23% did not? In this regard, the IFM defect suppression experiment is quite convincing, but did the authors try a negative control, i.e., a mutant for one of the UPS components that did not suppress lethality in the directed screen?4. For the western blots in Fig. 3E and Fig S2, how were the samples prepared? Presumably not by the myofibrillar protein isolation procedure given in the Methods section. For all western blots: are the blots for the control protein from the same gel or at least the same samples? This should be stated.5. Please speculate in the text on how the mutants work to reduce proteasome function, if activity of the proteasome is maintained in most of them (Fig. 4)?6. It would be better to state in the abstracts and elsewhere that the improved muscle structure/function observed due to reducing UPS components does not correlate with the levels of aggregate accumulation, since some of the current wording implies there is no change in aggregate accumulation.7. Why not include the statistical significance indicators in Fig. 5C?8. Why was tubulin replaced with a different control protein in Fig. 6E?9. It would be helpful to show (or refer to from another publication) a confocal or TEM image of sarcomeres from PABPN1 muscles and from PABPN1 muscles that have been rescued. Is there sarcomere degradation that is prevented?10. The authors might mention that aggregates could serve a useful function in removing misfolded proteins from the soluble cytoplasm to prevent their aberrant interactions.11. A number of the statistical comparisons (e.g., Fig 7C-E) compare only two independent experiments. Does PLoS permit this?Reviewer #3: see attachment**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: No: Numerical data are not provided for a few figure panels, just summary statistics and plots.Reviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: Yes: Sanford I. BernsteinReviewer #3: NoSubmitted filename: review Ribot et al., Plos Genetics D-21-00502.docxClick here for additional data file.29 Nov 2021Submitted filename: Ribot et al Point-by-point Response.pdfClick here for additional data file.14 Dec 2021Dear Dr Simonelig ,Thank you very much for submitting your Research Article entitled 'Activation of the ubiquitin-proteasome system contributes to oculopharyngeal muscular dystrophy through muscle atrophy' to PLOS Genetics.The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some concerns that we ask you address in a revised manuscriptWe therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.In addition we ask that you:1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsPlease review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]Please let us know if you have any questions while making these revisions.Yours sincerely,Bingwei LuAssociate EditorPLOS GeneticsGregory BarshEditor-in-ChiefPLOS GeneticsReviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #2: The authors have responded very well to my initial suggestions, including producing new experimental data. Most notably, they include a new series of fluorescent images of indirect flight muscles, which are also quantified as to phenotype. Some of the English usage is not precise in the revisions, but presumably will be corrected by a copy editor. Below are a few minor points that should be attended to for clarity:Page 11: Regarding the Rpn10 mutant, it is possible that the portion of the transcript that was tested by RT-PCR was produced at normal levels, but the P element in the coding sequence prevented normal translation. This may be what the authors meant by indicating it could be a null allele, but the explanation given in my first sentence would clarify that for the reader.Page 11: Explain that the mutant lines reduced the proteins in all tissues, so that is why you did the muscle-specific knockdown.Page 13 top: Change “checked” to “verified”. The word checked does not indicate what the outcome of the experiment was.Figure 3E legend: exemplified not examplified (Figure 4C as well). Anti-Kettin appears magenta rather than red in the image I was provided.Reviewer #3: Dear Authors,The revised manuscript contains additional data supporting the contribution of increased ubiquitin-proteasome activity to muscle atrophy in a Drosophila model of Oculopharyngeal Muscular Dystrophy. The authors have rather satisfactorily answered my suggestions and the criticisms and suggestions by other reviewers. Thanks for this.Among the revisions which significantly improved the ms:- The added S1 figure convincingly shows the strong muscle defects in 3rd instar larvae, contrasting with the absence of muscle defects in late embryos, indicative of a progressive muscle atrophy.- Fig.3 E and F (and 3C) nicely illustrate the progressivity of the disease.- Fig.4, 5, 6. Additional data showing reduced proteasome activity in transheterozygotes help interpreting differences in rescue scores between Rpn10 and Rpn11/Prosb4/Pomp- Fig.8. the inset: “yet compatible with PABPN17-Ala oligomer degradation except for rpn10” reflects well some seemingly contradictory data.- Discussion. One added sentence (last of the second-to-last paragraph): “this sequence of events might participate in the progressivity of the disease as proteasome upregulation would be subsequent to defects arising earlier, namely oxidative stress and accumulation of PABPN1 oligomers that might slowly build up in patients” summarizes some remaining questions (see below).Before publication, I would suggest a few more corrections.- Introduction: extend “we use a Drosophila model of OPMD” to: “we use a Drosophila model of OPMD induced by mesodermal expression of PABPN1” to make clear that it is not a genetic model.- Discussion: The authors might elaborate more on the added sentence: “this sequence of events might participate in the progressivity of the disease as proteasome upregulation would be subsequent to defects arising earlier, namely oxidative stress and accumulation of PABPN1 oligomers that might slowly build up in patients” using, for example, references abundantly quoted earlier in the discussion (23, 24, 65). As it is, extensive description of data from OPMD mouse models is more introduction than discussion of the new data reported here.- New Fig.S1. The figure legend could be more precise and help readers by: i) indicating that 3 adjacent hemisegments are shown. ii) highlighting one specific muscle by its name in the larval panels, (for example LL1 which is well visible and missing in one segment in the right-most panel).Reviewer #4: Interesting work.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #2: YesReviewer #3: YesReviewer #4: None**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #2: Yes: Sanford I. BernsteinReviewer #3: Yes: Alain VINCENTReviewer #4: NoSubmitted filename: Plos Genetics review_OPMD.docxClick here for additional data file.20 Dec 2021Submitted filename: Ribot et al.Point-by-point Response.pdfClick here for additional data file.1 Jan 2022Dear Dr Simonelig ,We are pleased to inform you that your manuscript entitled "Activation of the ubiquitin-proteasome system contributes to oculopharyngeal muscular dystrophy through muscle atrophy" has been editorially accepted for publication in PLOS Genetics. Congratulations!Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!Yours sincerely,Bingwei LuAssociate EditorPLOS GeneticsGregory BarshEditor-in-ChiefPLOS Geneticswww.plosgenetics.orgTwitter: @PLOSGenetics----------------------------------------------------Comments from the reviewers (if applicable):----------------------------------------------------Data DepositionIf you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-00502R2More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.----------------------------------------------------Press QueriesIf you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.7 Jan 2022PGENETICS-D-21-00502R2Activation of the ubiquitin-proteasome system contributes to oculopharyngeal muscular dystrophy through muscle atrophyDear Dr Simonelig,We are pleased to inform you that your manuscript entitled "Activation of the ubiquitin-proteasome system contributes to oculopharyngeal muscular dystrophy through muscle atrophy" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!With kind regards,Livia HorvathPLOS GeneticsOn behalf of:The PLOS Genetics TeamCarlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdomplosgenetics@plos.org | +44 (0) 1223-442823plosgenetics.org | Twitter: @PLOSGenetics
Authors: Janet E Davies; Lin Wang; Lourdes Garcia-Oroz; Lynnette J Cook; Coralie Vacher; Dominic G O'Donovan; David C Rubinsztein Journal: Nat Med Date: 2005-05-01 Impact factor: 53.440
Authors: Capucine Trollet; Seyed Yahya Anvar; Andrea Venema; Iain P Hargreaves; Keith Foster; Alban Vignaud; Arnaud Ferry; Elisa Negroni; Christophe Hourde; Martin A Baraibar; Peter A C 't Hoen; Janet E Davies; David C Rubinsztein; Simon J Heales; Vincent Mouly; Silvère M van der Maarel; Gillian Butler-Browne; Vered Raz; George Dickson Journal: Hum Mol Genet Date: 2010-03-05 Impact factor: 6.150
Authors: Aymeric Chartier; Vered Raz; Ellen Sterrenburg; C Theo Verrips; Silvère M van der Maarel; Martine Simonelig Journal: Hum Mol Genet Date: 2009-03-03 Impact factor: 6.150
Authors: Aymeric Chartier; Pierre Klein; Stéphanie Pierson; Nicolas Barbezier; Teresa Gidaro; François Casas; Steven Carberry; Paul Dowling; Laurie Maynadier; Maëlle Bellec; Martine Oloko; Claude Jardel; Bodo Moritz; George Dickson; Vincent Mouly; Kay Ohlendieck; Gillian Butler-Browne; Capucine Trollet; Martine Simonelig Journal: PLoS Genet Date: 2015-03-27 Impact factor: 5.917