Safinamide protects against amyloid β (Aβ)-induced oxidative stress and cellular senescence in M17 neuronal cells.

Alzheimer's disease (AD) is a neurodegenerative disorder that is pathologically related to oxidative stress and cellular senescence. Safinamide is one of the clinically prescribed monoamine oxidase B (MAOB) inhibitors. It has been reported to possess therapeutic potential in neurological disorders. However, the therapeutic potential of safinamide in AD is still under investigation. In this study, we explored the effect of safinamide in amyloid (Aβ)1-42 oligomers-stimulated M17 neuronal cells. We established the in vitro model with M17 cells by treating them with 1 μM Aβ1-42 oligomers with or without safinamide (100 or 200 nM). The results show that safinamide ameliorated Aβ1-42 oligomers-induced oxidative stress in M17 cells as revealed by the decreased reactive oxygen species (ROS) production and reduced glutathione (GSH) content. Safinamide treatment significantly ameliorated senescence-associated-β-galactosidase (SA-β-gal)-positive cells and telomerase activity. Further, we show that safinamide treatment resulted in decreased mRNA and protein expressions of p21 and plasminogen activator inhibitor-1 (PAI-1). Moreover, silencing of Sirtuin1 (SIRT1) abolished the effects of safinamide on the mRNA levels of p21 and PAI-1, as well as SA-β-gal-positive cells in Aβ1-42 oligomers-induced M17 cells. In conclusion, we reveal that safinamide exerted a protective function on M17 cells from Aβ1-42 oligomers induction-caused oxidative stress and cellular senescence through SIRT1 signaling. These present results provide meaningful evidence that safinamide may be medically developed for the prevention and therapy of AD.

Introduction

Alzheimer’s disease (AD) is a well-known age-associated neurodegenerative disease, clinically characterized by a progressive cognition decline [1]. It has become a public health crisis since the total number of older people is likely to significantly increase in upcoming decades [2]. Therefore, AD treatment and prevention strategies must be geared based on its complex pathophysiology and etiopathogenesis.

Currently, advancing age is documented to represent a strong risk factor for AD [3,4]. According to published documents on the causes of age-related conditions, a major contributor, oxidative stress, is observed [5,6]. Aging-associated oxidative stress has been found to contribute to changes in the telomere/telomerase system, thereby initiating a cellular senescence course [7]. Cellular senescence conversely promotes the production of ROS and other bioactive peptides, as well as the loss of tissue function, ultimately leading to AD pathogenesis [7]. Collectively, preventing the aging-associated increased oxidative status and cellular senescence may be helpful for alleviating AD progression. Several key factors have been shown to be involved in the pathogenesis of AD progression, including Sirtuin 1 (SIRT1), PAI, and p21. SIRT1 was the first identified of the Sirtuins family proteins and is one of the most well-studied aging regulators. SIRT1 has protective effects against age-related neurodegenerative diseases [8]. Plasminogen activator inhibitor type-1 (PAI-1) is the main inhibitor of the fibrinolytic system and has been recognized as a biomarker of AD [9]. P21 is a potent cyclin-dependent kinase inhibitor and plays a significant role in the control of the cell cycle and DNA repair. SIRT1 and PAI-1 have an inversion relationship. SIRT1 downregulates the transcription factor p53, which directly regulates p21 [8].

Monoamine oxidase (MAO)-B is an important isoform of MAO, which is a mitochondrial enzyme [10]. MAO is located in the outer mitochondrial membrane, and catalyzes oxidative deamination and production of ROS [10]. Therefore, MAO inhibitors have been documented to be useful in managing tissue damage associated with oxidative stress [11]. Some inhibitors of MAO have great potential for the therapy of several neurodegenerative disorders, including AD [12]. Safinamide (Figure 1(a)) is a reversible inhibitor of MAO-B that has both dopaminergic and glutamatergic functions [13]. Current evidence suggests that safinamide may be useful for the treatment of multiple neurological disorders including neuromuscular disorders, Parkinson’s disease (PD), stroke, and multiple sclerosis [14,15]. Evidence from multiple preclinical studies has shown that safinamide possesses antioxidant capacity [16]. However, the therapeutic potential of safinamide in AD has not been well documented.

Figure 1.

Cytotoxicity of Safinamide in M17 neuronal cells. (a) Molecular structure of safinamide; (b) Cells were treated with safinamide at the concentrations of 0, 5,10, 20, 100, 200, 1000, 2000 nM, cell viability was determined using MTT assay (*, **, P < 0.05, 0.01 vs. vehicle group).

It has been demonstrated that the pathogenesis of AD is closely associated with amyloid-β (Aβ) peptide [17]. Currently, Aβ1-42 oligomers are widely used for the establishment of AD models [18]. Hence, we used Aβ1-42 for the induction of oxidative stress, as well as cellular senescence in M17 neuronal cells. Using this cell model, for the first time, we explored the potential effects of safinamide on AD and uncovered the underlying mechanisms.

Materials and methods

M17 neuronal cells treatment

Human M17 neuronal cells (ATCC, Rockville, MD, USA) were cultured in 1:1 (vol./vol.) of minimal essential medium and F12 medium (Sigma, St. Louis, MO, USA). The medium was supplemented with10% FBS, 2 mM glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin. The treatment reagents Aβ1-42 and safinamide were obtained from Sigma-Aldrich (St. Louis, USA). To prepare oligomerized Aβ1-42, the lyophilized powder was resuspended in hexafluoro-2-Propanol (HFIP) for 2 hours to allow for Aβ monomerization as previously described [19]. To prepare the safinamide solution, the reagent was dissolved in DMSO. For the treatment experiment, the M17 cells in Aβ1-42 stimulation groups were pretreated with Aβ1-42 (1 μM) for 2 hours before the safinamide treatment (100 or 200 nM).

Cell transfection

For the transfection experiments, M17 cells were subcultured in a 24-well plate and subsequently transfected with predesigned siRNA targeting silencing information regulator 2 related enzyme 1 (sirtuin1, SIRT1) (si-SIRT1) or siRNA negative control (si-NC) the next day. Finally, the M17 cells were harvested and disposed of appropriately for the Western blot analysis.

MTT assay

Initially, 6 × 104 M17 cells were plated and treated with safinamide at the concentrations of 0, 5,10, 20, 100, 200, 1000, 2000 nM [20]. Posteriorly, the cell viability was measured using an MTT assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

Mitochondrial ROS measurement

The ROS content of M17 cells was assessed by incubation with H2DCFDA (Sigma, USA). The fluorescent H2DCFDA was finally converted into DCF, a highly fluorescent compound formed by H2DCF with ROS. Fluorescence of DCF was scanned with a microplate reader.

Assessment of reduced glutathione (GSH)

The spectrophotometric method was used to assess the reduced GSH concentration in M17 cells using a commercial kit (Jiancheng Bio., China), based on the manufacturer’s instructions.

Staining for senescence-associated β-galactosidase (SA-β-gal)

Staining for SA-β-gal was carried out using a commercial SA-β-gal Testing Kit (Beyotime Shanghai, China). The harvested M17 cells were fixed with 4% (vol./vol.) paraformaldehyde for 30 minutes and then stained with a staining solution overnight. Five random fields were selected for counting the number of SA-β-gal positive cells under a light microscope and the percentage of blue-stained cells was calculated.

Telomerase activity detection

The harvested M17 cells were processed to obtain the total protein. Then the protein amount was estimated using the Bradford method. A quantitative TeloTAGGG Telomerase PCR-ELISA kit (Roche, Switzerland) was used for the determination of relative telomerase activity in the M17 cells following the manufacturer’s protocol.

Real-time PCR (RT-PCR)

Total RNA of M17 cells was processed using a Total RNA Kit (Thermo Fisher Scientific, USA) and used for obtaining cDNA with a cDNA Synthesis Kit (Thermo Fisher Scientific, USA). The obtained cDNA was then amplified for evaluating the mRNA levels of plasminogen Activator Inhibitor-1 (PAI-1), p21, and SIRT1 using SYBR Green Master Mix (Roche) under conditions previously described [21]. The following primers were used in this study: p21 (Forward: 5ʹ-AGGTGGACCTGGAGACTCTCAG −3ʹ, Reverse: 5ʹ- TCCTCTTGGAGAAGATCAGCCG-3ʹ); PAI1 (Forward: 5ʹ-CTCATCAGCCACTGGAAAGGCA −3ʹ, Reverse: 5ʹ-GACTCGTGAAGTCAGCCTGAAAC −3ʹ); SIRT1 (Forward: 5ʹ- TAGACACGCTGGAACAGGTTGC −3ʹ; Reverse: 5ʹ-CTCCTCGTACAGCTTCACAGTC-3ʹ); GAPDH (5ʹ- GTCTCCTCTGACTTCAACAGCG −3ʹ; Reverse: 5ʹ- ACCACCCTGTTGCTGTAGCCAA-3ʹ).

Western blot analysis

Whole-cell lysates of M17 cells were prepared then loaded on SDS-PAGE gel and then the isolated proteins were subjected to Western blot analysis. The specific primary antibodies for SIRT1 (#9475, 1;1000), PAI-1 (#94,536, 1;1000), p21 (#2947, 1;1000) and β-actin (#3700, 1;10,000) and the corresponding secondary antibody (#7074 and #7076, 1;5000) were purchased from Cell Signaling Technology (MA, USA). The bands were visualized by incubating with the Chemiluminescent Substrate (Thermo Fisher Scientific) and the densitometry was imaged using Image J software.

Statistical analysis

Unpaired Student’s t-test or ANOVA followed by the Student-Newman-Keuls (SNK) test were used for the statistical analysis [22-24]. All of the data are analyzed as mean ± SE.

Results

We found that 100 and 200 nM safinamide treatment protected M17 cells from Aβ1-42 oligomers-induced ROS production. Safinamide treatment also ameliorated Aβ1-42 oligomers-induced reduced telomerase activity and cellular senescence. Mechanistically, we showed that safinamide treatment mitigated the expressions of p21 and PAI-1. Finally, we confirmed that SIRT1 is required for the beneficial effects of safinamide.

Cytotoxicity of safinamide in M17 cells

In preliminary experiments, we evaluated the effect of safinamide on M17 cells. A range of concentrations (0–2000 nM) were used to determine the cytotoxicity. From the MTT assay, we could see that no significant change in cell viability was found at all concentrations of safinamide except for 1000 and 2000 nM (Figure 1(b)). There were 10% and 18% decreases in cell viability at the concentrations of 1000 and 2000 nM, respectively (Figure 1(b)). Based on the results, 100 and 200 nM were chosen for the subsequent experiments.

Safinamide ameliorated Aβ1-42 oligomers induction-caused oxidative stress in M17 cells

M17 cells were stimulated with Aβ1-42 oligomers with or without safinamide (100, 200 nM) for 24 h. The antioxidant effect of safinamide on M17 cells was investigated by detecting the changes in intracellular ROS levels. Mitochondrial ROS were dramatically increased with a 3.2-fold change after Aβ1-42 oligomers stimulation, compared with control cells (Figure 2(a)). In M17 cells treated with a low or high dose of safinamide, mitochondrial ROS were respectively decreased by 34.4% and 50.0% (Figure 2(a)). Also, the GSH content was assessed. Exposure to Aβ1-42 oligomers caused a significant decrease (42%) in GSH content (Figure 2(b)). Whilst treatment with safinamide (100 or 200 nM) significantly rescued the GSH content by 31.0% and 53.4%, respectively (Figure 2(b)). Our results suggest that safinamide inhibited ROS production and elevated GSH content in M17 cells following Aβ1-42 exposure.

Figure 2.

Safinamide ameliorated Aβ1-42 oligomers-induced oxidative stress in M17 neuronal cells. Cells were stimulated with Aβ1-42 oligomers with or without safinamide (100, 200 nM) for 24 hours. (a). ROS was measured; (b). The levels of reduced GSH were assayed (***, P < 0.01 vs. vehicle group; #, ##, ###, P < 0.05, 0.01, 0.005 vs. Aβ1-42 oligomers group).

Safinamide mitigated Aβ1-42 oligomers-caused changes in SA-β-gal in M17 cells

To determine if safinamide could protect against Aβ1-42 oligomers-induced cellular senescence, SA-β-gal staining was conducted. In Figure 3(a), the representative images of SA-β-gal staining are presented. Quantification of SA-β-gal staining proved that the number of blue-stained cells was markedly increased in Aβ1-42 oligomers-induced M17 cells with a 3.3-fold change, as compared to the control M17 cells (Figure 3(b)). In safinamide (100 or 200 nM) treatment groups, the SA-β-gal-positive cells numbers were respectively reduced by 27.3% and 48.5% (Figure 3(b)).

Figure 3.

Safinamide mitigated Aβ1-42 oligomers-caused changes in SA-β-gal in M17 neuronal cells. Cells were stimulated with Aβ1-42 oligomers with or without safinamide (100, 200 nM) for 7 days. (a). Cellular senescence was accessed using senescence-associated-β-galactosidase (SA-β-gal) staining. (b). Quantification of SA-β-gal staining (***, P < 0.01 vs. vehicle group; ##, ###, P < 0.01, 0.005 vs. Aβ1-42 oligomers group).

Safinamide attenuated Aβ1-42 oligomers-induced reduction of telomerase activity in M17 cells

Previous studies have demonstrated that declined telomerase activity may lead to telomere shortening and cellular senescence [7]. Thus, we evaluated the changes in telomerase activity after safinamide treatment. As shown in Figure 4, the telomerase activity of M17 cells treated with Aβ1-42 oligomers (12.1 ± 1.25 IU/L) was much lower than that of control M17 cells (25.6 ± 2.71 IU/L). Nevertheless, treatment of M17 cells with 100 or 200 nM safinamide restored the telomerase activity to 17.5 ± 1.87 and 22.7 ± 2.64 IU/L, respectively.

Figure 4.

Safinamide attenuated Aβ1-42 oligomers-induced reduction of telomerase activity in M17 neuronal cells. Cells were stimulated with Aβ1-42 oligomers with or without safinamide (100, 200 nM) for 7 days. Telomerase activity was measured using a commercial kit (***, P < 0.01 vs. vehicle group; ##, ###, P < 0.01, 0.005 vs. Aβ1-42 oligomers group).

Safinamide inhibited Aβ1-42 oligomers-induced increased mRNA and protein levels of PAI-1 and p21 in M17 cells

PAI-1 and p21 are two important markers and mediators of cellular senescence. Therefore, we assessed the regulation of safinamide on their expression levels. Results from RT-PCR show that PAI-1 and p21 mRNA levels were markedly elevated by 2.9- and 3.6-fold, respectively, in cells stimulated with Aβ1-42 oligomers (Figure 5(a)). However, the mRNA levels of PAI-1 and p21 were both downregulated after safinamide (100 and 200 nM) treatment. Meanwhile, the changes in the protein levels of PAI-1 and p21 were consistent with those of their mRNA levels (Figure 5(b)).

Figure 5.

Safinamide inhibited Aβ1-42 oligomers-induced expression of PAI-1 and p21 in M17 neuronal cells. Cells were stimulated with Aβ1-42 oligomers with or without safinamide (100, 200 nM) for 24 hours. (a). mRNA of PAI-1; (b). Protein of PAI-1 and p21 as measured by Western blot analysis (***, P < 0.01 vs. vehicle group; ##, ###, P < 0.01, 0.005 vs. Aβ1-42 oligomers group).

Safinamide increased the expression of SIRT1 in M17 cells

SIRT1 is considered an eminent factor of aging, hence, we assessed if safinamide could affect its expression. The mRNA level of SIRT1 was decreased by 45% in Aβ1-42 oligomers-induced M17 cells. However, it was increased by 38.2% and 69.1% after treatment with 100 or 200 nM safinamide, respectively (Figure 6(a)). Western blot analysis results prove that a 39% reduction in the SIRT1 protein level was observed in cells stimulated with Aβ1-42 oligomers. Treatment with 100 or 200 nM safinamide resulted in significant increases in SIRT1 protein expression by 1.28- and 1.59-fold, respectively (Figure 6(b)).

Figure 6.

Safinamide increased the expression of SIRT1 in M17 neuronal cells. Cells were stimulated with Aβ1-42 oligomers with or without safinamide (100, 200 nM) for 24 hours. (a). mRNA of SIRT1; (b). Protein of SIRT1 as measured by Western blot (***, P < 0.01 vs. vehicle group; ##, ###, P < 0.01, 0.005 vs. Aβ1-42 oligomers group).

Transfection with si-SIRT1 abolished the effects of safinamide on senescence against Aβ1-42 oligomers stimulation

The role of SIRT1 in M17 cells was further confirmed by transfection with si-SIRT1. Western blot analysis confirmed that SIRT1 was successfully knocked down, as evidenced by the 47% reduction in its protein level (Figure 7(a)). The inhibitory effect of safinamide on the mRNA levels of PAI-1 and p21 was diminished in SIRT1 silencing cells (Figure 7(b)). Also, silencing of SIRT1 abolished the safinamide-caused reduction in SA-β-gal-positive cells percentage (Figure 7(c)).

Figure 7.

Silencing of SIRT1 abolished the inhibitory effects of Safinamide on oxidative stress and cellular senescence against Aβ1-42 oligomers. Cells were transfected with SIRT1 siRNA, followed by incubation with Aβ1-42 oligomers with or without safinamide (200 nM). (a). Western blot analysis demonstrated successful knockdown of SIRT1; (b). mRNA of PAI-1 and p21; (c). SA-β-gal staining (***, P < 0.005 vs. vehicle group; ##, P < 0.01, vs. Aβ1-42 oligomers group; &&, P < 0.01 vs. Aβ1-42 oligomers+safinamide).

Discussion

Several pieces of evidence recommend that oxidative stress occurs in AD hippocampi and cortices during the early course of AD, along with elevated levels of Aβ [17,24]. Redox-active metal ions can bind to Aβ and then catalyze the reaction to produce ROS. In turn, ROS contribute to Aβ peptide damage [17]. We first evaluated the effect of safinamide on ROS production in Aβ1-42 oligomers-induced M17 cells. The results in this study reveal that the increased levels of ROS were markedly repressed by safinamide. Also, we determined the content of GSH, which is the most potent antioxidant system in eukaryotic cells [25]. Our present data show that safinamide restored the GSH content in Aβ1-42 oligomers-induced M17 cells. Collectively, we demonstrated that safinamide exerted antioxidant activity in M17 cells in response to Aβ1-42 oligomers stimulation.

Cellular senescence is a physiological phenotype aimed at a permanent state of cell cycle arrest [26]. In young organisms, cellular senescence is commonly considered a beneficial process since it can suppress the accumulation of aberrant cells caused by various stresses. However, it is detrimental in older organisms because it induces age-related phenotypes [26]. The idea that cellular senescence contributes to aging has been fully documented. Several biomarkers of cellular senescence are targeted toward cell cycle arrest in the G1 phase, SA-β-gal, telomere attrition, senescence-associated heterochromatic foci, and accumulation of DNA damage [26,27]. In this study, changes in Aβ1-42 oligomers-induced cellular senescence with or without safinamide were assessed by determining the SA-β-gal staining and telomerase activity. Figures 3–4 show that the changes in Aβ1-42 oligomers-caused senescence were prevented by safinamide treatment. PAI-1 is an essential regulator of cellular senescence and a potential target for aging-related pathologies [28,29]. P21 is a critical regulator of senescence-associated cell cycle progression [30,31]. Consequentially, we assessed the changes in expression levels of PAI-1 and p21. The results denote that Aβ1-42 oligomers-induced expression levels of PAI-1 and p21 were inhibited by safinamide in M17 cells. Taken together, safinamide mitigated the cellular senescence caused by Aβ1-42 oligomers incubation.

SIRT1 is involved in the regulation of cellular senescence and aging [32]. It has been reported that SIRT1 expression is diminished with aging in mice, while increased SIRT1 expression is sufficient to extend lifespan in yeast, caenorhabditis elegans, and mice [33]. Conversely, overexpression of SIRT1 blocks senescence progression in several types of cells treated with angiotensin II [34-36]. In addition, SIRT1 was found to modulate the cellular senescence by interacting with several signal transductions, for instance, insulin/IGF-1 (IIS), AMPK, mTOR, and forkhead box (FOX) [37]. We found that safinamide induced the activation of SIRT1 signaling in Aβ1-42 oligomers-induced M17 cells, with the increased expression of SIRT1. To further confirm the role of SIRT1, M17 cells were transfected with si-SIRT1 to achieve the knockdown of SIRT1. We found that reduction of SIRT1 abolished the safinamide-caused decrease in oxidative stress and cellular senescence against Aβ1-42 oligomers, which further confirmed the crucial role of SIRT1 signaling in the protective effect of safinamide.

The limitation of the current study has to be discussed. First, all the data on safinamide in the current study were tested in the cultured neuronal cell line M17. Our study indicates that safinamide could have the potential protective effect against oxidative stress and neuronal senescence. However, these findings need to be validated in preclinical animal models and human subjects. Secondly, we only tested the effect of safinamide, which is one of three MAO-B inhibitors. Amongst MAO-B inhibitors, selegiline and rasagiline are also known to be effective for the treatment of early stages of neurodegenerative disorders [38,39]. Also, it is likely that the combination of MAO-B inhibitors could be more beneficial. The interaction mechanisms of different MAO-B inhibitors have to be tested for in future studies. Thirdly, a high dose (100 mg/day in humans) of safinamide has been suggested to be used to treat patients with mid-to late-stage Parkinson’s disease, as the high dose of the drug may provide further benefits for neuroprotection [40]. This dose is close to the range of the two doses that we tested (100 and 200 nM). Nevertheless, more tests with the clinically relevant dose of safinamide are warranted to understand its pharmacological effect. Moreover, the molecular pathology of neurodegeneration is a complex system. Besides Aβ oligomers-associated oxidative stress and senescence in neurons, there are other risk factors, such as Tau protein, aging, and genetic factors. Also, several other cell types are involved in its pathogenesis, including glial cells, immune cells, and brain vascular cell types [41]. The molecular effects of safinamide should be tested for in other cell types”.

Several clinical aspects have to be mentioned regarding the effectiveness of safinamide. The efficacy of the treatment is associated with the timing of intervention with respect to neuroprotection in neurodegenerative diseases. Also, the compensatory mechanism may be a factor in an aging brain [42]. Together, these factors may limit the effectiveness of early therapeutic invention. Also, the lack of diagnostic tools capable of early detection of Alzheimer’s disease negatively impacts our findings on safinamide in clinical practice.

Conclusion

In summary, we demonstrated the protective effects of safinamide on Aβ1-42 oligomers-induced oxidative stress and cellular senescence in M17 cells. Mechanistically, we found that the effect of safinamide requires SIRT1 activity. We conclude that the MAO-B inhibitor safinamide exhibits protective effects in neuronal cells. The therapeutic effect of safinamide requires validation in an in vivo model and clinical trials.