Literature DB >> 31728150

PAK4, a target of miR-9-5p, promotes cell proliferation and inhibits apoptosis in colorectal cancer.

Meihua Wang1, Qianqian Gao1, Yufang Chen1, Ziyan Li1, Lingping Yue1, Yun Cao1.   

Abstract

BACKGROUND: Colorectal cancer (CRC) is a leading cause of cancer-related death worldwide. P21-activated kinase 4 (PAK4) and miR-9-5p have emerged as attractive therapeutic targets in several tumor types, but in CRC, the regulation of their biological function and their target association remain unclear.
METHODS: The expression of PAK4 in CRC tissues was determined using quantitative real-time PCR and immunohistochemistry analyses. The targeted regulation between miR-9-5p and PAK4 was predicted and confirmed with bioinformatics analysis and the dual-luciferase reporter assay. Functional experiments, including the MTT assay and flow cytometry, were performed to investigate the impact of PAK4 knockdown and miR-9-5p overexpression on cell proliferation and apoptosis in CRC cells.
RESULTS: We found that the expression of PAK4 was upregulated in CRC tissues. PAK4 knockdown significantly suppressed cell proliferation and promoted apoptosis in cells of the CRC cell lines HCT116 and SW1116. We also found that miR-9-5p directly targeted the 3'-UTR of PAK4 mRNA and negatively regulated its expression. The degree of downregulation of miR-9-5p inversely correlated with PAK4 expression. Intriguingly, enforced expression of miR-9-5p suppressed cell proliferation and promoted apoptosis. This could be partially reversed by PAK4 overexpression.
CONCLUSION: These results suggest that miR-9-5p targeting of PAK4 could have therapeutic potential for CRC treatment.
© The Author(s) 2019.

Entities:  

Keywords:  Apoptosis; Colorectal cancer; PAK4; Proliferation; miR-9-5p

Mesh:

Substances:

Year:  2019        PMID: 31728150      PMCID: PMC6842216          DOI: 10.1186/s11658-019-0182-9

Source DB:  PubMed          Journal:  Cell Mol Biol Lett        ISSN: 1425-8153            Impact factor:   5.787


Background

Colorectal cancer (CRC) is thought to be the fourth leading cause of cancer-related death. For example, over 135,000 CRC cases and over 50,000 deaths were recorded in the United States in 2017 [1]. The prevalence of CRC varies depending on sex and age, with women and elderly people at the highest risk [1, 2]. There has been great progress in CRC treatment with surgical resection, adjuvant chemotherapy and radiation interventions. However, the prognosis and relapse rate remain unsatisfactory [3]. Molecular biology studies have revealed that the initiation and progression of CRC are complex processes involving altered genetic and epigenetic events [4]. It is essential that the research community better elucidates the mechanisms underlying the aggressive pathophysiology of this disease. P21-activated kinase 4 (PAK4) is a member of the PAK family of serine/threonine kinases. It was originally identified as an effector molecule for the Rho-type GTPase Cdc42 [5]. PAK4 has been implicated in the morphogenesis of the actin cytoskeleton, filopodia, and extraembryonic tissues and vessels [6, 7]. The PAK family can be divided into two groups, A (PAK1, − 2 and − 3) and B (PAK4, − 5 and − 6), based on domain structures and regulatory properties [8]. All six mammalian PAK members have a highly conserved C-terminal kinase domain and an N-ternimal GTPase-binding domain [9]. In recent years, cumulative evidence supports a critical role for abnormal PAK4 expression in oncogenesis [10]. Amplification or activation of PAK4 has been detected in numerous cancers, including pancreatic [11], breast [12] and ovarian cancers [13]. In multiple cancer types, cells overexpressing PAK4 show increased proliferation, migration invasion and/or survival, which contribute to transformation, tumor formation and metastasis [10, 13]. Interestingly, PAK4 has been recently used to promote CRC cell growth, migration and invasion. For example, Tabusa et al. showed that in CRC cells with a KRAS mutation, knockdown of PAK4 induces a decrease in cell proliferation via pathways that are independent of RAF/MEK/ERK and PI3K/AKT signaling [14]. The tumor suppressive miR-145 exerts an anti-tumor effect in human CRC cells by targeting PAK4 [15, 16]. MicroRNAs (miRNAs), which are small noncoding RNAs of ~ 22 nt in length, have emerged as critical post-transcriptional and epigenetic modulators of gene expression in eukaryotes [17]. They have been shown to mediate translational repression and target mRNAs for degradation, predominantly by binding to the 3′-untranslated regions (3′-UTRs) in a sequence-specific manner [18]. PAK4 has been reported to be target regulated by miR-433 in hepatocellular carcinoma [19], miR-224 in gastric cancer [20], miR-485 in glioblastoma [21], miR-199a-3p in gastric cancer [22] and hepatocellular carcinoma [23], and miR-663 in clear cell renal cell carcinoma [24]. In recent years, miR-9-5p has been shown to function as a tumor suppressor in several tumors, including pancreatic cancer [25] and gastric cancer [26], but as an oncogene in prostate cancer [27]. In our previous investigation, we found that PAK4 is a potential target gene of miR-9-5p. The function of miR-9-5p in CRC remains unknown. We speculated that miR-9-5p might target PAK4 to regulate cell proliferation and apoptosis in CRC cells. To validate our hypothesis, we determined the expression of PAK4 and miR-9-5p in CRC tissues and adjacent normal tissues. In vitro experiments were used to investigate whether miR-9-5p regulated cell proliferation and apoptosis by targeting PAK4 in CRC cell lines (HCT116 and SW1116). This is the first report to show that the powerful interaction between miR-9-5p and PAK4 plays an important role in CRC growth and survival. These results will no doubt enrich the state of knowledge on CRC pathogenesis.

Materials and methods

Clinical samples and cell culture

Fresh CRC tissue and matched adjacent normal tissue samples were collected from 32 CRC patients (age range from 32 to 76 years) who were undergoing surgery. The samples were immediately snap-frozen in liquid nitrogen and stored at − 80 °C for RNA extraction. None of the patients had received chemotherapy or radiotherapy prior to surgery. All signed a written informed consent form. In addition, 20 paraffin-embedded CRC specimens were collected at the Changzhou Tumor Hospital Affiliated to Soochow University. These were used for evaluation of PAK4 expression. This study was approved by the Ethical Committee of Changzhou Tumor Hospital Affiliated to Soochow University (approval number: C3A02143; 2016.6.13). The human CRC cell lines HCT116 and SW1116 were purchased from the American Type Culture Collection (ATCC). HCT116 and SW1116 cells were respectively cultured in RIMI 1640 and Dulbecco’s modified Eagle medium (DMEM; Hyclone), both with 10% fetal bovine serum (FBS) in a humidified atmosphere containing 5% CO2 at 37 °C.

Quantitative real-time PCR

For PAK4 detection, total RNA was extracted from tissues and cultured cells using Trizol solution (TaKaRa) and reverse transcribed into cDNA with a M-MLV Reverse Transcriptase kit (TaKaRa) according to the manufacturer’s instructions. For miR-9-5p quantification, miRNA was isolated with a mirVana kit (Life Technologies). Total RNA was then reverse transcribed using a Superscript II kit (Invitrogen). The expressions of miR-9-5p and PAK4 were determined using a TaqMan microRNA assay kit and SYBR Green Real-time PCR Master Mix (Applied Biosystems) on an ABI Prism 7700 system (Applied Biosystems). The relative expression levels of miR-9-5p and PAK4 were determined using the 2−ΔΔCt method with small nuclear RNA U6 and GAPDH as the respective internal references. Samples were analyzed in triplicate and each sample was analyzed at least three times. The primer sequences used are shown in Additional file 1: Table S1.

Immunohistochemistry analysis

The paraffin-embedded sections were sliced into 5-μm thick sections and used for immunohistochemistry (IHC) staining, as previously described [28]. Briefly, the 5-μm thick sections were deparaffinized in xylene and rehydrated in gradient ethanol, followed by antigen retrieval with heated citrate buffer. Then, the tissue sections were blocked with 3% (v/v) hydrogen peroxide for 10 min and incubated with anti-PAK4 antibody (1:500, ab227197; Abcam) at 4 °C overnight. After incubation with a HRP-conjugated secondary antibody for 30 min, the IHC staining results were photographed using an Olympus camera and independently evaluated by two experienced pathologists. Finally, the immunoreactivity scores were calculated by adding the scores for the staining percentage (0, 0–5%; 1, 6–20%; 2, 21–60%; 3, 61–75%; or 4, 76–100%) and staining intensity (0, no staining; 1, low intensity; 2, moderate intensity; 3, high intensity). Tissue sections with an immunoreactivity score of 0–2 were considered to be weakly immunoreactive (−+), 3–4 were moderately immunoreactive (+) and higher than 4 were strongly immunoreactive (++).

Oligonucleotides and transfection

To stably knock down PAK4 in CRC cells, HCT116 or SW1116 cells were transfected with two different small interfering RNAs targeting PAK4 (si-PAK4–1: 5′-GACAACTATGAGATCTCGAGA-3′ and si-PAK4–2: 5′-AAGAGGCGAGATAACTCGAGT-3′) and a negative control siRNA (si-NC: 5′-UAACGUGUCUCCGUCACGUTT-3′). The siRNAs were synthesized by Shanghai GenePharma at a final concentration of 50 nM. For miR-9-5p overexpression, miR-9-5p mimics and miR-NC were chemically synthesized by RiboBio and subsequently transfected into HCT116 or SW1116 cells. In the rescue experiments, the sequence for human PAK4 (AGTATGTAAGCAAACTCGAGTTTGCTTACATACTC) was amplified via PCR and cloned into the pcDNA3.1 vector to give pcDNA3.1-PAK4. In the miR-9-5p mimics + PAK4 group, pcDNA3.1-PAK4 was transfected into miR-9-5p overexpressing HCT116 or SW1116 cells. All cell transfections were performed for 48 h using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions.

Western blot

Total protein was extracted from cultured cells or tissue samples using RIPA lysis buffer and the protein concentration was determined using a BCA Protein Assay kit (Pierce Biotechnology). Equal amounts of protein were separated via 10% SDS-PAGE and then transferred to polyvinylidene fluoride membranes (GE Healthcare). The membrane was blocked with Tris-buffered saline containing 0.1% Tween-20 (TBST) with 5% non-fat milk at room temperature. It was then incubated with primary antibodies against PAK4 (1:1000, ab227197; Abcam) and GAPDH (1:5000, 10,494–1-AP; Proteintech) overnight at 4 °C, followed by incubation with horseradish peroxidase-conjugated secondary antibody (1:5000, SC-2054; Santa Cruz Biotechnology). The bands of target protein were visualized using an enhanced chemiluminescence reagent (Bio-Rad Laboratories) and quantified using Image-pro plus 6.0 Software.

MTT assay

Cell proliferation was determined using the MTT assay in CRC cells. Approximately 3 × 103 transfected cells per well were seeded in 96-well plates and cultured for five consecutive days at 37 °C. At 1, 2, 3, 4 and 5 day, 20 μl of 5 mg/ml MTT (Sigma Aldrich) was added into each well and the cells were incubated for 2 h. Then 150 μl dimethyl sulfoxide (Sigma) was added to each well to solubilize the crystals, followed by absorbance detection at a wavelength of 595 nm using a microplate reader (Bio-Rad).

Flow cytometry assay

Cell apoptosis was assessed using the Annexin V-FITC Apoptosis Detection Kit according to the manufacturer’s protocol. Briefly, the transfected cells were harvested via trypsinization and washed with cold PBS. Next, the cells were resuspended in 500 μl of binding buffer supplemented with 5 μl each of Annexin V-FITC and propidium iodide (PI; BD Biosciences) for 30 min at room temperature in the dark. The stained cells were analyzed for early apoptosis (Annexin V+/PI-) and late apoptosis (Annexin V+/PI+) via flow cytometry (FACScan; BD Biosciences).

Target prediction and luciferase reporter assay

TargetScan 7.1 (http://www.targetscan.org/) and PicTar (http://pictar.mdc-berlin.de/) were used for the bioinformatic analysis to predict the potential miRNAs that target PAK4. For the luciferase reporter assay, the miR-9-5p binding sequence of the PAK4 3′-UTR fragment was mutated using the Gene Tailor Site-Directed Mutagenesis System according to the manufacturer’s instructions. The wild-type (WT) and mutant (MUT) 3′-UTR of PAK4 were inserted into the psiCHECK-2 luciferase reporter plasmid (Promega Corporation). Subsequently, WT and MUT constructs were transfected into HCT116 and SW1116 cells, together with miR-9-5p mimics or miR-NC using Lipofectamine 2000. Forty-eight hours after transfection, the relative luciferase activities were measured using the dual-luciferase reporter assay system (Promega Corporation).

Statistical analysis

All data were analyzed using GraphPad Prism 6.0 software and expressed as the means ± SD of at least three experiments. The relationship between the miR-9-5p and PAK4 mRNA levels was determined using Spearman’s correlation analysis. A paired t-test was used for the analysis of paired samples while an unpaired t-test was used for the analysis of distinct samples. The two-tailed Student’s t-test was used to determine the difference between two independent groups. One-way analysis of variance followed by Tukey’s post-hoc test was performed to determine the differences for more than two groups. The p < 0.05 was considered to be statistically significant.

Results

PAK4 expression is elevated in CRC tissues

To confirm our hypothesis that PAK4 might be an oncogene in CRC, total RNA from 32 pairs of fresh CRC tissue and matched adjacent normal tissues was reverse transcribed and analyzed using quantitative real-time PCR. PAK4 was found to be significantly upregulated in CRC tissues compared with adjacent tissues (Fig. 1a; p < 0.001). IHC analysis was performed to confirm the expression of PAK4 in CRC tissues. Figure 1b shows representative photomicrographs of the different degrees of PAK4 expression intensity observed in the cytoplasm. PAK4 protein was detected in 85% (17/20) of the CRC-derived tissue samples and in 20% (4/20) of the non-cancerous colorectal mucosa, which indicates that the PAK4 expression in the CRC-derived tissue is higher than that in the normal colorectal mucosa.
Fig. 1

The expression of PAK4 mRNA and protein in CRC tissues. a The expression of PAK4 mRNA was determined using quantitative real-time PCR in 32 pairs of CRC tissues and adjacent non-cancerous tissues. ***p < 0.001; b Representative immunohistochemical staining of PAK4 in CRC tissues and non-cancerous colorectal mucosa (−+, weak staining, + moderate staining, ++ strong staining)

The expression of PAK4 mRNA and protein in CRC tissues. a The expression of PAK4 mRNA was determined using quantitative real-time PCR in 32 pairs of CRC tissues and adjacent non-cancerous tissues. ***p < 0.001; b Representative immunohistochemical staining of PAK4 in CRC tissues and non-cancerous colorectal mucosa (−+, weak staining, + moderate staining, ++ strong staining)

PAK4 knockdown inhibits cell proliferation and promotes apoptosis in CRC cells

Using western blot analysis, the protein levels of PAK4 were examined in HCT116 and SW1116 cells after transfection with two different siRNAs. The results show that both si-PAK4–1 and si-PAK4–2 transfection downregulated the expression of PAK4 protein in HCT116 (Fig. 2a) and SW1116 cells (Fig. 2b). The si-PAK4–2 was selected for the subsequent in vitro experiments because it seemed more effective at silencing PAK4 expression than si-PAK4–1.
Fig. 2

Effects of PAK4 knockdown on cell proliferation and apoptosis in CRC cells. a and b Western blot analysis was performed to detect PAK4 protein expression in HCT116 and SW1116 cells after transfection with si-NC, si-PAK4–1 or si-PAK4–2 for 48 h. c and d The MTT assay was used to evaluate cell proliferation ability in HCT116 and SW1116 cells on consecutive 5 days. e and f Flow cytometry was performed to determine cell apoptosis in HCT116 and SW1116 cells. All data are expressed as the means ± SD. **p < 0.01, ***p < 0.001, compared with the si-NC group

Effects of PAK4 knockdown on cell proliferation and apoptosis in CRC cells. a and b Western blot analysis was performed to detect PAK4 protein expression in HCT116 and SW1116 cells after transfection with si-NC, si-PAK4–1 or si-PAK4–2 for 48 h. c and d The MTT assay was used to evaluate cell proliferation ability in HCT116 and SW1116 cells on consecutive 5 days. e and f Flow cytometry was performed to determine cell apoptosis in HCT116 and SW1116 cells. All data are expressed as the means ± SD. **p < 0.01, ***p < 0.001, compared with the si-NC group The MTT assay was performed to determine cell proliferation. The results show that PAK4 knockdown by si-PAK4–2 significantly suppresses cell proliferation in HCT116 (Fig. 2c, p < 0.001) and SW1116 cells (Fig. 2d, p < 0.01, p < 0.001). Flow cytometry analysis was performed to verify whether PAK4 silencing caused cell apoptosis. PAK4 knockdown significantly promoted cell early apoptosis from 2.4 ± 0.1 to 13.8 ± 0.4% and late apoptosis from 1.9 ± 0.1 to 22.8 ± 0.4% in HCT116 cells (Fig. 2e; p < 0.001). Similarly, the early apoptotic and late apoptotic percentages of cells in the si-PAK4–2 group were remarkably elevated compared with those for the si-NC group in SW1116 cells (Fig. 2f, p < 0.001).

PAK4 is a direct target of miR-9-5p

The miRNAs that affect the expression of PAK4 were predicted using TargetScan 7.1 and PicTar. They included miR-9-5p, which has been reported to be a tumor suppressor in several types of cancer where PAK4 is known to be significant. Thus, it was chosen for further investigation. The 3′-UTR of PAK4 mRNA contains the predicted binding sites for miR-9-5p. The mutated miR-9-5p binding sequence of the PAK4 3′-UTR fragment is shown in Fig. 3a. To determine whether miR-9-5p directly targets PAK4, the luciferase reporter assay was conducted on CRC cells. The results show that luciferase activity was significantly suppressed in HCT116 (Fig. 3b; p < 0.01) and SW1116 cells (Fig. 3c; p < 0.01) co-transfected with miR-9-5p mimics and the WT PAK4 3′-UTR luciferase reporter plasmid, indicating that PAK4 is a direct target of miR-9-5p. Furthermore, miR-9-5p mimic transfection significantly downregulated PAK4 mRNA expression (Fig. 3d; p < 0.01) and PAK4 protein expression in HCT116 and SW1116 cells (Fig. 3e). These findings suggest that miR-9-5p could negatively regulate the expression of PAK4 in CRC cells.
Fig. 3

PAK4 was a target gene of miR-9-5p in CRC cells. a The potential binding sites of miR-9-5p and PAK4 mRNA, as well as the sequences in potential binding sites of mutant-type plasmid. b and c Dual luciferase reporter assays were performed in HCT116 and SW1116 cells with vectors including the putative miR-9-5p target sites in the 3′-UTR of PAK4 mRNA (wild-type) and mutant. Data were normalized against Renilla or firefly luciferase activity. d Quantitative real-time PCR was used to determine the mRNA levels of PAK4 in HCT116 and SW1116 cells transfected with miR-9-5p mimics or miR-NC. e Western blot analysis was used to determine the protein levels of PAK4 in HCT116 and SW1116 cells transfected with miR-9-5p mimics or miR-NC. All data are expressed as the means ± SD. **p < 0.01, compared with the miR-NC group

PAK4 was a target gene of miR-9-5p in CRC cells. a The potential binding sites of miR-9-5p and PAK4 mRNA, as well as the sequences in potential binding sites of mutant-type plasmid. b and c Dual luciferase reporter assays were performed in HCT116 and SW1116 cells with vectors including the putative miR-9-5p target sites in the 3′-UTR of PAK4 mRNA (wild-type) and mutant. Data were normalized against Renilla or firefly luciferase activity. d Quantitative real-time PCR was used to determine the mRNA levels of PAK4 in HCT116 and SW1116 cells transfected with miR-9-5p mimics or miR-NC. e Western blot analysis was used to determine the protein levels of PAK4 in HCT116 and SW1116 cells transfected with miR-9-5p mimics or miR-NC. All data are expressed as the means ± SD. **p < 0.01, compared with the miR-NC group

Downregulation of miR-9-5p inversely correlates with PAK4 expression in CRC

Next, we analyzed the expression of miR-9-5p in 32 pairs of CRC tissues and matched adjacent tissues using quantitative real-time PCR. The expression of miR-9-5p was significantly lower in CRC tissues than in adjacent tissues (Fig. 4a; p < 0.001). What’s more, we found that the expression of miR-9-5p negatively correlated with PAK4 expression in 40 CRC tissues (Fig. 4b; r = − 0.3674, p = 0.0386).
Fig. 4

The negative correlation between miR-9-5p and PAK4 in CRC tissues. a Lower expression of miR-9-5p was observed in 32 CRC tissue samples than in the matched adjacent tissues (determined using quantitative real-time PCR). ***p < 0.001; b The correlation between PAK4 and miR-9-5p in the 32 CRC clinical samples was analyzed using Spearman’s rank correlation

The negative correlation between miR-9-5p and PAK4 in CRC tissues. a Lower expression of miR-9-5p was observed in 32 CRC tissue samples than in the matched adjacent tissues (determined using quantitative real-time PCR). ***p < 0.001; b The correlation between PAK4 and miR-9-5p in the 32 CRC clinical samples was analyzed using Spearman’s rank correlation

The effects of miR-9-5p on cell proliferation and apoptosis are partially reversed by PAK4 overexpression

Since miR-9-5p is downregulated in CRC and negatively correlates with PAK4 expression, we speculated that it might negatively impact CRC cellular function by targeting PAK4. To validate this hypothesis, we transfected HCT116 and SW1116 cells with miR-NC, miR-9-5p mimics or miR-9-5p + PAK4. First, we confirmed that the expression of miR-9-5p in HCT116 and SW1116 cells increased significantly after transfection with miR-9-5p mimics using quantitative real-time PCR analysis (Fig. 5a; p < 0.001). The expression of PAK4 protein obviously decreased after transfection with miR-9-5p mimics, but partially attenuated after PAK4 overexpression (western blot results; Fig. 5b). Our in vitro experiments showed that ectopic PAK4 expression effectively reversed the effects of miR-9-5p overexpression on HCT116 and SW1116 cell proliferation (MTT assay results; Fig. 5c; p < 0.01, p < 0.001) and apoptosis (flow cytometry analysis; Fig. 5d; p < 0.05, p < 0.01, p < 0.001). Furthermore, we found that PAK4 overexpression markedly reversed the effects of miR-9-5p on the expression of pro-apoptotic Bad and anti-apoptotic Bcl-2 (Fig. 5e). These results suggest that miR-9-5p suppresses CRC cell proliferation by targeting PAK4.
Fig. 5

PAK4 alleviated the effects of miR-9-5p on cell proliferation and apoptosis in CRC cells. HCT116 and SW1116 cells were transfected with miR-NC, miR-9-5p mimics or miR-9-5p mimics + PAK4 for 48 h. a Quantitative real-time PCR was used to determine miR-9-5p expression with U6 as internal control. b Western blot was used to determine the expression levels of PAK4 with GAPDH as a loading control. c MTT assay was utilized to determine the cell proliferation in different groups on consecutive 5 days. d Cell apoptosis levels were determined using flow cytometry. Representative images of double Annexin V/PI staining are shown in the left panel and a statistical analysis of early and late apoptotic cells is shown in the right panel. e The protein levels of Bad and Bcl-2 were detected using western blotting in both HCT116 and SW1116 cells. All data are expressed as the means ± SD. ***p < 0.001, compared with the miR-NC group; #p < 0.05, ##p < 0.01, ###p < 0.001, compared with the miR-9-5p mimics group

PAK4 alleviated the effects of miR-9-5p on cell proliferation and apoptosis in CRC cells. HCT116 and SW1116 cells were transfected with miR-NC, miR-9-5p mimics or miR-9-5p mimics + PAK4 for 48 h. a Quantitative real-time PCR was used to determine miR-9-5p expression with U6 as internal control. b Western blot was used to determine the expression levels of PAK4 with GAPDH as a loading control. c MTT assay was utilized to determine the cell proliferation in different groups on consecutive 5 days. d Cell apoptosis levels were determined using flow cytometry. Representative images of double Annexin V/PI staining are shown in the left panel and a statistical analysis of early and late apoptotic cells is shown in the right panel. e The protein levels of Bad and Bcl-2 were detected using western blotting in both HCT116 and SW1116 cells. All data are expressed as the means ± SD. ***p < 0.001, compared with the miR-NC group; #p < 0.05, ##p < 0.01, ###p < 0.001, compared with the miR-9-5p mimics group

Discussion

The immense potential of miRNAs as modulators of cancer-related processes, including proliferation, apoptosis, migration and invasion, has fully emerged over the past decade [29]. Understanding the molecular pathology of cancer progression has been hampered by our limited knowledge about miRNA–mRNA regulatory networks [30]. Based on our previous work, we predicted PAK4 to be a target gene of miR-9-5p. Here, we explored whether PAK4 is a functional regulator of miR-9-5p in CRC cell proliferation and apoptosis. As expected, PAK4 knockdown or miR-9-5p overexpression significantly inhibited cell proliferation and induced apoptosis in the cells of two CRC cell lines, HCT116 and SW1116. PAK4 has been implicated in the regulation of the cell cycle regulatory proteins p21, CDK6 and p16 [31, 32]. Functional experiments with specific molecules showed that PAK4 is involved in the regulation of multiple cellular processes, including actin cytoskeleton remodeling, cell growth and gene expression [33]. PAK4 decreases the sensitivity of gastric cancer cells to cisplatin through the PI3K/Akt and MEK/ERK signaling pathways [34]. Studies have shown promotion of TCF/LEF gene transcription by PAK4 via regulation of β-catenin signaling, and the association between PAK4 and β-catenin could drive cell proliferation due to upregulation of cyclin D1 and c-myc [35]. PAK4 was also identified as an inhibitor of caspase 3 and caspase 8 activation, whichprevents the apoptotic process from starting [36]. This evidence shows the positive regulation of PAK4 in tumor cell growth and proliferation. As for miR-9-5p, there are several reports of its suppressive role in tumor progression. For example, Guo et al. showed that downregulation of miR-9-5p promoted the proliferation of papillary thyroid cancer cells by inhibiting apoptosis [37]. Fan et al. showed that miR-9-5p is closely related to the malignant progression of gastric cancer (GC) [26]. Our data, which show that downregulation of Bcl-2 and upregulation of Bad are caused by miR-9-5p overexpression in CRC cells, further confirm the tumor suppressor role of miR-9-5p. Our luciferase reporter assay results show that PAK4 is a potential target of miR-9-5p in HCT116 and SW1116 cells. Unfortunately, the inverse correlation between PAK4 mRNA levels and miR-9-5p was found to be very weak in 32 of the CRC tissue samples, although this might be ascribed to the relatively small sample size. Rescue experiments were performed to explore whether PAK4 is a downstream functional regulator involved in miR-9-5p regulation of CRC cell proliferation and apoptosis. Overexpression of PAK4 significantly alleviated the anti-proliferative and anti-survival effects of miR-9-5p in CRC cells. Sheng et al. [16] similarly recently found that PAK4 is a target of miR-145 and that the PAK4-dependent pathway is responsible for inhibiting the CRC cell migration and invasion induced by miR-145. Therefore, we suggest that enforced expression of miR-9-5p decreases CRC cell proliferation and survival by negatively regulating PAK4. Based on this, we shall investigate the possible mechanisms of how aberrant expression of PAK4 can lead to unfavorable proliferation and survival of CRC cells expressing low levels of miR-9-5p. PAK4 was discovered to bind and phosphorylate Smad2/3 through kinase-dependent and -independent pathways, thus reducing the response to the growth-inhibitory effects of TGF-β1 in gastric cancer cells [38]. Recent data revealed that Gab1, a binding partner for PAK4, is essential for cell cycle progression and proliferation [39]. These suggest a possible mechanism by which miR-9-5p targets PAK4 to inhibit CRC cell proliferation.

Conclusions

We have demonstrated that miR-9-5p regulates the expression of the serine/threonine kinase PAK4, providing strong evidence that miR-9-5p inhibits CRC proliferation and survival through negative regulation of PAK4. This study indicates a targeted regulation between miR-9-5p and PAK4, and provides a potential novel therapeutic target for CRC treatment. Additional file 1: Table S1. Primer sequences used for quantitative real time PCR analysis.
  39 in total

Review 1.  Signaling, Regulation, and Specificity of the Type II p21-activated Kinases.

Authors:  Byung Hak Ha; Elizabeth M Morse; Benjamin E Turk; Titus J Boggon
Journal:  J Biol Chem       Date:  2015-04-08       Impact factor: 5.157

2.  miR-9-5p inhibits pancreatic cancer cell proliferation, invasion and glutamine metabolism by targeting GOT1.

Authors:  Juan Wang; Bo Wang; HanQiang Ren; Wei Chen
Journal:  Biochem Biophys Res Commun       Date:  2018-12-24       Impact factor: 3.575

Review 3.  miRNA Deregulation in Cancer Cells and the Tumor Microenvironment.

Authors:  Rajesha Rupaimoole; George A Calin; Gabriel Lopez-Berestein; Anil K Sood
Journal:  Cancer Discov       Date:  2016-02-10       Impact factor: 39.397

4.  MiR-145 regulates PAK4 via the MAPK pathway and exhibits an antitumor effect in human colon cells.

Authors:  Zhigang Wang; Xiaoping Zhang; Zhili Yang; Hangxiang Du; Zhenqian Wu; Jianfeng Gong; Jun Yan; Qi Zheng
Journal:  Biochem Biophys Res Commun       Date:  2012-07-02       Impact factor: 3.575

5.  MicroRNA-9 inhibits the gastric cancer cell proliferation by targeting TNFAIP8.

Authors:  Hong-Yu Gao; Fu-Chun Huo; Hai-Yan Wang; Dong-Sheng Pei
Journal:  Cell Prolif       Date:  2017-01-27       Impact factor: 6.831

6.  Overexpressed PAK4 promotes proliferation, migration and invasion of choriocarcinoma.

Authors:  Hui-Juan Zhang; Michelle K Y Siu; Matthew C W Yeung; Li-Li Jiang; Victor C Y Mak; Hextan Y S Ngan; Oscar G W Wong; Hong-Quan Zhang; Annie N Y Cheung
Journal:  Carcinogenesis       Date:  2011-02-16       Impact factor: 4.944

Review 7.  MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.

Authors:  Rajesha Rupaimoole; Frank J Slack
Journal:  Nat Rev Drug Discov       Date:  2017-02-17       Impact factor: 84.694

8.  PAK5 mediates cell: cell adhesion integrity via interaction with E-cadherin in bladder cancer cells.

Authors:  Ahmad Fahim Ismail; Sevil Oskay Halacli; Nouf Babteen; Mario De Piano; Tracey A Martin; Wen G Jiang; Muhammad Shamim Khan; Prokar Dasgupta; Claire M Wells
Journal:  Biochem J       Date:  2017-03-24       Impact factor: 3.857

9.  miR-199a-3p Modulates MTOR and PAK4 Pathways and Inhibits Tumor Growth in a Hepatocellular Carcinoma Transgenic Mouse Model.

Authors:  Elisa Callegari; Lucilla D'Abundo; Paola Guerriero; Carolina Simioni; Bahaeldin K Elamin; Marta Russo; Alice Cani; Cristian Bassi; Barbara Zagatti; Luciano Giacomelli; Stella Blandamura; Farzaneh Moshiri; Simona Ultimo; Antonio Frassoldati; Giuseppe Altavilla; Laura Gramantieri; Luca Maria Neri; Silvia Sabbioni; Massimo Negrini
Journal:  Mol Ther Nucleic Acids       Date:  2018-04-12       Impact factor: 8.886

10.  Inhibition of miR-9-5p suppresses prostate cancer progress by targeting StarD13.

Authors:  Lin Chen; Weifeng Hu; Guohao Li; Yonglian Guo; Zhihua Wan; Jiajun Yu
Journal:  Cell Mol Biol Lett       Date:  2019-03-08       Impact factor: 5.787

View more
  12 in total

1.  MiR-199a/b-3p inhibits colorectal cancer cell proliferation, migration and invasion through targeting PAK4 and BCAR3.

Authors:  Junjie Hou; Xuguang Mi; Ning Liu; Xiaonan Li; Xiao-Nan Li; Ying Yang; Xiaodan Lu; Yanqiu Fang; Ning-Yi Jin
Journal:  Eur J Med Res       Date:  2022-07-16       Impact factor: 4.981

2.  LncRNA LINC01116 Promotes the Development of Colorectal Cancer by Targeting miR-9-5p/STMN1.

Authors:  Chongyao Bi; Hongshuai Cui; Haijing Fan; Lai Li
Journal:  Onco Targets Ther       Date:  2020-10-15       Impact factor: 4.147

3.  LncRNA MEG3 Protects Chondrocytes From IL-1β-Induced Inflammation via Regulating miR-9-5p/KLF4 Axis.

Authors:  Yijiang Huang; Daosen Chen; Zijian Yan; Jingdi Zhan; Xinghe Xue; Xiaoyun Pan; Huachen Yu
Journal:  Front Physiol       Date:  2021-03-11       Impact factor: 4.566

4.  hsa-miR-199a-3p Inhibits Motility, Invasiveness, and Contractility of Ovarian Endometriotic Stromal Cells.

Authors:  Ruofei Zhu; Kaei Nasu; Naoki Hijiya; Masato Yoshihashi; Tomoko Hirakawa; Yoko Aoyagi; Hisashi Narahara
Journal:  Reprod Sci       Date:  2021-05-13       Impact factor: 3.060

5.  microRNA-9-5p protects liver sinusoidal endothelial cell against oxygen glucose deprivation/reperfusion injury.

Authors:  Yi Duan; Yuanyuan Meng; Zhifeng Gao; Xiaoyu Wang; Huan Zhang
Journal:  Open Life Sci       Date:  2021-04-19       Impact factor: 0.938

6.  Interfering with pak4 Protein Expression Affects Osteosarcoma Cell Proliferation and Migration.

Authors:  Yuxin Fu; Lun Fang; Qipu Yin; Qi Wu; Wei Sui; Ying Sun; Xindi Zhao; Yadi Wu; Lu Zhou
Journal:  Biomed Res Int       Date:  2021-12-30       Impact factor: 3.411

7.  CDK15 promotes colorectal cancer progression via phosphorylating PAK4 and regulating β-catenin/ MEK-ERK signaling pathway.

Authors:  Chuntian Huang; Ruijuan Du; Xuechao Jia; Kangdong Liu; Yan Qiao; Qiong Wu; Ning Yao; Lu Yang; Liting Zhou; Xuejiao Liu; Pu Xiang; Mingxia Xin; Yan Wang; Xiaojie Chen; Dong Joon Kim; Zigang Dong; Xiang Li
Journal:  Cell Death Differ       Date:  2021-07-14       Impact factor: 15.828

8.  PAK4 suppresses TNF-induced release of endothelial microparticles in HUVECs cells.

Authors:  Shouqin Zhang; Yingjie Yin; Congye Li; Yi Zhao; Qixing Wang; Xiangyu Zhang
Journal:  Aging (Albany NY)       Date:  2020-07-12       Impact factor: 5.682

9.  PAK4 suppresses motor neuron degeneration in hSOD1G93A -linked amyotrophic lateral sclerosis cell and rat models.

Authors:  Chaohua Cong; Weiwei Liang; Chunting Zhang; Ying Wang; Yueqing Yang; Xudong Wang; Shuyu Wang; Di Huo; Hongyong Wang; Di Wang; Honglin Feng
Journal:  Cell Prolif       Date:  2021-02-21       Impact factor: 6.831

10.  miR-9-5p Promotes Lung Adenocarcinoma Cell Proliferation, Migration and Invasion by Targeting ID4.

Authors:  Kai Zhu; Jinlan Lin; Shengjia Chen; Qian Xu
Journal:  Technol Cancer Res Treat       Date:  2021 Jan-Dec
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.