Literature DB >> 35005025

Interfering with pak4 Protein Expression Affects Osteosarcoma Cell Proliferation and Migration.

Yuxin Fu1, Lun Fang1, Qipu Yin1, Qi Wu2, Wei Sui1, Ying Sun1, Xindi Zhao1, Yadi Wu1,3, Lu Zhou1,3.   

Abstract

PURPOSE: A number of studies have discovered various roles of PAK4 in human tumors, including osteosarcoma. However, the exact role of PAK4 in osteosarcoma and its mechanism have yet to be determined. Therefore, this study focused on interrogating the PAK4 effect on the proliferation and migration ability of osteosarcoma and its underlying mechanisms.
MATERIALS AND METHODS: Western blot and QRT-PCR were utilized to quantify the PAK4 relative protein and mRNA levels. To measure cellular viability and mobility, the MTT and wound-healing assays were preferred.
RESULTS: With the adenovirus-mediated overexpression of PAK4, the proliferation and migration of U2-OS and MG-63 osteosarcoma cells were stimulated. Furthermore, a liposome-mediated knockout of PAK4 will inhibit osteosarcoma cells from proliferating. In terms of mechanism, we observed the positive correlation of PAK4 expression with expression of P21, CyclinD1, CyclinE1, CDK2, and CDK6, which drives G0/G1 to the G2/M phase transition. PAK4 can also activate Erk expression in OS cells and induce EMT.
CONCLUSION: Interfering with PAK4 protein expression has been shown to affect osteosarcoma proliferation and migration.
Copyright © 2021 Yuxin Fu et al.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 35005025      PMCID: PMC8739922          DOI: 10.1155/2021/9977001

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Osteosarcoma (OS), a primary malignant bone tumor, is characterized by triangular stromal cells originating from primitive intercellular cells and producing osteoid tissue [1]. It is most commonly seen in the adolescent metaphysis of the long bones of the extremities [2]. Owing to its high malignancy, rapid development, and poor prognosis, it accounts for a significant proportion of cancer-related deaths in young adults and children. Amputation was the only treatment option for osteosarcoma patients in the 1970s, with less than 20% of a 5-year survival rate. The advancement of chemotherapy has significantly increased the life expectancy of osteosarcoma patients and makes it possible to preserve them, with a 5-year survival rate of 70% [3]. Despite chemotherapy, 30 to 40% of patients experienced metastasis or tumor recurrence. Osteosarcoma has a high risk of lung metastasis, and patients suffering from lung metastasis showed poor prognosis, with a 20% of 5-year survival rate [4]. The lack of knowledge about the precise mechanisms of proliferation, metastasis, and apoptosis in osteosarcoma has hampered treatment development, resulting in a leveling of overall survival in osteosarcoma patients over the past few decades. Therefore, the discovery of new biomarkers linked to progression, and prognosis may improve the treatment and prognosis for patients with osteosarcoma. The p-21-activated kinases (PAKs), which are members of the serine/threonine protein kinase family, are thought to be important downstream effector molecules of Rac1, Cdc42, and the key small Rho GTPase proteins. They are made up of six members who are divided into two groups based on homology sequence: group I (PAK1-3) and group II (PAK4-6) [5]. PAK4 is a group II cancer-related factor that is found in subcellular domains of the cytoplasm and nucleus. Overexpression of PAK4 can be found in a wide range of tumors, including pancreatic cancer [6], gastric carcinoma [7], and ovarian cancer [8]. It can inhibit apoptosis of tumor cells, promote cell survival, cause uncontrolled growth, trigger cell morphology to lose its regulatory function, inhibit cell adhesion, and promote cell migration and tumor formation. In addition, it is capable of regulating the independent growth of the cells by relying on independent kinase activity to stimulate the growth, invasion, and metastasis of tumor cells [9]. These outcomes discovered that PAK4 may serve a critical part in the occurrence and progression of osteosarcoma tumors. A recent study has found that inhibition of PAK4 can limit human osteosarcoma cell proliferation, invasion, and migration, but the specific regulatory mechanism, especially on cell proliferation ability, is still not clear [10]. Therefore, PAK4's function in controlling OS proliferation, invasion, and metastasis, as well as its basic mechanism, requires further investigation. This study focuses on the examination of the expression and function of PAK4 in OS. The data indicate that PAK4 overexpression promotes osteosarcoma cell proliferation and migration. Moreover, mechanistic studies reveal that PAK4 induces epithelial-mesenchymal transition (EMT) by activating the Erk level in osteosarcoma cells. Therefore, these results provide evidence for a functional role in OS and suggest that it may be a new therapeutic target for the disease.

2. Materials and Methods

2.1. Cell Culture

In this analysis, the human osteosarcoma cell line U2-OS and MG-63 and human osteoblast cell line (hFOB) were used and purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and were plated in 6-well plates at a density of 1.5 × 106 cells/well in Dulbecco's Modified Eagle Medium (DMEM; Gibco; Lot. 8121218). These cells were grown at 37°C under a humidified 5% CO2 atmosphere, supplemented with 10% fetal bovine serum (FBS; Biological Industries; Lot. 2033119), 10 units/ml penicillin, and 10 μg/ml streptomycin (Sigma-Aldrich, St. Louis, MO, USA).

2.2. Cell Transfection

For the PAK4 silencing experiment, transfection of osteosarcoma cells was performed by using small interference (si) RNA. PAK4-siRNA was purchased from GenePharma. Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used, according to the provided manual, for transient transfection at 37°C for 6 h using a final concentration of siRNA of 5 nM. For the PAK4 overexpression experiment, osteosarcoma cells were transfected for 12 h at 37°C with 1 × 109 particle forming units of PAK4 adenovirus, which was purchased from Vigene Biosciences. As a control, the ad-GFP was purchased from Abcam. To improve transfection quality, U2-OS and MG-63 cells were incubated in DMEM medium without antibiotics for 24 h before transfection.

2.3. MTT Assay

The viability of the cells was determined by using the MTT assay. In 96-well plates, cells were plated at a density of 1 × 104 cells per well in 10% FBS and antibiotics supplemented DMEM medium. Incorporation of MTT solution (Biotopped) in plates was made at a concentration of 0.5 mg/ml for 3 h at 37°C. After removing the medium, the prepared formazan crystals were dissolved in 100 μl dimethyl sulfoxide. At 570 nm, the absorbance was detected with a spectrophotometer.

2.4. EdU-488 Cell Proliferation Assay

Cell proliferation was detected with BeyoClickEdU-488 Cell Proliferation Assay Kit (Beyotime Biotechnology, C0071S). Cells at a density of 5000 cells/ml were seeded into 24-well plates. After 24 h of cell culture, an equal volume of 20 μmol/l EdU working solution was added to each well to continue incubation for 2 h. Then, 4% tissue cell fixative was fixed at room temperature for 20 min, and PBS permeabilizing solution containing 0.3% TritonX-100 was incubated at room temperature for 15 min. 500 μl click reaction solution per well, prepared according to the instructions, was incubated at room temperature for 30 min in the dark for click reaction. Hoechst 33342 solution was incubated at room temperature in the dark for 10 min. Ultimately, staining results were observed under a fluorescence microscope.

2.5. Wound Healing Assay

In the logarithmic growth phase, osteosarcoma cells were digested with trypsin (0.25%), and a density of 5 × 105 cells/well was seeded into the 6-well plate and cultured at 37°C overnight in the presence of 5% CO2. The next day, the scratching was performed with a 200 μl pipette tip followed by thrice washing with PBS to remove suspension cells before being applied to a serum-free medium. The migration of cells (each group) was detected using a microscope after 24 hours of incubation at 37°C in a 5% CO2 incubator. With one optical microscope, pictures were obtained at 0 and 24 h, separately.

2.6. Digital Holographic Microscopy

The Holomonitor™ M4 microscope (Phase Holographic Imaging AB, Lund, Sweden) was used for tracking and imaging the movement of U2-OS and MG-63 cells. There are various good advantages for this technique, such as quantitative and long-term cytokinetic analysis avoiding any marking. Moreover, to achieve parameter stability, we switched on the microscope component of the HoloMonitor M4 system and left it overnight in a CO2 incubator. A total of 24 hours of observations were taken and separated by 10 minutes. Following a period of 24 h, the M4 Studio tracking software version 2.6.2 was applied to analyze the data.

2.7. Cell Cycle Analysis

Cell (1‐5 × 105) were incubated in 6-well plates for 48 h with ad-PAK4 (100 MOI), ad-GFP (100MOI), or PAK4 siRNA and control siRNA. Cells were trypsinized and collected, then performed PBS washing thrice and fixed overnight in ethanol (70%) at 4°C, and then, performed three times washing in PBS with 0.1% BSA. Incubation of cells was performed at 4°C for 90 minutes with 50 mg/ml PI and 5 mg/ml RNase A (DNase free). A FAC Star flow cytometer was used to observe the fractions of cells in various cell cycle stages.

2.8. Western Blot

In the lysis buffer, the cells were placed for 30 min and centrifuged for 30 min at 4°C at 13,200 x g. The resulting supernatant was kept at -80°C till use. Determination for the concentration of protein was performed to use the BCA (Vazyme). The lysate separation was performed with 10% SDS-PAGe followed by electroblotting to PVDF membranes (Millipore, Billerica, MA, USA) for 1 h at 100 volts. After being locked with 5% skim milk, the resulting blot was then probed with primary antibodies for PAK4 (1 : 2000; cat.no. ab19007; Abcam.), CDK2 (1 : 2000; cat.no.2546; Cell Signaling Technology, Inc.), CDK6 (1 : 2000; cat.no.3136; Cell Signaling Technology, Inc.), Cyclin D1 (1 : 2000; cat.no.GB11079; Servicebio), Cyclin E1 (1 : 2000; cat.no.GB13305; Servicebio), P21 (1 : 2000; cat.no. ab86696; Abcam.), Erk (1 : 2000; cat.no. ab54230; Abcam.), E-Cadherin (1 : 2000; cat.no.14472; Cell Signaling Technology, Inc.), and N-Cadherin (1 : 2000; cat.no.14215; Cell Signaling Technology, Inc.).

2.9. RNA Isolation and the Real-Time RT-PCR Analysis

The TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used for the total RNA extraction from the cells. The random primer (hexamer) included in the first-strand cDNA synthesis kit (Takara, Shiga, Japan) was used to generate first-strand cDNA. Primer Express software was used to design specific primers for each gene (Takara, Shiga, Japan). The ABI Prism 7900Ht Sequence Detection system (Applied Biosystems) was used to perform the PCR reaction. Specific primers for each gene (Table 1) were designed using Primer Express software (Applied Biosystems). All experiments were carried out in triplicate.
Table 1

Sequences and accession numbers for forward (FOR) and reverse (REV) primers for the QRT-PCR.

GeneSequences for primersAccession no.
P21FOR: TGCAACTACTACAGAAACTGCTGNM_181617
REV: CAAAGTGGTCGGTAGCCACA
CyclinD1FOR: GCTGCGAAGTGGAAACCATCNM_053056
REV: CCTCCTTCTGCACACATTTGAA
CyclinE1FOR: AAGGAGCGGGACACCATGANM_001238
REV: ACGGTCACGTTTGCCTTCC
CDK6FOR: GCTGACCAGCAGTACGAATGNM_001145306
REV: GCACACATCAAACAACCTGACC
CDK2FOR: TGTTTAACGACTTTGGACCGCNM_005851
REV: CCATCTCCTCTATGACTGACAGC
ErkFOR: CGGGGCATCTTCGAGATCGNM_001030312
REV: CAGAACAACGCCGTTTCAGTT
E-cadherinFOR: CGAGAGCTACACGTTCACGGNM_004360
REV: GGGTGTCGAGGGAAAAATAGG
N-cadherinFOR: TTTGATGGAGGTCTCCTAACACCNM_004061
REV: ACGTTTAACACGTTGGAAATGTG

2.10. Statistical Analysis

The data was statistically analyzed using the Duncan's test and ANOVA. Differences with a P value < 0.05 were considered statistically significant.

3. Results

3.1. PAK4 Was Overexpressed in OS Cell Lines, and the Expression Level of PAK4 Affects the Survival Rate of Osteosarcoma Patients

For ensuring the expression of PAK4 in OS, we detected the expression of PAK4 in OS cell lines; as Figure 1(a) shows, PAK4 was lower in OS cell lines U2-OS and MG-63 than in osteoblastic cell hFOB. And to examine the PAK4 impact on the occurrence and development of osteosarcoma and osteoblast, we analyzed the online database of OS high-throughput gene chip data through the Kaplan-Meier (http://kmplot.com/analysis/) and found significantly lower overall survival of patients in the PAK4 mRNA high transcript level group compared with the PAK4 low level group (Figure 1(b)). These findings suggested that PAK4 dysregulation could be a predictor of OS prognosis.
Figure 1

The Kaplan-Meier online database was used to study the relationship between differential expression of PAK4 and survival rate.

3.2. PAK4 Induces Cell Proliferation in Human Osteosarcoma Cells

After 48 h transfection of the ad-PAK4 or the PAK4 siRNA, we analyzed the cellular proliferation of U2-OS and MG-63 cells. The results of MTT analysis suggested that the Ad-PAK4 overexpression increased the proliferation. Meanwhile, the PAK4 siRNA reduced the cellular proliferation in the human osteosarcoma (Figure 2(a)). The results of EdU-488 staining showed that a large amount of green fluorescence was observed in the proliferating cells. The number of proliferating cells increased significantly in the Ad-PAK4 group compared with the NC group, while decreased in the Si-PAK4 group (Figure 2(b)). These findings demonstrated that PAK4 affected cell proliferation.
Figure 2

Effect of PAK4 on OS cell lines proliferation. (a) Cell viability was analyzed with MTT. (b) Detection of EdU-488 staining of PAK4 on proliferation of osteosarcoma cells. EdU-labeled proliferating cell nucleus fluoresce green and overlap with Hoechst 33342-stained blue nucleus. (c) Influence of PAK4 on cell cycle of osteosarcoma cells U2-OS by flow cytometry. Compared with the control group, ∗P < 0.05.

3.3. PAK4 Promotes Osteosarcoma Cell Migration and Metastasis

Wound healing was carried out to investigate the migration speed of OS cells following ad-PAK4 and si-PAK4. As illustrated in Figure 3(a), cell migration was increased remarkably in PAK4 adenovirus cells as compared to the NC group. Furthermore, digital holographic microscopy has produced consistent images of cell mobility. According to single-cell tracking analysis, the distance of migration and the motility of the ad-PAK4 group markedly increased than that of the control group (Figure 3(b)). Moreover, the assay results were congruent between U2-OS and MG-63 cell lines. Collectively, overexpression of PAK4 facilitates OS migration and metastasis.
Figure 3

Effect of PAK4 on OS cell lines migration. (a) Migration ability was determined by applying a wound healing assay. (b) Each color represented the migration trajectory of different groups of cells. (a) Comprehensive comparison of migration distances of several different groups. (b–f) The migration distance of each group of cells was analyzed by holography microscopy.

3.4. PAK4 Induces the Transition of the G0/G1 to the G2/M Phase in Human Osteosarcoma Cells

Following a 48-hour transfection with PAK4 adenovirus or siRNA, FACS analysis was used to determine cell cycle distribution after PAK4 overexpression (Figure 2(c)). CDK6 has been shown to induce cell transformation from G0/G1 to G2/M, promoting cell proliferation and facilitating tumorigenesis. In the U2-OS cell line, a lower proportion of cells was observed in the G1 phase in the ad-PAK4 group than that of the control group. At the same time, the cellular proportion in the G2 phase and S phase in the experimental group also decreased to different degrees, indicating that PAK4 can induce the cell cycle progression of human osteosarcoma. To find out PAK4's effect on cell cycle transition, we observed the increased expression of CyclinD1, CyclinE1, and cyclin-dependent kinases (CDKs) CDK2 and CDK6 in PAK4 overexpression of OS cell line (Figure 4(a)). Meanwhile, the number of cells expressing the cell cycle inhibitor, p21, was reduced. However, ad-GFP was transfected with adenovirus, while si-CON was transfected with the plasmid, so the results of these two groups were different. Such observations suggested that PAK4 may exert a critical role in the U2-OS cell cycle transition of the G0/G1 to the G2/M phase.
Figure 4

Interference effect of PAK4 on OS cell proliferation. P21, Cyclin D1, Cyclin E1, CDK2, and CDK6 protein levels detected in osteosarcoma cells with NC, ad-GFP, ad-PAK4, si-CON, and si-PAK4 treatment, respectively. (b) The expression of PAK4 is closely related to the relative gene about the cell cycle in human osteosarcoma cell lines. The relative expression of the target protein was measured with the expression of GAPDH. ∗P < 0.05 as compared to the NC group.

3.5. Real-Time RT-PCR Analysis of Oncogenes

To explore the molecular mechanism through which PAK4 activated the proliferation of U2-OS cells, we studied the interaction of PAK4 with oncogenes on proliferation using RT-PCR. The RNA was isolated from PAK4 adenovirus or siRNA transfected cell. According to the result of Western blotting, the levels of expression of several related genes were investigated. P21 RNA levels were found to be inversely related to PAK4 expression. The RT-PCR data demonstrated that the RNA level of cyclin D1, CyclinE1, CDK2, and CDK6 were increased (Figure 4(b)). These results specify that the PAK4 overexpression may promote osteosarcoma proliferation through driving G0/G1 to the G2/M phase transition via regulation of expression level of cyclinD1, cyclinE1, CDK2, CDK6, and P21.

3.6. Erk/EMT Is Involved in PAK4-Medicated Migration of Osteosarcoma Cells

To determine whether PAK4 promotes osteosarcoma cell migration by regulating Erk levels, Western blotting was used to identify variations in the protein expression that are involved in the Erk/EMT signaling pathway. The results showed that in the PAK4-adenoviral group, expression of Erk and N-Cadherin was upregulated, while E-cadherin expression was downregulated. Meanwhile, it was further verified that PAK4-silenced resulted in Erk and N-Cadherin downregulation and E–Cadherin upregulation (Figure 5). These data suggest that PAK4 overexpression stimulates the migration of osteosarcoma cells by stimulating the EMT signaling pathway via regulation of Erk levels.
Figure 5

PAK4 promotes the cell migration of osteosarcoma by regulating the Erk protein expression to induce EMT. The expression level of Erk, N-Cadherin, and E-Cadherin was detected by using Western blot (a) and qRT-PCR (b). GAPDH expression was utilized to study the relative expression of the target protein. ∗P < 0.05 versus the normal control group.

4. Discussion

In the current study, we focused on whether PAK4 plays a role in the growth and metastasis of OS. We demonstrated the increased level of PAK4 in osteosarcoma cell lines. Unrestricted cell replication and invasive metastasis are two critical steps during tumor development. And our study found that the expression level of PAK4 was increased in osteosarcoma cell lines, and silencing PAK4 inhibited the proliferation and migration of osteosarcoma cells. Previous researches have shown that PAK4 has important biological effects on tumor growth and migration, and it has become one of the hotspots in tumor biological signal transduction research [11-13]. Our results indicate that several proteins related to cell cycle, CDK2, CDK6, CyclinD1, and CyclinE1 expression levels were shown to be increased after PAK4 overexpression treatment, while the expression level of p21 was decreased. But the results were completely opposite after silencing PAK4. Nekrasova and Minden reported that PAK4-null fibroblasts arrested in G1 phase, which was associated with increased expression of p21 and decreased expression of cyclinD1, respectively [14]. As everyone knows, cell proliferation is a complex and ordered process that is rigorously regulated by a number of factors, including cyclin, cyclin-dependent protein kinase (CDK), and cyclin-dependent kinase inhibitor (CKI) [15]. The normal cell cycle requires balance and precise coordination between cyclin, a positive regulator of CDK, and CKI, a negative regulator. When this balance is upset, it leads to uncontrolled cell proliferation and, eventually, carcinogenesis. CyclinD1 and CyclinE1 exert a key role in the G1 phase regulation and G1/S phase transition [16]. CDK2 and CDK6 are important CDK family members, and activated CDK can promote the cell cycle to enter the S phase through the restriction point of G1/S, which controls the replication of DNA and centrosome, and can also promote the occurrence of mitosis during the G2/M transition [17]. Nevertheless, p21 has the potential to inhibit the activity of cyclin complex and proliferating cell nuclear antigen. Abnormal p21 (either decreased or disappeared expression) lost the normal regulation of the activity of cyclin-CDK complex, which leads to misreplication of cellular DNA, cellular dissimilation or carcinogenesis, and cell cycle arrest [18]. Meanwhile, EdU-488 staining visually reflected the effect of PAK4 on osteosarcoma cell proliferation. Moreover, the results of flow cytometry also revealed that PAK4 could push osteosarcoma cell cycle transition and promote cell proliferation. In addition, it has been confirmed that the proliferation of lung adenocarcinoma cells is restricted and the cell cycle is arrested in G1 phase after PAK4 inhibition [19]. Our study also found that PAK4 could promote the EMT process, and expressed ERK in osteosarcoma cell lines in vitro. PAK4 overexpression increased the expression level of N-Cadherin and decreased the expression level of E-Cadherin. Upregulation of N-Cadherin and downregulation of E-Cadherin induce EMT, loss of cell polarity, improve their migration ability, and significantly enhance their affinity to other stromal tissues, thereby metastasizing and spreading malignant cells [20]. Moreover, PAK4 can specifically bind and phosphorylate the EMT transcription factor Slug, which mediates PAK4-induced EMT and prostate cancer invasion [21]. In addition, Erk is a key factor in the induction of EMT. The elevated level of Erk was observed in various cancer types, including osteosarcoma. MicroRNA-765 targeting MTUS1 has been reported to promote proliferation, migration, and invasion of osteosarcoma by mediating the ERK/EMT pathway [22]. Tan et al. also reported that type I collagen plays a crucial role in the morphology, proliferation, and invasiveness of U2-OS cells and the ERK signaling pathway in collagen-treated cells, while it can also induce the EMT process in U2-OS cells [23]. According to studies on the signaling pathways involved in the EMT process, we found that PAK4 silencing downregulated Erk expression and synchronously inhibited EMT, which attenuated cell invasion and metastasis.

5. Conclusion

The following conclusions can be drawn from the current study. PAK4 overexpression in OS cells can promote tumor proliferation, invasion, and metastasis. Additionally, it can promote the proliferation of osteosarcoma by inhibiting the expression of P21 and upregulate the level of Cyclin D1, CyclinE1, CDK2, and CDK6, which drives G0/G1 to the G2/M phase transition. By activating the Erk signaling pathway, PAK4 can trigger EMT in OS cells, which promotes tumor migration and invasion. Taken together, our findings provide an experimental basis for targeting PAK4 as a possible osteosarcoma therapeutic target. It is suggested that this point investigated in future studies.
  23 in total

Review 1.  Cell "circadian" cycle: new role for mammalian core clock genes.

Authors:  Laurence Borgs; Pierre Beukelaers; Renaud Vandenbosch; Shibeshih Belachew; Laurent Nguyen; Brigitte Malgrange
Journal:  Cell Cycle       Date:  2009-03-16       Impact factor: 4.534

Review 2.  P21 activated kinase signaling in cancer.

Authors:  Chetan K Rane; Audrey Minden
Journal:  Semin Cancer Biol       Date:  2018-01-09       Impact factor: 15.707

3.  PAK4 is required for regulation of the cell-cycle regulatory protein p21, and for control of cell-cycle progression.

Authors:  Tanya Nekrasova; Audrey Minden
Journal:  J Cell Biochem       Date:  2011-07       Impact factor: 4.429

4.  Exosome-mediated RNAi of PAK4 prolongs survival of pancreatic cancer mouse model after loco-regional treatment.

Authors:  Lizhou Xu; Farid N Faruqu; Yau M Lim; Kee Y Lim; Revadee Liam-Or; Adam A Walters; Paul Lavender; David Fear; Claire M Wells; Julie Tzu-Wen Wang; Khuloud T Al-Jamal
Journal:  Biomaterials       Date:  2020-09-10       Impact factor: 12.479

5.  Therapeutically actionable PAK4 is amplified, overexpressed, and involved in bladder cancer progression.

Authors:  Darshan S Chandrashekar; Balabhadrapatruni V S K Chakravarthi; Alyncia D Robinson; Joshua C Anderson; Sumit Agarwal; Sai Akshaya Hodigere Balasubramanya; Marie-Lisa Eich; Akhilesh Kumar Bajpai; Sravanthi Davuluri; Maya S Guru; Arjun S Guru; Gurudatta Naik; Deborah L Della Manna; Kshitish K Acharya; Shannon Carskadon; Upender Manne; David K Crossman; James E Ferguson; William E Grizzle; Nallasivam Palanisamy; Christopher D Willey; Michael R Crowley; George J Netto; Eddy S Yang; Sooryanarayana Varambally; Guru Sonpavde
Journal:  Oncogene       Date:  2020-03-30       Impact factor: 9.867

6.  PAK4 suppresses PDZ-RhoGEF activity to drive invadopodia maturation in melanoma cells.

Authors:  Nicole S Nicholas; Aikaterini Pipili; Michaela S Lesjak; Simon M Ameer-Beg; Jenny L C Geh; Ciaran Healy; Alistair D MacKenzie Ross; Maddy Parsons; Frank O Nestle; Katie E Lacy; Claire M Wells
Journal:  Oncotarget       Date:  2016-10-25

7.  LINC01224 Exhibits Cancer-Promoting Activity in Epithelial Ovarian Cancer Through microRNA-485-5p-Mediated PAK4 Upregulation.

Authors:  Shujian Xing; Yaqi Zhang; Jing Zhang
Journal:  Onco Targets Ther       Date:  2020-06-16       Impact factor: 4.147

Review 8.  Structural insights into the functional diversity of the CDK-cyclin family.

Authors:  Daniel J Wood; Jane A Endicott
Journal:  Open Biol       Date:  2018-09       Impact factor: 6.411

9.  The important tumor suppressor role of PER1 in regulating the cyclin-CDK-CKI network in SCC15 human oral squamous cell carcinoma cells.

Authors:  Xiao-Juan Fu; Han-Xue Li; Kai Yang; Dan Chen; Hong Tang
Journal:  Onco Targets Ther       Date:  2016-04-15       Impact factor: 4.147

Review 10.  Cell apoptosis, autophagy and necroptosis in osteosarcoma treatment.

Authors:  Jing Li; Zuozhang Yang; Yi Li; Junfeng Xia; Dongqi Li; Huiling Li; Mingyan Ren; Yedan Liao; Shunling Yu; Yanjin Chen; Yihao Yang; Ya Zhang
Journal:  Oncotarget       Date:  2016-07-12
View more
  3 in total

Review 1.  Astragalus polysaccharide: a review of its immunomodulatory effect.

Authors:  Chun-Xiao Li; Ying Liu; Yu-Zhen Zhang; Jing-Chun Li; Jiang Lai
Journal:  Arch Pharm Res       Date:  2022-06-17       Impact factor: 4.946

Review 2.  The significance of PAK4 in signaling and clinicopathology: A review.

Authors:  Xinbo Yu; Changwei Huang; Jiyuan Liu; Xinyu Shi; Xiaodong Li
Journal:  Open Life Sci       Date:  2022-06-20       Impact factor: 1.311

Review 3.  Recent advances on development of p21-activated kinase 4 inhibitors as anti-tumor agents.

Authors:  Yang Li; Qing Lu; Chenghu Xie; Yiming Yu; Ao Zhang
Journal:  Front Pharmacol       Date:  2022-08-29       Impact factor: 5.988

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.