Literature DB >> 35013476

Substantial rearrangements, single nucleotide frameshift deletion and low diversity in mitogenome of Wolbachia-infected strepsipteran endoparasitoid in comparison to its tephritid hosts.

Sharon Towett-Kirui1, Jennifer L Morrow1, Markus Riegler2.   

Abstract

Insect mitogenome organisation is highly conserved, yet, some insects, especially with parasitic life cycles, have rearranged mitogenomes. Furthermore, intraspecific mitochondrial diversity can be reduced by fitness-affecting bacterial endosymbionts like Wolbachia due to their maternal coinheritance with mitochondria. We have sequenced mitogenomes of the Wolbachia-infected endoparasitoid Dipterophagus daci (Strepsiptera: Halictophagidae) and four of its 22 known tephritid fruit fly host species using total genomic extracts of parasitised flies collected across > 700 km in Australia. This halictophagid mitogenome revealed extensive rearrangements relative to the four fly mitogenomes which exhibited the ancestral insect mitogenome pattern. Compared to the only four available other strepsipteran mitogenomes, the D. daci mitogenome had additional transpositions of one rRNA and two tRNA genes, and a single nucleotide frameshift deletion in nad5 requiring translational frameshifting or, alternatively, resulting in a large protein truncation. Dipterophagus daci displays an almost completely endoparasitic life cycle when compared to Strepsiptera that have maintained the ancestral state of free-living adults. Our results support the hypothesis that the transition to extreme endoparasitism evolved together with increased levels of mitogenome changes. Furthermore, intraspecific mitogenome diversity was substantially smaller in D. daci than the parasitised flies suggesting Wolbachia reduced mitochondrial diversity because of a role in D. daci fitness.
© 2022. The Author(s).

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35013476      PMCID: PMC8748643          DOI: 10.1038/s41598-021-04398-y

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Animal mitochondrial genomes (mitogenomes) are double-stranded DNA molecules with a length of 15–18 kb. They are generally circular chromosomes consisting of 37 genes including 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes and two ribosomal RNA (rRNA) genes, and one AT-rich region, also known as the control region[1,2]. Mitochondrial genes and mitogenomes have widely been used for DNA barcoding, and in phylogenetic and phylogeographic analyses across many animal taxa because of their conserved function yet relatively high substitution rates, maternal inheritance and very low levels of recombination[3-5]. Mitogenome studies focussing on individual species have revealed that some species have very low mitogenome diversity, and this has generally been attributed to bottleneck effects, also known as founder effects[6,7]. In insects, reduced mitogenome diversity can also be caused by maternally inherited bacterial endosymbionts such as Wolbachia that can invade host populations by either manipulating host reproduction or increasing host fitness in other ways (for instance, increased fecundity or resistance against pathogens)[8,9], resulting in selective sweeps and the hitchhiking of coinherited mitogenome variants[10-12]. Conversely, a recent modelling study also suggested that selection on mitochondrial genomes can lead to reduced symbiont variation across host populations[13]. Comparative mitogenome analyses across multiple phylogenetically diverse insect taxa have revealed in some insect lineages unusual genome characteristics such as gene duplications, changes of gene order, indels and differences in codon usage, nucleotide content and secondary structures of tRNA genes[14-17]. The rearrangement of gene order can include transposition, inversion and inverse transposition of mitochondrial genes, and can be used to infer phylogenetic relationships across different taxonomic levels[18-20]. It has been hypothesised that mitogenome rearrangements may occur because of recombination, but recombination in animal mitogenomes is generally rare[21]. The more likely process may be tandem duplication of a set of genes followed by the random loss of a part of the duplication, also known as tandem duplication random loss (TDRL) events[22-24]. Mitochondrial gene duplications have been observed in the scorpion fly, Microchorista philpotti[25] and in other invertebrates, such as Leptotrombidium chigger mites[26] and the parasitic nematode, Camallanus cotti[27]. However, such duplications may not persist for long before they result in pseudogenisation and loss of duplicated genes, and are not frequently seen in lineages with rearranged mitogenomes[22-24]. Mitogenome fragmentation has also been observed in several arthropod taxa and other organisms, and can lead to mitogenomes consisting of several small circular chromosomes[28-30]. Mitogenome rearrangements have occurred in several insect and other arthropod lineages with parasitic life cycles, for example, some hymenopteran endoparasitoid taxa[31]. Mitogenome rearrangements have also been found in ectoparasites, such as the wallaby louse, Heterodoxus macropus, and the small pigeon louse, Campanulotes bidentatus compar[20,32]. Similarly, mitogenome fragmentation has been found in parasitic human lice, Pediculus humanus, Pediculus capitis and Pthirus pubis[30], the macaque louse, Pedicinus obtusus and the colobus louse, Pedicinus badii[29]. Strepsiptera is a small insect order, with approximately 630 described species[33]. They are thought to have small genomes; using flow cytometry, the genome sizes of Caenocholax fenyesi and Xenos vesparum were estimated at 108 Mb and 130 Mb[34]. Their small genome size may be attributed to their endoparasitic life cycle, unusual morphological characteristics and unique features[18,35,36]. Strepsiptera display extreme sexual dimorphism. Adult females of most strepsipteran species are neotenic, with fused head and thorax, lacking typical characteristics of adult insects like wings, antennae, mouth and legs, and are permanently endoparasitic, except for the free-living adult females of the Mengenillidae[37,38]. In contrast, adult strepsipteran males undergo complete metamorphosis, and are free-living and winged[37]. Strepsiptera comprises two suborders, the Mengenillidia, with one family (Mengenillidae) and the Stylopidia with eight families, including the Xenidae and the Halictophagidae[33,39]. Strepsiptera are endoparasitoids of a wide range of hosts across seven insect orders: Blattodea, Hemiptera, Hymenoptera, Diptera, Mantodea, Orthoptera and Zygentoma[36,37]. Host attack occurs by the free-living first instar larvae (planidia). After three more larval instars within their hosts, in Stylopidia the neotenic females and male pupae extrude through the host’s cuticle; adult males then emerge from the pupae in the extrusions while the neotenic females remain fully endoparasitic. In contrast, Mengenillidae have maintained the ancestral state of free-living adults, and both females and males undergo pupation outside the host[36]. Until recently, the phylogenetic placement of Strepsiptera and its species has proved to be a challenge due to their morphological peculiarities and the scarcity of molecular data[39-41]. The sequencing of the mitogenomes of two species each of Mengenilla (Mengenillidae) and Xenos (Xenidae) has provided substantial progress[18,42-44]. Mitogenome comparisons revealed more changes in Xenos vesparum than Mengenilla australiensis when compared to the inferred ancestral holometabolan mitogenome arrangement[18]. These additional changes arose with the transition from Mengenillidae which still leave the host for pupation and have free-living adult females and males, to Stylopidia with endoparasitic neotenic females and free-living adult males and, therefore, a more extreme endoparasitic strepsipteran life cycle[18]. Nevertheless, molecular data of the largest strepsipteran family, the Halictophagidae, are crucial for a more comprehensive understanding of strepsipteran evolution, and in particular, their interactions with hosts and the transition to the more extreme endoparasitic life cycle of Stylopidia, with males that pupate inside the host and neotenic females that are fully endoparasitic. Dipterophagus daci is the only described strepsipteran parasitising Diptera (except for undescribed strepsipteran species from Papua New Guinean platystomatid flies) and has been recorded in 22 dacine fruit fly species (Tephritidae: Dacini) in Australia and the Solomon Islands[45-47]. Recent molecular analyses of whole genome sequencing (WGS) libraries of field-collected adult tephritid fruit flies from Australia detected genomic sequences of D. daci, including its entire mitogenome, indicative of concealed parasitisation of the sequenced flies[47]. Phylogenetic analyses of the D. daci mitochondrial cox1, nad1, 16S rRNA and nuclear 18S rRNA genes revealed that it belongs to the family Halictophagidae[47], confirming earlier morphological analyses which placed it into the halictophagid subfamily Dipterophaginae[33,37]. The WGS analyses and further diagnostic testing of both parasitised and unparasitised tephritid fruit fly individuals revealed a clear link between D. daci and two Wolbachia strain sequence types, ST-285 and ST-289, previously detected in these tephritid fruit fly samples at low prevalence[48,49]; this demonstrated that D. daci is the true host of these two strains, wDdac1 and wDdac2, which occur at a high prevalence in D. daci[47]. Furthermore, no Wolbachia genes known to cause host reproductive manipulations were found, and there was a low diversity in the mitochondrial PCGs of D. daci when compared with its nuclear 18S rRNA gene sequences[47]. This suggests that due to its maternal coinheritance with mitochondria, Wolbachia may have reduced mitochondrial diversity as a consequence of a positive fitness effect on D. daci. However, it has not been analysed whether the extent of intraspecific mitogenome diversity differs between D. daci and its fruit fly host species, yet this may provide further evidence that D. daci is the actual host of Wolbachia rather than the fruit flies. The hosts of D. daci include several dacine fruit fly species that are destructive pests of fruits and vegetables, for example Bactrocera tryoni (Queensland fruit fly, Australia’s most significant horticultural pest), its sibling species Bactrocera neohumeralis, Bactrocera frauenfeldi[50] and many other species that are not major pests such as Zeugodacus strigifinis which develops in flowers of Cucurbitaceae[51,52]. Several Dacini mitogenomes have previously been sequenced, including of B. tryoni[53], however, the mitogenomes of B. frauenfeldi, B. neohumeralis and Z. strigifinis have not yet been sequenced and characterised. In this study, we obtained six mitogenome variants of D. daci and nine mitogenome variants of four of its 22 tephritid host species, B. frauenfeldi, B. neohumeralis, B. tryoni and Z. strigifinis by WGS of DNA libraries obtained from parasitised individual hosts. We then compared the arrangement, nucleotide composition and codon usage of these mitogenomes together with the previously sequenced mitogenomes of four other strepsipterans, four species of closely related insect orders and the host fruit flies. As mitogenome rearrangements have previously been detected in other strepsipterans[18,42-44], we expected that the D. daci mitogenome would also differ from the ancestral mitogenome arrangement of insects and the fruit fly mitogenomes. Furthermore, we anticipated that D. daci mitogenomes contain more rearrangements compared to the mitogenomes of Mengenilla (with free-living adults) but share some of these differences with the mitogenomes of Xenos (with more extreme endoparasitic life cycles). Furthermore, we compared the intraspecific mitogenome diversity between D. daci and the fruit flies from which the D. daci mitogenomes were obtained. Due to the previously described association of D. daci with Wolbachia[47], we expected that intraspecific mitogenome diversity would be less in D. daci than the fruit fly species.

Results

Genome sequencing and assembly

Whole genome sequencing was performed on genomic extracts of nine individuals of four tephritid fruit fly species that were parasitised with Wolbachia-infected D. daci and were collected across a range of > 700 km in Australia (Table 1). Of these, six sequence libraries produced a good coverage (≥ 26.7-fold) of D. daci mitogenomes; three other sequence libraries contained D. daci mitogenomic sequences but not of sufficient coverage to assemble mitogenomes (Table 1). However, all nine sequence libraries included mitogenomes of the four fruit fly species. The D. daci and fruit fly mitogenomes were first filtered from the contig list of Bfra485 which had the highest read number. Its D. daci mitogenome comprised two contigs of approximately 12 kb and 3.2 kb while the fly mitogenome comprised one contig of approximately 15.9 kb. Then, iterative mapping using Bfra485 reads resulted in an almost complete D. daci mitogenome with a minimum estimated length of 16,255 bp and a complete circular B. frauenfeldi mitogenome of 15,935 bp (Fig. 1, Table S1). These two mitogenomes were used to filter the D. daci and fruit fly mitogenomes from the other sequence libraries. Dipterophagus daci mitogenomes were successfully assembled from six libraries (Bfra485, Bn171, Bn342, Bt194, Bt210 and Zst503). Albeit detectable, D. daci coverage in the three remaining libraries (Bn135, Bn240 and Bn244) was too low (< fivefold) for mitogenome assembly but was sufficient in Bn240 for the calling of single nucleotide polymorphisms (SNPs) at informative sites. The fruit fly mitogenomes were successfully assembled from all nine libraries (Bfra485, Bn135, Bn171, Bn240, Bn244, Bn342, Bt194, Bt210 and Zst503) (Table 1). The size of the mitogenomes ranged from 16,243 to 16,255 bp for D. daci, and from 15,858 to 15,935 bp for the fruit flies (Table S1).
Table 1

Summary of nine fruit fly WGS libraries obtained from individuals of four tephritid fruit fly species parasitised by Dipterophagus daci, collection localities, Wolbachia infection status (+ or −) with wDdac1 (ST-285) and wDdac2 (ST-289), number of reads after QC and coverage for the D. daci and fruit flies mitogenomes. Mitogenomes with high coverage are presented in bold, with coverage number in parentheses. All nine fruit fly samples contained D. daci as detected by sequence reads and PCR[47].

Tephritid speciesSample IDCollection localitywDdac1 (ST-285)wDdac2 (ST-289)Number of reads after QCD. daci mitogenome mapped reads (coverage)Fly mitogenome mapped reads (coverage)
Bactrocera frauenfeldi485Cairnsyy109,057,96015,938 (104.5)11,544 (72)
Bactrocera neohumeralis135Mourilyan Harbouryy68,308,7646 (0.04)86,7084 (5,427)
Bactrocera neohumeralis171Townsvilleyy77,482,3684094 (26.8)62,060 (387)
Bactrocera neohumeralis240Mourilyan Harbouryn72,186,748320 (2.1)36,332 (228)
Bactrocera neohumeralis244Cairnsny60,128,32452 (0.3)496,912 (3101)
Bactrocera neohumeralis342Mackayyy67,282,4744086 (26.7)47,976 (300)
Bactrocera tryoni194Cairnsyy79,574,3568104 (53.2)530,836 (3312)
Bactrocera tryoni210Mackayyy63,859,8826892 (45.2)18,486 (115.4)
Zeugodacus strigifinis503Cairnsyy65,468,73411,210 (73.5)579,200 (3646)
Figure 1

Structure of the mitogenomes of Dipterophagus daci and Bactrocera frauenfeldi obtained from a whole genome sequencing library of the genomic extract of the parasitised specimen B. frauenfeldi Bfra485. PCGs are denoted in yellow, rRNA genes in red, tRNA genes in purple and control region in green. The AT content (blue) and GC content (green) were plotted as the deviation from the average AT and GC content of the overall sequence using sliding window analysis. The mitogenome of D. daci has not been closed and contains one unusual single nucleotide frameshift deletion in the nad5 gene.

Summary of nine fruit fly WGS libraries obtained from individuals of four tephritid fruit fly species parasitised by Dipterophagus daci, collection localities, Wolbachia infection status (+ or −) with wDdac1 (ST-285) and wDdac2 (ST-289), number of reads after QC and coverage for the D. daci and fruit flies mitogenomes. Mitogenomes with high coverage are presented in bold, with coverage number in parentheses. All nine fruit fly samples contained D. daci as detected by sequence reads and PCR[47]. Structure of the mitogenomes of Dipterophagus daci and Bactrocera frauenfeldi obtained from a whole genome sequencing library of the genomic extract of the parasitised specimen B. frauenfeldi Bfra485. PCGs are denoted in yellow, rRNA genes in red, tRNA genes in purple and control region in green. The AT content (blue) and GC content (green) were plotted as the deviation from the average AT and GC content of the overall sequence using sliding window analysis. The mitogenome of D. daci has not been closed and contains one unusual single nucleotide frameshift deletion in the nad5 gene.

Mitogenome structure

The six D. daci and nine fruit fly mitogenomes each contained 13 PCGs, two rRNA genes and 22 tRNA genes (Table S2). In the D. daci and fruit fly mitogenomes, nine PCGs (nad2, cox1, cox2, atp8, atp6, cox3, nad3, nad6 and cob) and 14 tRNA genes (trnI, trnM, trnW, trnL, trnK, trnD, trnG, trnS, trnR, trnN, trnE, trnA, trnT and trnS) were located on the major strand (leading strand) while four PCGs (nad5, nad4, nad4L and nad1), eight tRNA genes (trnQ, trnC, trnY, trnF, trnH, trnP, trnL and trnV) and both rRNA genes (rrnL and rrnS) were located on the minor strand (lagging strand) (Fig. 1, Table S2). The AT-rich region of the fruit fly mitogenomes was located between rrnS and trnI and had an average length of 594 bp, while in D. daci the AT-rich region was located between trnV and trnS. Furthermore, the D. daci mitogenomes contained an unresolved sequence assembly gap between trnV and trnS resulting in variable lengths (Table S2).

Mitogenome base composition

The nucleotide composition of D. daci mitogenomes was AT-biased (approximately 84%) and this was similar to the mitogenomes of the other strepsipterans. The fruit fly mitogenomes were less AT-biased (approximately 72%) (Fig. 2, Table S1) and their AT contents were similar except for B. frauenfeldi 485 and Z. strigifinis 503, which had AT contents of 74.1% and 73.4% respectively (Fig. 2, Table S1). Comparative mitogenome analyses of D. daci and their fruit fly hosts revealed a clear bias in nucleotide composition with positive AT-skews and negative GC-skews (Table S1). This was also noted for X. vesparum while M. australiensis and Mengenilla moldryzki had a negative AT skew (Table S1). All the insect taxa had a negative GC skew (Table S1).
Figure 2

Comparative analysis of AT content of mitogenomes of Dipterophagus daci, its host fruit fly species and other reference species.

Comparative analysis of AT content of mitogenomes of Dipterophagus daci, its host fruit fly species and other reference species.

Mitochondrial protein coding genes

The total length of the 13 PCGs of the D. daci mitogenomes was on average 10,696 bp and was relatively shorter than the total length of the PCGs of the fruit fly mitogenomes with an average length of 11,187 bp (Table S1). The start codons ATT, ATA and ATG were used in both D. daci and fruit fly PCGs, except the fruit fly atp8 gene which started with GTG (Table S2). In D. daci PCGs nad1, nad2, nad3 and nad4L started with ATA, cox2, atp8, nad5 and nad6 with ATT, atp6, cox3, nad4 and cob with ATG, and cox1 with CAA (Table S2). Furthermore, the D. daci PCGs nad2, atp8, nad6, cox3, nad4L and nad1 ended with TAA, while it is assumed that the remaining PCGs that ended with T are completed by adding 3’ A nucleotides to the mRNA (Table S2). The fruit fly PCGs nad2, nad3, nad5 and nad6 started with ATT, cox2, atp6, cox3, nad4, nad4L and cob with ATG, atp8 with GTG, nad1 with ATA, and cox1 with TCG (Table S2). Seven fruit fly PCGs stopped with TAA, while nad3 and nad4 stopped with TAG; nad5, cob and nad1 that ended with T, (and cox1 ending with TA) are presumably completed by adding 3’ A nucleotides to the mRNA (Table S2). Comparative analyses of the relative synonymous codon usage (RSCU) revealed that across D. daci, the fruit fly and the other insect species, codons ending with A or T prevailed. Amino acids Ala, Gly, Leu, Pro, Arg, Ser, Thr and Val were commonly used, and Leu had the highest RSCU in all insect species (Table S3). Surprisingly, the nad5 gene contained an unusual deletion of one nucleotide (nucleotide position 291) in all six D. daci mitogenomes which introduced an in-frame stop codon (TAA) at amino acid position 98 (Fig. 3); the remainder of nad5 further downstream, however, still constituted an open reading frame but started from a different position. The unexpected finding of a single nucleotide -1 frameshift deletion was further verified by Sanger sequencing of the nad5 region of D. daci from five samples in addition to those used for WGS; these samples did not undergo REPLI-g amplification which was used for the WGS samples prior to library preparation (Table S4). All nad5 gene Sanger sequences were identical to the assembled mitogenomes and confirmed this nucleotide deletion. Subsequently, the domain architecture of the nad5 gene was checked using CDART (NCBI)[54]. This revealed that, similar to other nad5 genes, the second part of the D. daci nad5 gene downstream of the deletion contained the proton-conducting transporter domain starting at amino acid position ~ 100 in most full-length strepsipteran nad5 genes (Fig. 3), suggesting that this larger fragment of nad5 of D. daci could still encode for a functional yet truncated protein.
Figure 3

Amino acid (aa) alignment of the nad5 gene of Dipterophagus daci (Bfra485) and five strepsipteran species, Mengenilla australiensis, Mengenilla moldryzki, Eoxenos laboulbenei (Mengenillidae), Xenos vesparum and Xenos cf. moutoni (Xenidae), listed with their GenBank accession numbers. The red-highlighted star indicates stop codons, including a stop codon at position 98 in D. daci, with a new start codon (highlighted in blue) upstream of the mutation. Positions with > 0.5 conserved aa across sequences are highlighted in yellow when D. daci displays the conserved aa, or green when D. daci is different; the 5’ sequence of D. daci reads from an alternative open reading frame starting position than the 3’ sequence due to the deletion that inserts a stop codon.

Amino acid (aa) alignment of the nad5 gene of Dipterophagus daci (Bfra485) and five strepsipteran species, Mengenilla australiensis, Mengenilla moldryzki, Eoxenos laboulbenei (Mengenillidae), Xenos vesparum and Xenos cf. moutoni (Xenidae), listed with their GenBank accession numbers. The red-highlighted star indicates stop codons, including a stop codon at position 98 in D. daci, with a new start codon (highlighted in blue) upstream of the mutation. Positions with > 0.5 conserved aa across sequences are highlighted in yellow when D. daci displays the conserved aa, or green when D. daci is different; the 5’ sequence of D. daci reads from an alternative open reading frame starting position than the 3’ sequence due to the deletion that inserts a stop codon.

Mitochondrial tRNA and rRNA genes

The D. daci and fruit fly mitogenomes contained 22 tRNA genes (Fig. 1, Table S2). Their average total length was 1424 bp in D. daci and 1468 bp in fruit fly mitogenomes (Table S1). Both 16S rRNA and 12S rRNA genes (rrnL and rrnS respectively), had a total length of 2074 bp in the D. daci mitogenomes, while both combined ranged from 2081 to 2110 bp in the fruit fly mitogenomes (Table S1). Across the six D. daci mitogenomes, MITOS2 could only identify one part (688 bp 3’ section adjacent to the nad1 gene) of the 16S rRNA gene because the 5’ section flanked by trnV was highly diverged. However, the entire coding sequence was confirmed by sequence alignment with 16S rRNA genes of the reference strepsipteran mitogenomes obtained from GenBank and by BLASTn. In fruit fly mitogenomes the 16S rRNA gene was flanked by trnL and trnV and the 12S rRNA gene was flanked by trnV and the AT-rich region (Fig. 1, Table S2).

Mitochondrial gene arrangement

Significant gene rearrangements were observed in the D. daci mitogenomes relative to the ancestral insect mitogenome, while the gene arrangement of the fruit fly mitogenomes were identical to the ancestral insect mitogenome pattern (Fig. 4A,B). Gene rearrangements in the D. daci mitogenomes were observed in two regions: the first region involved the transposition of trnA, trnS and trnF; and the second region involved the transposition of trnS, trnL and rrnS (Fig. 4A), resulting in a different rRNA gene order when compared to all other mitogenomes.
Figure 4

Organisation and rearrangement of the Dipterophagus daci mitogenome (A) compared to the ancestral holometabolan pattern; tRNA genes are blue, rRNA genes are yellow, protein coding genes are white and the control region is grey. The major (leading) strand is denoted by > and arrows denote gene translocations; (B) compared to ten other insect species (including four strepsipteran species and the host species Bactrocera frauenfeldi and Bactrocera tryoni); conserved gene arrangement (salmon colour) and different gene arrangements (white) in D. daci and the other species; the control region is grey. Mitogenome representation is not drawn to scale; * indicates species for which only incomplete mitogenomes are available.

Organisation and rearrangement of the Dipterophagus daci mitogenome (A) compared to the ancestral holometabolan pattern; tRNA genes are blue, rRNA genes are yellow, protein coding genes are white and the control region is grey. The major (leading) strand is denoted by > and arrows denote gene translocations; (B) compared to ten other insect species (including four strepsipteran species and the host species Bactrocera frauenfeldi and Bactrocera tryoni); conserved gene arrangement (salmon colour) and different gene arrangements (white) in D. daci and the other species; the control region is grey. Mitogenome representation is not drawn to scale; * indicates species for which only incomplete mitogenomes are available. The D. daci mitogenome arrangement was also compared with the mitogenomes of the four other strepsipteran species, one representative species each of four closely related insect orders (Coleoptera, Megaloptera, Neuroptera, Rhaphidioptera), B. frauenfeldi 485 and a reference B. tryoni (GenBank accession NC014611) (Fig. 4B). Generally, most genes in the D. daci mitogenome had a conserved gene arrangement position (Fig. 4B). However, comparisons revealed that D. daci contained more mitogenome rearrangements (6 transpositions) compared to Xenos cf. moutoni, X. vesparum, M. moldryzki and M. australiensis that contained 4, 3, 2 and 1 transpositions, respectively (Fig. 5). The transposition of trnS observed in D. daci was also observed in the four strepsipteran species, and the transposition of trnA and trnL was also found in X. cf. moutoni and X. vesparum (Fig. 5). The transposition of trnF, trnS and rrnS were unique to D. daci, while the transposition of trnM (from I-Q-M in ancestral arrangement to M-I-Q) was unique to X. cf. moutoni and not seen in D. daci (Fig. 5). Mitogenomes of the fruit flies as well as the three representative species of Coleoptera, Megaloptera and Rhaphidioptera were arranged according to the ancestral insect mitogenome pattern while Dendroleon pantherinus (Neuroptera) exhibited a C-W-Y (W–C-Y in ancestral) gene arrangement (Fig. 4B).
Figure 5

Mitogenome organisation and rearrangement illustrating gene translocations and number of transpositions in Dipterophagus daci and four strepsipteran species relative to the ancestral pattern in insect mitogenomes; tRNA genes are blue, rRNA genes are yellow, protein coding genes are white and the control region is grey. The major (leading) strand is denoted by > , arrows denote gene translocations and * indicate species for which only incomplete mitogenomes are available. Mitogenome representation is not drawn to scale.

Mitogenome organisation and rearrangement illustrating gene translocations and number of transpositions in Dipterophagus daci and four strepsipteran species relative to the ancestral pattern in insect mitogenomes; tRNA genes are blue, rRNA genes are yellow, protein coding genes are white and the control region is grey. The major (leading) strand is denoted by > , arrows denote gene translocations and * indicate species for which only incomplete mitogenomes are available. Mitogenome representation is not drawn to scale.

Intraspecific mitogenome variation

We performed multiple sequence alignments to investigate the intraspecific diversity across the six D. daci mitogenome variants from six sequence libraries, and also obtained informative SNP data from an additional library (Bn240) that had low D. daci mitogenome coverage but was sufficient for SNP calling of sites variable between the six mitogenomes. We identified a total of ten SNPs occurring in four mitochondrial PCGs, including cox1, nad5, nad4 and cob (Table 2) and a total of 34 SNPs occurring in the D. daci mitogenome variants (Table S5). To contrast intraspecific mitogenome variation, we investigated the diversity of the 13 PCGs of the assembled six D. daci, five B. neohumeralis and two B. tryoni mitogenome variants obtained in this study and the reference B. tryoni mitogenome variant. Despite the relatively low mitogenome sample number, intraspecific nucleotide diversities were substantially lower in the PCGs of the D. daci mitogenome variants than in the PCGs of the fruit fly mitogenome variants (Table 3). In contrast to the ten SNPs in the mitochondrial PCGs of D. daci, the mitochondrial PCGs of B. neohumeralis and B. tryoni had 298 and 133 SNPs, respectively, showing that the PCGs of the B. neohumeralis and B. tryoni mitogenomes were 33.1 × and 14.7 × more diverse than the D. daci mitogenome (Table 3).
Table 2

Single nucleotide polymorphisms (SNPs) in protein coding genes of Dipterophagus daci mitogenomes, showing the collection locality, Wolbachia infection status (+ or −) with wDdac1 (ST-285) and wDdac2 (ST-289) and the SNP position in the mitogenome; * denotes the assembled reference mitogenome of D. daci from Bactrocera frauenfeldi Bfra485 (MW233588) and ^ denotes the library with low coverage that did not allow assembly of the mitogenome; empty cells indicate that the positions have the same nucleotide as the assembled reference genome.

Collection localitywDdac1wDdac2Genecox1nad5nad4cob
Nucleotide position in the mitogenome1762254664086607691273067869864010,27611,033
CairnsyyDipterophagus daci_Bfra485*CAGGTCTGAA
TownsvilleyyDipterophagus daci_Bn171TCCACG
Mourilyan HarbourynDipterophagus daci_Bn240^GCAC
MackayyyDipterophagus daci_Bn342A
CairnsyyDipterophagus daci_Bt194A
MackayyyDipterophagus daci_Bt210G
CairnsyyDipterophagus daci_Zst503A
Table 3

Nucleotide diversity of the mitochondrial PCGs of Dipterophagus daci (n = 6), Bactrocera neohumeralis (n = 5) and Bactrocera tryoni (n = 3), showing the number of single nucleotide polymorphisms (SNPs). The 5’ part of the D. daci nad5 gene with the stop codon is listed separately as nad5_5’.

GeneDipterophagus daci (n = 6) PCGsBactrocera neohumeralis (n = 5) PCGsBactrocera tryoni (n = 3) PCGs
Total number of nucleotidesSNPsTotal number of nucleotidesSNPsTotal number of nucleotidesSNPs
atp66420678166788
atp8150016251621
cob11112113523113513
cox115072153542153512
cox26520690186908
cox37680789177899
nad19420940249409
nad29270102322102310
nad33430354103545
nad412632134145134222
nad4L264029172971
nad513504172055172026
nad5_5’2910nananana
nad64860525145259
Total PCG10,6961011,18329811,190133
Single nucleotide polymorphisms (SNPs) in protein coding genes of Dipterophagus daci mitogenomes, showing the collection locality, Wolbachia infection status (+ or −) with wDdac1 (ST-285) and wDdac2 (ST-289) and the SNP position in the mitogenome; * denotes the assembled reference mitogenome of D. daci from Bactrocera frauenfeldi Bfra485 (MW233588) and ^ denotes the library with low coverage that did not allow assembly of the mitogenome; empty cells indicate that the positions have the same nucleotide as the assembled reference genome. Nucleotide diversity of the mitochondrial PCGs of Dipterophagus daci (n = 6), Bactrocera neohumeralis (n = 5) and Bactrocera tryoni (n = 3), showing the number of single nucleotide polymorphisms (SNPs). The 5’ part of the D. daci nad5 gene with the stop codon is listed separately as nad5_5’.

Discussion

We have analysed the mitogenome of D. daci as the first sequenced mitogenome of Halictophagidae, the largest strepsipteran family, together with the mitogenomes of four of its 22 tephritid fruit fly host species, B. frauenfeldi, B. neohumeralis, B. tryoni and Z. strigifinis. We obtained these sequences from fly individuals with concealed D. daci parasitisation. Mitogenome analyses revealed extensive mitogenome rearrangements in D. daci relative to the inferred ancestral holometaboloan mitogenome arrangement and the fruit fly mitogenomes. Furthermore, in comparison to the other strepsipteran mitogenomes, D. daci has, with six gene transpositions, the most re-arranged strepsipteran mitogenome characterised so far. While it shared some of the mitogenome rearrangements with other Strepsiptera, D. daci contained additional and unique mitogenome differences. These included a single nucleotide -1 frameshift deletion in the coding region of the nad5 gene possibly requiring translational frameshifting[16,17], other unknown compensation mechanisms, or, alternatively, leads to a significant truncation of the gene product. Another unusual feature was a different order of the rRNA genes because of the transposition of the rrnS gene. Our findings also revealed that D. daci mitogenomes have shorter PCGs than mitogenomes of other insects which is typical for strepsipterans[18,43]. Despite the low sample number but whole-mitogenomic representation and similar sampling effort for D. daci and fruit fly species across a geographic range of > 700 km, covering a large part of known D. daci distribution[45], we observed substantially (15-33x) lower genetic diversity in the D. daci mitochondrial PCGs relative to their host fruit fly species, suggesting that Wolbachia may be the cause for the loss of mitogenome diversity in D. daci. Insect mitogenomes have a fairly conserved gene order, however, gene rearrangements occur in several insect taxa[55]. In the current study, we found extensive gene rearrangements in D. daci mitogenomes relative to the ancestral holometabolan mitogenome pattern. Mitochondrial gene rearrangements are usually characterised by either transposition, inversion or inverse transposition[56], and more frequently involve tRNA genes than PCGs and rRNA genes[57]. In D. daci, rearrangements involved six gene transpositions (five tRNA genes and one rRNA gene). These were more mitogenomic transpositions in D. daci than in any other strepsipterans further suggesting that the D. daci lineage has experienced accelerated structural mitogenome rearrangements. The transpositions of trnF, trnS and rrnS were unique to D. daci, however, the transpositions of trnA and trnL were also observed in X. cf. moutoni and X. vesparum, while the transposition of trnS was common to the five strepsipteran species. We also found that nad5 of D. daci had one single nucleotide -1 frameshift deletion that resulted in the introduction of a stop codon at amino acid position 98. However, the downstream part of the gene still had an open reading frame but starting with another nucleotide position. This could be indicative that D. daci experiences translational frameshifting, similar to the translational editing mechanism proposed to overcome the issues of single nucleotide insertion and deletions found in PCGs of some animal mitogenomes[58]. Previously, single nucleotide insertions have been observed in cob of ants[16] and nad3 of some bird and turtle species[17]. It is noteworthy that our finding is, to our knowledge, the first example of -1 frameshift deletion found in an invertebrate mitogenome. So far single nucleotide deletions in mitochondrial PCGs have only been found in a few turtle species[58], and, overall, -1 frameshift deletions appear to be rarer than +1 frameshift insertions[59]. Alternatively, the single nucleotide deletion in nad5 of D. daci could result in the expression of a truncated but still functional nad5 gene product because it still contained the proton-conducting transporter domain similar to nad5 genes in other species[60], however, this scenario may be less likely because it would constitute a substantial truncation. Yet another scenario could be compensation of the frame shift mutation by an unknown mechanism other than translational frameshifting, via the D. daci nuclear genome, Wolbachia or the fruit fly mitochondrial or nuclear genomes. There are several examples of intracellular endosymbionts with degraded gene functions that are compensated by other endosymbionts[61] or their hosts[62]. It has previously been hypothesised that mitogenome rearrangements arose with the evolution of parasitic life cycles. This is because a transition to a parasitic life cycle in a lineage may come in hand with a relaxation of selective constraints acting on mitogenomes and their functions[40]. Based on our findings we can now add single nucleotide frameshift mutations that may also arise in lineages that have evolved parasitic life cycles. There is evidence for the association between mitogenome changes and evolution of parasitic life cycles, because mitogenomes of parasitic lineages of Hymenoptera are highly rearranged when compared to the conserved mitogenome arrangement patterns in the more basal lineages of Hymenoptera which are not parasitic[31]. Mitogenome rearrangements were also reported for the two egg parasitoids, Trichogramma japonicum and Trichogramma ostriniae[55] as well as a parasitoid of Drosophila larvae, Leptopilina boulardi[63]. Similarly, rearrangements have been observed in three parasitoid wasp species of the genus Psyttalia which parasitise Bactrocera oleae[64]. Furthermore, the numbers of mitogenome rearrangements in Strepsiptera correlated with the transition from moderate to extreme levels of parasitism. More gene rearrangements were observed in the mitogenomes of the Stylopidia species D. daci, X. cf. moutoni and X. vesparum compared to the Mengenillidia species M. australiensis and M. moldryzki. The largest number of differences when compared to the ancestral insect mitogenome arrangement were observed in D. daci, and the single nucleotide frameshift deletion in nad5 and the transposition of rrnS were unique, and possibly associated with the more extreme endoparasitism displayed by D. daci and its different host utilisation (i.e. Diptera). Rearrangements involving ribosomal RNA genes have been found in other insects, such as thrips[65]. It is unclear how the nad5 frameshift deletion could have occurred, but its effect may not be as severe in an endoparasitic insect[36]. Flight muscles rely heavily on mitochondrial function[66,67], and an insect with limited flight function may be able to cope with a less efficient mitochondrial function. The overall length of the D. daci and fruit fly mitogenomes were within the expected length of 15–18 kb[3]. Both D. daci and the fruit fly mitogenomes contained the 37 genes and the AT-rich region usually found in animal mitogenomes[1,2]. The conserved location for AT-rich region is between rrnS and trnI, however in the D. daci mitogenome the AT-rich region is located between trnV and trnS, which is similar to its position in a gnat bug, Stenopirates sp.[68], while it is located in the conserved location in M. moldrzyki[42] and X. cf. moutoni; however, incomplete information is available for X. cf. moutoni[44]. The D. daci mitogenome assembly contained a gap in this region and hence the full length of the AT-rich region could not be estimated. Attempts to close the mitogenome by iterative mapping with short reads proved impossible. This region could either be too long and repetitive to be closed with bioinformatics approaches, or have secondary folding structures resulting in sequencing difficulties, as also found for M. australiensis, X. cf. moutoni and X. vesparum[18,43,44]. Our study revealed that the mitochondrial PCGs of D. daci are shorter relative to the PCGs of their host fruit flies, and this could be associated with the evolution of the strepsipteran life cycle, as also suggested for M. australiensis, X. cf. moutoni and X. vesparum[18,43,44]. Similar to other parasitic insects[3,55], the nucleotide composition of the D. daci mitogenomes were more AT-biased compared to fruit fly mitogenomes. The high AT bias observed in D. daci was found to be similar to the other Strepsiptera[18,43,44]. Furthermore, the D. daci mitogenome had a positive AT skew and a negative GC skew indicating that its genes contain more A than T, and more C than G, as also reported for other insects[69]. Low intraspecific mitogenome diversity is generally attributed to founder events[70,71], or can be due to Wolbachia endosymbionts which manipulate host reproduction or provide a fitness benefit to hosts[9,12]. Maternal coinheritance of mitogenomes and Wolbachia may facilitate Wolbachia-driven selective sweeps of the infected mitochondrial haplotype resulting in low mitochondrial genetic diversity[10-12,72]. In comparison to B. neohumeralis and B. tryoni, D. daci mitogenomes had only ten SNPs in PCGs and were 15–33 × less diverse. Previously, it has been demonstrated that D. daci hosts two Wolbachia strains, wDdac1 and wDdac2; these two strains lack genes required for host reproductive manipulations, and therefore may have beneficial effects on host fitness[47]. Our extensive mitogenome analysis of D. daci together with the previous analysis of its nuclear 18S rRNA gene filtered from the WGS libraries provides strong evidence that the low diversity observed in the D. daci mitogenome could be due to a past Wolbachia invasion with hitchhiking mitogenome types. In addition, the detection of high prevalence of Wolbachia in D. daci[47] also suggests that Wolbachia confers a fitness benefit to D. daci. It is unknown, however, whether both strains invaded this host at once, or in two separate waves. Further characterisation of D. daci genetic diversity and the D. daci-Wolbachia relationship across larger population samples will be required to further investigate Wolbachia effects on mitogenome diversity patterns and host fitness in this species.

Methods

Insect specimens and WGS

This study analysed WGS libraries of nine males of four tephritid fruit fly species (B. frauenfeldi, B. neohumeralis, B. tryoni and Z. strigifinis) representing field populations across a region from Mackay to Cairns (> 700 km distance) in Queensland, Australia (Table 1). These specimens formed part of a previous survey of Wolbachia in 24 Australian tephritid fruit fly species and were collected using traps with male attractants as previously described[48,49]. DNA was extracted from fly abdomens and tested for Wolbachia using Wolbachia surface protein (wsp) and 16S rRNA gene primers; furthermore, two strains of Wolbachia-positive flies were characterised using multi-locus sequence typing (MLST) as ST-285 and ST-289[48,49] (Table 1), with later assignment of these strains to their actual host D. daci as wDdac1 and wDdac2[47]. DNA extracts of 14 Wolbachia-positive flies were selected and amplified by multiple displacement using the REPLI-g mini kit (Qiagen) previously used to amplify DNA of mitochondrial and bacterial chromosomes at higher coverage than eukaryotic chromosomes[11] and submitted for library construction and WGS using the Illumina Hiseq2500 platform as previously described[47]. Nine of these 14 WGS libraries produced sufficient mitogenome coverage and were used for analyses in the current study (Table 1). The remaining five WGS libraries were of low quality and excluded from the analyses. Furthermore, all nine samples were PCR positive for Wolbachia and D. daci[47] (Table 1).

Genome assembly

Sequence quality control and de novo assembly were performed in CLC Genomics Workbench as previously described[47]. Sequence identification and extraction was achieved by querying the reference genomes against the WGS library contig lists. First, BLASTn using the M. australiensis partial mitogenome (GenBank GU188852) was performed to filter the D. daci mitogenome from the contig list of Bactrocera frauenfeldi Bfra485 (Table 1). Contigs with the best hit were concatenated and manually gap-filled by iterative mapping of the trimmed reads at 90% similarity and 60–80% read length. The final D. daci draft mitogenome consensus sequence of this library was verified by mapping reads at 99% similarity. The final D. daci mitogenome extracted from the Bfra485 contig list was then used as a reference for the identification and filtration of D. daci mitogenomes from the other five libraries (Table 1). Similarly, BLASTn using the Ceratitis capitata mitogenome (GenBank AJ242872) was performed to identify and extract the fruit fly mitogenomes from the libraries, and the contigs with the best hit in each library were then assembled by iterative mapping as described earlier. The extracted D. daci and fruit fly mitogenomes were manually aligned and inspected in Geneious v10.0.9[73].

PCR amplification and Sanger sequencing of nad5

The D. daci mitogenome assembly revealed an unusual deletion of one nucleotide in nad5. This genomic dataset was obtained from WGS libraries which underwent REPLI-g amplification prior to library preparation[11]. To verify that this mutation was not due to a rare amplification error, PCR primers were designed to specifically amplify nad5 of D. daci to confirm the WGS results, using Primer-BLAST (NCBI); Dd_nad5F: 5’ GAAACTGGAGTTGGAGCAGC 3’ and Dd_nad5R: 5’ ATAGCGTGTGATAAGTTAAATCGTT 3’ with an expected amplicon size of 396 bp. MyTaq™ Mix (Bioline) PCR reagents were used according to the manufacturer’s instructions. PCR cycling conditions began with an initial denaturation for 3 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 50 °C and 1 min at 72 °C, then a final elongation step of 7 min at 72 °C. Five additional D. daci samples (Table S4) were PCR amplified and visualised by capillary electrophoresis on a QIAxcel system using a QIAxcel DNA screening kit (Qiagen). Prior to sequencing, PCR amplicons were treated with ExoSAP [exonuclease I (New England Biolabs, Ipswich, MA, USA) and shrimp alkaline phosphatase (Promega)] and incubated at 37 °C for 30 min, then 95 °C for 5 min. Sanger sequencing was performed using BigDye Terminator v3.1 kit (Applied Biosystems) and run on an Applied Biosystems 3500 Genetic Analyser.

Mitogenome annotation and analysis

Annotation of the D. daci and fruit fly mitogenomes was performed using MITOS2 with “RefSeq 63 Metazoa” provided by MITOS2 and the invertebrate genetic code[74], followed by manual verification of the coding regions and comparison with published mitochondrial sequences in Geneious v10.0.9 and NCBI BLASTn. The tRNA genes predicted by MITOS2 were confirmed using tRNAscan-SE[75] and ARWEN[76]. The circular mitogenomes were visualised in Geneious v10.0.9. Comparative analyses of the composition skewness of the mitogenomes were calculated using the formulae: AT skew = [A − T]/[A + T] and GC skew = [G − C]/[G + C]. Comparative analysis of the mitogenomes codon usage was computed in MEGA7[77].

Comparative mitogenomics

Comparative analyses were performed using the six D. daci and nine fruit fly mitogenomes from this study, the mitogenomes of four other strepsipterans [M. australiensis (GU188852.1), M. moldryzki (JQ398619.1), X. vesparum (DQ364229.1) and X. cf. moutoni (MW222190)] and a representative member of other orders closely related to Strepsiptera including Coleoptera [Tribolium castaneum (AJ3124132)], Neuroptera [D. pantherinus (MK3012461)], Megaloptera [Neochauliodes fraternus (NC_0252821)], Raphidioptera [Mongoloraphidia harmandi (NC_0132511)] and Diptera [B. tryoni (NC_014611)].

Intraspecific mitogenome diversity analyses

To determine the intraspecific genetic diversity across the D. daci mitogenome variants, we performed multiple sequence alignments of the six D. daci (Bfra485, Bn171, Bn342, Bt194, Bt210 and Zst503) mitogenome variants and used D. daci sequence information from the Bn240 library with a low mitogenome coverage which was insufficient for assembly but sufficient for SNP calling. Additionally, to compare the intraspecific genetic diversity in D. daci and the fruit fly host species, we performed individual multiple sequence alignments of 13 PCGs of the six assembled D. daci, five B. neohumeralis and three B. tryoni mitogenome variants (including B. tryoni NC_014611 obtained from GenBank). The multiple sequence alignments and DNA diversity analyses were performed using Geneious v10.0.9[73] with default settings. Supplementary Information.
  70 in total

1.  Dynamics of cytoplasmic incompatibility and mtDNA variation in natural Drosophila simulans populations.

Authors:  M Turelli; A A Hoffmann; S W McKechnie
Journal:  Genetics       Date:  1992-11       Impact factor: 4.562

2.  A hotspot of gene order rearrangement by tandem duplication and random loss in the vertebrate mitochondrial genome.

Authors:  Diego San Mauro; David J Gower; Rafael Zardoya; Mark Wilkinson
Journal:  Mol Biol Evol       Date:  2005-09-21       Impact factor: 16.240

Review 3.  Host-parasitoid associations in Strepsiptera.

Authors:  Jeyaraney Kathirithamby
Journal:  Annu Rev Entomol       Date:  2009       Impact factor: 19.686

4.  Deducing the pattern of arthropod phylogeny from mitochondrial DNA rearrangements.

Authors:  J L Boore; T M Collins; D Stanton; L L Daehler; W M Brown
Journal:  Nature       Date:  1995-07-13       Impact factor: 49.962

5.  The first molecular phylogeny of Strepsiptera (Insecta) reveals an early burst of molecular evolution correlated with the transition to endoparasitism.

Authors:  Dino P McMahon; Alexander Hayward; Jeyaraney Kathirithamby
Journal:  PLoS One       Date:  2011-06-28       Impact factor: 3.240

Review 6.  Structure, function and evolution of insect flight muscle.

Authors:  Hiroyuki Iwamoto
Journal:  Biophysics (Nagoya-shi)       Date:  2011-02-17

7.  Evolution of host support for two ancient bacterial symbionts with differentially degraded genomes in a leafhopper host.

Authors:  Meng Mao; Xiushuai Yang; Gordon M Bennett
Journal:  Proc Natl Acad Sci U S A       Date:  2018-11-21       Impact factor: 11.205

8.  Single-copy nuclear genes resolve the phylogeny of the holometabolous insects.

Authors:  Brian M Wiegmann; Michelle D Trautwein; Jung-Wook Kim; Brian K Cassel; Matthew A Bertone; Shaun L Winterton; David K Yeates
Journal:  BMC Biol       Date:  2009-06-24       Impact factor: 7.431

9.  The hitchhiker's guide to Europe: the infection dynamics of an ongoing Wolbachia invasion and mitochondrial selective sweep in Rhagoletis cerasi.

Authors:  Hannes Schuler; Kirsten Köppler; Sabine Daxböck-Horvath; Bilal Rasool; Susanne Krumböck; Dietmar Schwarz; Thomas S Hoffmeister; Birgit C Schlick-Steiner; Florian M Steiner; Arndt Telschow; Christian Stauffer; Wolfgang Arthofer; Markus Riegler
Journal:  Mol Ecol       Date:  2016-03-15       Impact factor: 6.185

10.  Extensive gene rearrangements in the mitochondrial genomes of two egg parasitoids, Trichogramma japonicum and Trichogramma ostriniae (Hymenoptera: Chalcidoidea: Trichogrammatidae).

Authors:  Long Chen; Peng-Yan Chen; Xiao-Feng Xue; Hai-Qing Hua; Yuan-Xi Li; Fan Zhang; Shu-Jun Wei
Journal:  Sci Rep       Date:  2018-05-04       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.