Literature DB >> 35000535

Circ_0017639 facilitates proliferative, migratory, and invasive potential of non-small cell lung cancer (NSCLC) cells via PI3K/AKT signaling pathway.

Hong-Bo Zhang1, Xiang-Ming Qiu1, Yi-Chao Zhang1, Ting-Ting Huang1, Zhan-Jie Zuo1, Tao Zhang2.   

Abstract

Non-small cell lung cancer (NSCLC) has increased morbidity and mortality rate worldwide. The current NSCLS therapies are associated with poor outcomes and need further improvement. CircRNAs were shown to regulate NSCLC progression. However, little is known re garding the functions and mechanisms of circ_0017639 in NSCLC, which requires further extensive studies. The circ_0017639 expression in NSCLC tissues and cell lines was evaluated via qRT-RCR. Moreover, using ectopic plasmid incorporation and shRNA assays, we analyzed the circ_0017639-mediated cellular proliferative, migratory and invasive processes in NSCLC cell lines, using CCK-8, EdU, and transwell assays. Furthermore, the core proteins (p-PI3K, PI3K, p-AKT, and AKT) levels of the PI3K/AKT signaling cascade were investigated via immunoblotting. Finally, we tested the functional role of circ_0017639 by examining its regulation of xenograft tumor growths in nude mice in vivo. Circ_0017639 expression was remarkably high in the NSCLC tissues and cell lines. The transfection experiments showed that circ_0017639 overexpression was able to promote proliferative, migratory, and invasive properties of NSCLC cells, while sh-circ_0017639 showed opposing effects. We further showed that circ_0017639 knockdown suppressed the cellular development via PI3K/AKT cascade inactivation. Additionally, in-vivo experiment in nude mice demonstrated that sh-circ_0017639 could reduce the tumor growth of NSCLC. Circ_0017639 may promote the development of NSCLC by accelerating NSCLC metastasis through stimulating the PI3K/AKT cascade.

Entities:  

Keywords:  NSCLC; circ_0017639; pi3k/akt; tumorigenesis

Mesh:

Substances:

Year:  2022        PMID: 35000535      PMCID: PMC8805965          DOI: 10.1080/21655979.2021.2020390

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   3.269


Introduction

NSCLC is a malignant tumor that is considered to be the most prevalent form of lung carcinoma with the highest fatality rates and accounts for almost 85% of all lung carcinoma cases [1]. Despite multidisciplinary therapies that have been used for the advanced NSCLC patients, the overall survival (OS) rates are still poor [2]. Therefore, there is a critical need to explore the mechanism underlying NSCLC, develop novel treatments, and improve NSCLC outcomes. As we know, circRNA is a group of circular RNAs derived from pre-mRNAs [3]. At the moment, the main function of circRNAs has been discovered to work as miRNAs sponge [4]. Moreover, more and more studies suggested that circRNAs might play important roles in tumor development [5]. Multiple evidence have suggested that the increasing number of circRNAs, including circSATB2 [6], circPTK2 [7], and circHIPK3 [8], are strongly correlated with the occurrence and progression of NSCLC as pivotal molecular regulators and prognostic biomarkers [9]. In recent years, multiple studies demonstrated a clear link between circRNAs dysregulation and the tumor chemoresistance, tumor progression, dissemination of NSCLC [10-12]. The previous studies have found that hsa_circ_0017639 (GSE78092 in the GEO database, Additional file 1: Table S1) is derived from gene SFMBT2, also called as circ-SFMBT2 and promotes the progression of gastric cancer (GC) [13,14]. It has been reported that circ_0017639 is significantly overexpressed in lung cancer tissues [15]. Nevertheless, its regulation, of NSCLC remains to be explored. Herein, we evaluated the effect of circ_0017639 on NSCLC. PI3K/AKT is a critical signal transduction pathway for the regulation of key cellular metabolic activities involved in metastatic progression [16]. The signaling cascade i.e., PI3K/AKT is associated with the metastasis of lung carcinoma and regulating the progression of cancerous cells [16-18]. Although PI3K/AKT cascade is critical mediators of NSCLC, for example, circular RNA 0008594 regulates NSCLC development via PI3K/AKT [19], whether circ_0017639 regulates these axes in NSCLC requires additional investigation. Here, we aimed at exploring the biological role of circ_0017639 in NSCLC. We examined the expression and function of circ_0017639 in NSCLC in-vitro and in-vivo. We hypothesized that circ_0017639 regulated the PI3K/AKT signaling cascade in its modulation of NSCLC progression. Our work will offer considerable insight into targeted NSCLC therapy.

Materials and methods

Tissue samples

NSCLC and the corresponding paracancerous tissue samples (total 80 samples) were retrieved from 80 pairs of patients with NSCLC at the General Hospital of Chinese People’s Armed Police Forces from March 2015 to March 2020. These patients did not receive pre-operative chemo- or radio-therapy. We received informed signed documents from all patients agreeing to the participation in the study, prior to tissue extraction. The protocol was approved by the Ethics Committee of General Hospital of Chinese People’s Armed Police Forces. The specimens were maintained at −80°C for further studies.

Cell culture

NSCLC cell lines (i.e., A549, H1299, H1755, and H2170) and bronchial epithelial cells (i.e., 16HBE) of human source were provided by ATCC, USA. The cells were passaged in RPMI-1640 (Invitrogen) containing FBS (10%), and antibiotics streptomycin/penicillin (1%). The cells were incubated at 37°C in a humidified environment with a continuous supply of 5% CO2.

Cell transfection

The pcDNA3.1/circ_0017639 and sh-circ_0017639 were developed by GenePharma (Shanghai). H1755 and H2170 cells (2 × 105 cells) were then incorporated with 2 μg pcDNA3.1/circ_0017639 (circ_0017639) or pcDNA3.1/NC (vector), A549 and H1299 cells (2 × 105 cells) were incorporated with 100 nM sh-circ_0017639 (CGGTGACTAAGCAATCAAAGA) or sh-negative control (sh-NC), Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) per operational guidelines. Following 48 h of incubation, the cells underwent additional examinations.

Fluorescence in situ hybridization (FISH)

We obtained a FITC-labeled biotin-labeled circ_0017639 probe (5′-CTCCTGCGTCGGTGACTAAGCAATCAAAGAGAAGTAC-3′-biotin) from Genepharma (Shanghai, China). We used 4,6-diamidino-2- phenylindole for cell nucleus counterstaining. The processes followed standard protocols of Genepharma and previous work [13]: 0.4-μm NSCLC tissue sections were dewaxed and sequentially dehydrated with 70%, 85%, and 100% alcohol for 5 min. Treated with the FITC-coupled probe for circ_0017639 was at 37°C overnight. Samples were washed three times with 50% form amide at 42°C for 5 min and re-dyed with DAPI and observed under a fluorescence microscope.

qRT-PCR assay

Total RNA was isolated with a RNA isolation kit (Biomed, Beijing, China), and quantified with a Nanovue spectrophotometer (GE, Buckinghamshire, UK) following operational guidelines. Next, RNA was used as a template to form cDNA using the First-Stand cDNA Synthesis SuperMix (TransGen Biotech. Beijing, China) as the kit guidelines. The circ_0017639 and GAPDH primers employed in this study are given below: circ_0017639 (F: 5′-GCGTCGGTGACTAAGCAATC-3′, R: 5′-CCAATCCCACATAGCGAAGG-3′), GAPDH (F: 5′-TGTTCGTCATGGGTGTGAAC-3′, R: 5′-ATGGCATGGACTGTGGTCAT-3′). GAPDH was the endogenous control, and the 2−ΔΔCt method [20] was employed for the estimation of relative gene expression. The thermocycling conditions of PCR were: 0.5 min at 95°C, 5 s for 40 cycles at 95°C, and 35 s at 60°C.

Actinomycin D assay

A549 cells were seeded in a 6-well plate overnight and then treated with 2 mg/L actinomycin D (A1410, Sigma-Aldrich, USA) as a control at indicated time. qRT-PCR assay was used to assess the expression of circ_0017639 after cells were harvested [21].

CCK-8 assay

We tested the transfected cell proliferative abilities using CCK-8 assay [12]. Plasmid incorporated cells (1 × 103/well of 96-well plate) were grown. After 24 hours, a CCK-8 reagent (10 μl) was added to each well at ~ 25°C. Then, 0, 24, 48, and 72 hours later, absorbance was monitored with a microplate reader (Bio-Rad) at 450 nm.

EdU (5-ethynyl-2′-deoxyuridine) proliferation assay

EdU assay was used to examine cell proliferation [17]. The cells were kept under standard experimental conditions. The EdU Cell Proliferation Assay Kit (E10187, Invitrogen) was employed to evaluate the cellular proliferation, followed by incubating NSCLC cells with EdU (50 µM) for 4 hours. Next, the staining of cells nuclei was carried out with 4′, 6-diamidino-2-phenylindole (DAPI, D3571, Invitrogen) for 20 min, and visualized under a fluorescent microscope.

Transwell assay

Transfected cells were performed with transwell chamber kits (Corning, USA) having matrigel coating (BD Biosciences) or not [13,22]. For invasion assay, matrigel membrane was formed after being diluted in 1:10 serum-free DMEM and then placed at 37°C for 4–6 hours. For migration assay, the transfected cells were put in the media (serum-free) in the upper compartment (8-μm pore size) with a 2 mg/ml Matrigel-coated membrane (precoating at 37 °C for 15 min). After 72 hours incubation, cells were removed from the top of the filter by using a cotton swab, followed by fixing the cells (in the membrane lower portion) with formaldehyde (4%) for 10 min, followed by staining with 0.5% crystal violet (cat. no. C0775MSDS, Sigma-Aldrich; Merck KGaA) at RT for 15 min, before imaging and counting of the cells at ×200 magnifications with an inverted microscope (Nikon Corporation).

Western blot (WB)

Total protein isolation was carried out from transfected cells with RIPA lysis buffer with proteinase inhibitors (protease inhibitors; phosphatase inhibitors; Sigma, USA). SDS-PAGE (10%) was conducted to isolate protein samples (50 μg) before being transferred to a PVDF membrane. Next, the membrane blockage was carried out with skimmed milk (5%) for 2 h, and then exposed to corresponding primary antibodies at 4°C: anti-p-PI3K (phospho Y607, ab235266), anti-PI3K (ab32089), anti-p-AKT (phospho T308, ab38449), anti-AKT (ab18785), and anti-GAPDH (ab181602), all from Abcam, UK, with a dilution of 1:1000. After 3 consecutive washes, the membrane was treated with secondary antibody labeled with peroxidase (anti-rabbit IgG, 1:2000, ab6721, Abcam, UK) at RT for 2 h, before development of protein bands with the ECL (Thermo Fisher Scientific, Inc.) and analysis via Image Lab™ Software (Bio-Rad) [17].

Mouse xenograft assay

The animal protocol was approved by the Animal Care and Use Committee of General Hospital of Chinese People’s Armed Police Forces before study initiation. BALB/c male nude mice (6 weeks old) were purchased from the Charles River Laboratories (Beijing, China). The circ_0017639 knockdown model (sh-circ_0017639) was generated in lentiviral-stabilized A549 cells in order to explore in vivo effects of circ_0017639 on the growth of the tumor. For the in vivo mouse xenograft, 2 × 107 A549 cells with or without sh-circ_0017639 was injected into right flanks of nude mice. After injection, tumor length and width were recorded with a standard caliper, and volume was obtained using the following formula: length × width2 /2. The tumor volumes were measured every week. In ~28 days, the mice were euthanized with sodium pentobarbital (40 mg/kg, i.p.). Then the tumors were isolated, and their weight was recorded.

Immunohistochemistry (IHC)

IHC was performed to assess levels of protein Ki-67 in the tumor tissues using an IHC staining kit (ab269452, Abcam), as suggested by the manufacturer [23]. Next, fixation of the tumor tissues was carried out in paraformaldehyde (4%, pH 7.4), before embedding in paraffin, and slicing to achieve ~5-μm thickness. Then 5-μm sections were treated overnight at RT in 10% rabbit serum with anti-Ki-67 (1:200, ab16667, Abcam, UK). After washing, the sections were treated for an additional 2 hours with HRP goat anti-rabbit IgG (1:1000, ab6721, Abcam, UK), before nuclear counterstaining with hematoxylin, and the positively stained cells per field (×200 or × 400) were assessed under a fluorescence microscope (DP80, Olympus).

Statistical analysis

Statistical analyses were done with GraphPad Prism version 7.0 (San Diego, CA, USA) and SPSS version 22.0 (Chicago). The t-test was employed for testing inter-group differences, and One-way ANOVA, and subsequent Tukey’s post hoc tests were used for multi-group differences. A log-rank test compared the OS between the high- and low-risk NSCLC patients. Each experimental procedure was conducted thrice unless otherwise indicated. Data are displayed as mean ± SD. P-value<0.05 was significance threshold.

Results

In this study, we studied the biological role and the molecular mechanisms of circ_0017639 in NSCLC. Our results indicated that circ_0017639 considerably contributes to the NSCLC development. High circ_0017639 expression was found in NSCLC cells and tissues, and enhanced the cell proliferation, migration, and invasion of NSCLC cells. Additionally, circ_0017639 could active the PI3K/AKT signaling pathway in vitro and in vivo. Thus, we revealed that an elevated expression of circ_0017639 enhanced the progression of NSCLC cells through triggering PI3K/AKT signaling pathway, which may provide the experimental evidence for the further targeted intervention therapy of NSCLC.

Circ_0017639 was increased in NSCLC tissue and cells

To identify the circ_0017639 expression in NSCLC, we evaluated the levels of circ_0017639 in 80 paired NSCLC versus precancerous tissues. Using qRT-PCR, we revealed substantially elevated levels of circ_0017639 in NSCLC tissues (P < 0.001; Figure 1a). Furthermore, among the NSCLC tissue samples, circ_0017639 expressions were elevated in the stage III–IV and metastatic of the NSCLC cases (Figure 1b, and 1c), and no considerable variations were observed in circ_0017639 expressions among the diverse age groups (age<60 and age≥60) of NSCLC patients (Figure 1d). Additionally, the NSCLC tissues were further separated into high-circ_0017639 (n = 40) and low-circ_0017639 groups (n = 40), based on the median circ_0017639 expression in NSCLC tissues (Figure 1a). Kaplan-Meier (K-M) plot of OS demonstrated that the high-circ_0017639 patients experienced markedly shorter OS, compared to the high-circ_0017639 cases (P = 0.0308; Figure 1e). NSCLC patient clinicopathological characteristics are summarized in Table 1.We also evaluated the circ_0017639 levels in 16HBE and NSCLC cell lines (A549, H1299, H1755 and H2170). figure 1f highlighted that circ_0017639 levels were remarkably higher in the NSCLC cells (A549 > H1299 > H1755 > H2170) versus 16HBE cells (P < 0.01, P < 0.001). FISH assays demonstrated that hsa_circ_0017639 was predominantly localized to the cytoplasm in NSCLC tissue (Figure 1g). In addition, A549 cells were treated with actinomycin D, an inhibitor of transcription, and total RNA was harvested at indicated time points. Circ_0017639 isoforms were highly stable, with transcript half-lives exceeding 48 h (Figure 1h). These findings unveil the complexity of circ_0017639 in the progression of NSCLC.
Figure 1.

The expression of circ_0017639 in NSCLC. (a) RT-qPCR detected the circ_0017639 expression in 80 paired NSCLC and precancerous tissues. (b) Expression of circ_0017639 among the stage I–II (n = 35) and III–IV (n = 45) of NSCLC patients. (c) Expression of circ_0017639 among the non-metastatic (n = 33) and metastatic (n = 47) of NSCLC patients. (d) Expression of circ_0017639 among the age <60 (n = 42) and the age≥60 (n = 38) of NSCLC patients. (e) K-M survival analyzed the OS (%) of patients suffering from NSCLC, with either elevated- (≥Median, n = 40) or decreased expression of circ_0017639 (

Table 1.

NSCLC clinicpathological features and circ_0017639 expression

CharacteristicsCasescirc_0017639 expression
P value
 N = 80HighLow 
Age (years)    
<604222200.1546
≥60381622 
Gender   0.3148
Male512426 
Female291415 
TNM stage   <0.001***
I–II35728 
III–IV453114 
metastasis   <0.001***
non-metastatic33924 
metastatic472918 
NSCLC clinicpathological features and circ_0017639 expression The expression of circ_0017639 in NSCLC. (a) RT-qPCR detected the circ_0017639 expression in 80 paired NSCLC and precancerous tissues. (b) Expression of circ_0017639 among the stage I–II (n = 35) and III–IV (n = 45) of NSCLC patients. (c) Expression of circ_0017639 among the non-metastatic (n = 33) and metastatic (n = 47) of NSCLC patients. (d) Expression of circ_0017639 among the age <60 (n = 42) and the age≥60 (n = 38) of NSCLC patients. (e) K-M survival analyzed the OS (%) of patients suffering from NSCLC, with either elevated- (≥Median, n = 40) or decreased expression of circ_0017639 (

Circ_0017639 overexpression accelerated the proliferative, migratory, and invasive potential of NSCLC cells

To elucidate the physiological property of circ_0017639 on NSCLC cells, pcDNA3.1/circ_0017639 (circ_0017639), or pcDNA3.1/NC (vector) were incorporated into the H1755 and H2170 cells. qRT-PCR data showed that in Figure 2a, circ_0017639 expression level was indeed elevated in the circ_0017639 group, relative to the vector group (P < 0.01). Data from the CCK-8 assay indicated that circ_0017639 upregulated the proliferative potential of H1755 and H2170 cells (P < 0.05 and < 0.001, accordingly, Figure 2b). Furthermore, the obtained data of EdU assay indicated that the overexpression of circ_0017639 considerably accelerated the proliferative abilities in cells i.e., H1755 and H2170, as shown in Figure 2c. Transwell assays further demonstrated that the cell migrated and invasive abilities were encouraged in H1755 and H2170 cells transfected with circ_0017639 (P < 0.01 and 0.001, accordingly, Figure 2d, 2e). Hence, these findings indicated that circ_0017639 overexpression can drive the proliferative, migratory, and invasive abilities of NSCLC cells.
Figure 2.

An elevated expression of circ_0017639 promoted the proliferative, migratory, and invasive abilities of NSCLC cells including H1755 and H2170. (a) qRT-PCR measured the transfection efficiency of circ_0017639 in H1755 and H2170 cells incorporated with circ_0017639. (b) CCK-8 assay and (c) EdU assay (scar bar = 50 μm) quantified the proliferation rate of H1755 and H2170 cells transfected with circ_0017639. (d, e) Transwell assay evaluated the migration and invasive property of the circ_0017639 overexpressing stably transfected H1755 and H2170 cells (scar bar = 50 μm). *P, **P, and ***P indicate P values less than 0.05, 0.01, and 0.001, accordingly.

An elevated expression of circ_0017639 promoted the proliferative, migratory, and invasive abilities of NSCLC cells including H1755 and H2170. (a) qRT-PCR measured the transfection efficiency of circ_0017639 in H1755 and H2170 cells incorporated with circ_0017639. (b) CCK-8 assay and (c) EdU assay (scar bar = 50 μm) quantified the proliferation rate of H1755 and H2170 cells transfected with circ_0017639. (d, e) Transwell assay evaluated the migration and invasive property of the circ_0017639 overexpressing stably transfected H1755 and H2170 cells (scar bar = 50 μm). *P, **P, and ***P indicate P values less than 0.05, 0.01, and 0.001, accordingly.

Circ_0017639 knockdown repressed the proliferative, migratory, and invasive abilities of NSCLC cells

The functional role of circ_0017639 was further confirmed with gene silencing (sh-circ_0017639) transfected into the A549 and H1299 cells. qRT-PCR results demonstrated that, sh-circ_0017639 incorporation, upon NSCLC cells exhibited a drastic decrease in circ_0017639 levels, relative to the si-NC group (P < 0.001; Figure 3a). CCK-8 and EdU assays also revealed that circ_0017639 knockdown markedly repressed the proliferation rate of cells including A549 and H1299 (P < 0.01 and 0.001, accordingly, Figure 3b, and 3c). The transwell assays results showed that circ_0017639 knockdown strongly suppressed the migratory, and invasive abilities of A549 and H1299 cells (P < 0.01 and 0.001, accordingly, Figure 3d and 3e). Our findings suggest that circRPPH1 circ_0017639 downregulates the cell growth, migration as well as invasion of NSCLC.
Figure 3.

Sh-circ_0017639 repressed the proliferative, migratory, and invasive features of NSCLC cells including A549 and H1299. (a) qRT-PCR determined the transfection efficiency of circ_0017639 in A549 and H1299 cells incorporated with sh-circ_0017639. (b) CCK-8 assay and (c) EdU assay (scar bar = 50 μm) quantified the cell proliferation of sh-circ_0017639-incorporated cells i.e., A549 and H1299. (d, e) Transwell assays evaluated the migration and invasive ability of the sh-circ_0017639 transfected A549 and H1299 cells (scar bar = 50 μm). **P and ***P indicate P values less than 0.01, and 0.001, accordingly.

Sh-circ_0017639 repressed the proliferative, migratory, and invasive features of NSCLC cells including A549 and H1299. (a) qRT-PCR determined the transfection efficiency of circ_0017639 in A549 and H1299 cells incorporated with sh-circ_0017639. (b) CCK-8 assay and (c) EdU assay (scar bar = 50 μm) quantified the cell proliferation of sh-circ_0017639-incorporated cells i.e., A549 and H1299. (d, e) Transwell assays evaluated the migration and invasive ability of the sh-circ_0017639 transfected A549 and H1299 cells (scar bar = 50 μm). **P and ***P indicate P values less than 0.01, and 0.001, accordingly.

Circ_0017639 activated the PI3K/AKT signaling cascade in NSCLC cells

To begin with, whether circ_0017639 has any effects on PI3K/AKT signaling pathway was investigated. We explored the circ_0017639-mediated regulation of the phosphorylation status of the PI3K and AKT core proteins involved in PI3K/AKT signaling axis. As depicted in the Western blot, the ratio of phosphorylated versus unphosphyrated forms of PI3K, and AKT were increased in circ_0017639 group than the vector group (Figure 4a, p < 0.001). However, these were lowered in the sh-circ_0017639 group (P < 0.01 and P < 0.001, accordingly, Figure 4b). Subsequently, to verify whether the PI3K/AKT signaling pathway was required for the oncogenic effects of circ_0017639, A549 cells were transfected with sh-circ_0017639 and then the cells were incubated with SC97 (the AKT activator) 24 hours after transfection. It was revealed that SC97 reactivated the AKT signaling pathway following the silencing of circ_0017639 in A549 cells, as indicated by the increase of p-AKT/AKT (Figure 4c). Collectively, these data suggests that circ_0017639 activates the PI3K/AKT signaling axes in NSCLC cells. Furthermore, it was also found that SC97 reversed the impact of the sh-circ_0017639 on cell’s proliferation rate (P < 0.01, Figure 4d, 4e), migration (P < 0.05, figure 4f) and invasion (P < 0.05, Figure 4g). These results suggested that the effects of the sh-circ_0017639 on the tumorigenesis of A549 cells by the inactivation of the PI3K/AKT signaling cascade.
Figure 4.

Indicates that activation of PI3K/AKT could reverse the effects of the sh-circ_0017639 on NSCLC cells. Evaluation of proteins contributed in the PI3K/AKT signaling cascade in cells (H1755) transfected with circ_0017639 (a) and in the sh-circ_0017639 transfected A549 cells (b) via Western blot. (c) A549 cells were transfected with sh-circ_0017639, and treated with or without SC97 for 24 hours. (d) CCK-8 assay and (e) EdU assay (scar bar = 50 μm) quantified the cell proliferation of sh-circ_0017639+ SC97-incorporated A549 cells. (f, g) Transwell assays evaluated the invasive ability of the sh-circ_0017639+ SC97 transfected A549 cells (scar bar = 50 μm). *P, **P, and ***P indicate P values less than 0.05, 0.01, and 0.001, accordingly.

Indicates that activation of PI3K/AKT could reverse the effects of the sh-circ_0017639 on NSCLC cells. Evaluation of proteins contributed in the PI3K/AKT signaling cascade in cells (H1755) transfected with circ_0017639 (a) and in the sh-circ_0017639 transfected A549 cells (b) via Western blot. (c) A549 cells were transfected with sh-circ_0017639, and treated with or without SC97 for 24 hours. (d) CCK-8 assay and (e) EdU assay (scar bar = 50 μm) quantified the cell proliferation of sh-circ_0017639+ SC97-incorporated A549 cells. (f, g) Transwell assays evaluated the invasive ability of the sh-circ_0017639+ SC97 transfected A549 cells (scar bar = 50 μm). *P, **P, and ***P indicate P values less than 0.05, 0.01, and 0.001, accordingly.

Circ_0017639 knockdown suppressed the xenograft tumor growth in vivo

To elucidate a possible circ_0017639-mediated regulation of xenograft tumor growth, nude mice were inoculated with sh-circ_0017639-incorporated A549 cells. The intratumoral administration of lentiviral vector with sh-circ_0017639 strongly suppressed tumor growth (Figure 5a), tumor volume (Figure 5b) and weight (Figure 5c) in sh-circ_0017639 group than that of sh-NC incorporation (P < 0.05, 0.01, and 0.001, accordingly). Furthermore, Ki-67 protein as the cellular marker for the cell proliferation, was found to be diminished in the tumor of sh-circ_0017639 group by IHC assay (Figure 5d). WB also revealed the inactivation of PI3K/AKT cascade by sh-circ_0017639 in the xenograft tumor tissues (P < 0.001; Figure 5e). These results indicated that circ_0017639 knockdown attenuated xenograft tumor growth in vivo.
Figure 5.

Sh-circ_0017639 suppressed the growth of xenograft tumor in vivo. (a) Effect of sh-circ_0017639 on tumor growth in xenograft model. (b) Tumor volume of xenograft tumor mice in a time-dependent manner. (c) Following 4 weeks days, the mice were euthanized and then assessed the weight of the tumor. (d) Detection the effect of sh-circ_0017639 on Ki-67 protein expression by immunohistochemistry assay (scar bar = 50 μm, 200× and 400×). (e) Western blot examined the translational level of p-PI3K, PI3K, AKT, and p-AKT in the tumorous tissues from the mice. *P, **P, and ***P indicate P values less than 0.05, 0.01, and 0.001, accordingly.

Sh-circ_0017639 suppressed the growth of xenograft tumor in vivo. (a) Effect of sh-circ_0017639 on tumor growth in xenograft model. (b) Tumor volume of xenograft tumor mice in a time-dependent manner. (c) Following 4 weeks days, the mice were euthanized and then assessed the weight of the tumor. (d) Detection the effect of sh-circ_0017639 on Ki-67 protein expression by immunohistochemistry assay (scar bar = 50 μm, 200× and 400×). (e) Western blot examined the translational level of p-PI3K, PI3K, AKT, and p-AKT in the tumorous tissues from the mice. *P, **P, and ***P indicate P values less than 0.05, 0.01, and 0.001, accordingly.

Discussions

NSCLC is tumor with the widespread metastases and poor prognosis [1]. Due to poor prognosis in NSCLC patients, the diagnostic rate is very low at the initial stage [6]. Thus, finding new biological targets to distinguish high-risk individuals from asymptomatic patients is critical. As we know, in comparison to linear RNA molecules, circRNAs are relatively more stable as they are not vulnerable to RNA exonuclease or RNase R destruction [24]. Circular RNAs from eukaryotic cells are stable in cells, and most exonic circular RNAs exhibit a half-life more than 48 h [25]. Evidence suggests that circRNAs work as tumor growth suppressors or oncogenes in different types of carcinomas, such as NSCLC. Given circRNAs’ role, they can serve as considerable biomarkers [26-30]. Previous study has also found circ_0017639 is up-regulated in lung cancer tissue [15]. In this study, an elevated expression of circ_0017639 was observed in NSCLC cells and tissues (A549, H1299, H1755 and H2170) compared with controls. Subsequently, the role of circ_0017639 was evaluated in NSCLC and it has been revealed that an elevated expression of circ_0017639 enhanced the proliferative, migratory, and invasive potential of NSCLC cells, while the opposing effect was indicated by circ_0017639 knockdown. We finally provided a proof for circ_0017639 as the molecular regulator of NSCLC signaling pathway, namely, PI3K/AKT. The circ_0017639 expression was considerably elevated in NSCLC cells in vitro. Additionally, an elevated expression of circ_0017639 could induce the migratory and invasive potential of cells (H1755 and H2170), while circ_0017639 knockdown had the opposite effects on cells (A549 and H1299). The effects of circ_0017639 on the tumorigenesis of NSCLC were also studied in a xenograft mouse model, and circ_0017639 knockdown suppressed the growth of NSCLC tumor in vivo. The earlier study revealed that circ_0017639 has been considerably elevated in GC cells, while decreased expression of circ_0017639 attenuated the proliferative and migratory abilities of GC [13]. In line with the previous studies, our data suggested that circ_0017639 may work as an oncogene to affect the development of NSCLC. To our knowledge, the role of circ_0017639 has not been investigated so far and remains elusive. Here, we also investigated the molecular mechanism of circ_0017639 in the NSCLC progression. The PI3K/AKT signaling cascade is a strong regulator of both tumorigenesis and progression of NSCLC [31]. For example, PI3K/AKT can also serve as a tumor promoter when FGF21 takes part in NSCLC [32]. GINS2 can promote the migration, proliferation, and EMT of NSCLC cells via modulating PI3K/AKT [33]. Thus, the inhibitor of PI3K/AKT signaling pathway demonstrated potential antitumor activities for NSCLC. In line with the results of previous studies, SC97 is the AKT activator, and SC97 reactivate the AKT signaling pathway after 24 hours transfection [34]. In our study, we found that circ_0017639 could regulate the phosphorylation levels of PI3K, and AKT proteins after transfection of circ_0017639 overexpression or sh-circ_0017639. In addition, SC97 reversed the inhibitory impact of the circ_0017639 knockdown on proliferative, migratory, and invasive abilities of tumor progression in NSCLC cells. To the best of our knowledge, the current study indicates that the circ_0017639 knockdown leads to the inhibition of the PI3K/AKT cascade. Therefore, the underlined study revealed that circ_0017639 drives NSCLC progression by affecting the PI3K/AKT signaling cascade. Previous investigations found that miR-224-5p was a circ_0017639 downstream target [13], and the increased expression of miR-224-5p was proved to inhibit cell proliferation in NSCLC [35,36]. PIK3R3, a regulatory subunit of phosphatidylinositol 3-kinase (PI3K) had been reported to be aberrantly expressed in some types of cancers, and the promotive effects of PIK3R3 on cell proliferation, migration, and invasion of several cancers, including NSCLC [37]. Upregulating miR-224-5p decreased expressions of PIK3R3 and AKT3, and subsequently blocked PI3K/AKT pathway thus leading to obstruction of proliferation, migration, and invasion of uveal melanoma [38]. Thus, in our study, we speculated the circ_0017639 drives NSCLC progression by affecting the PI3K/AKT signaling pathway via targeting the miR-224-5p. Of course, this requires further experimental verification. In the further experiment, more efforts should be made to completely outline the mechanisms of circ_0017639 as a tumor oncogene.

Conclusions

We showed that circ_0017639 considerably contributes to the NSCLC development. High circ_0017639 expression was found in NSCLC cells and tissues. It was revealed that an elevated expression of circ_0017639 enhanced the proliferative, migratory, and invasive potential of NSCLC cells through triggering PI3K/AKT signaling cascade, which may provide the experimental evidence for the further targeted intervention therapy of NSCLC. Click here for additional data file.
  38 in total

1.  Overexpression of miR-25 is associated with progression and poor prognosis of cholangiocarcinoma.

Authors:  Haibo Liu; Lujuan Ma; Jian Wang
Journal:  Exp Ther Med       Date:  2019-08-02       Impact factor: 2.447

2.  The biogenesis and emerging roles of circular RNAs.

Authors:  Ling-Ling Chen
Journal:  Nat Rev Mol Cell Biol       Date:  2016-02-24       Impact factor: 94.444

3.  GINS2 facilitates epithelial-to-mesenchymal transition in non-small-cell lung cancer through modulating PI3K/Akt and MEK/ERK signaling.

Authors:  Xiangli Liu; Lei Sun; Song Zhang; Shuguang Zhang; Wenya Li
Journal:  J Cell Physiol       Date:  2019-11-04       Impact factor: 6.384

4.  Hsa_circ_0017639 expression promotes gastric cancer proliferation and metastasis by sponging miR-224-5p and upregulating USP3.

Authors:  Bojing Li; Mingming Jin; Fanfan Cao; Jie Li; Jian Wu; Limin Xu; Xinghui Liu; Yihai Shi; Weichang Chen
Journal:  Gene       Date:  2020-05-04       Impact factor: 3.688

Review 5.  A view of pre-mRNA splicing from RNase R resistant RNAs.

Authors:  Hitoshi Suzuki; Toshifumi Tsukahara
Journal:  Int J Mol Sci       Date:  2014-05-26       Impact factor: 5.923

6.  MiR-3188 Inhibits Non-small Cell Lung Cancer Cell Proliferation Through FOXO1-Mediated mTOR-p-PI3K/AKT-c-JUN Signaling Pathway.

Authors:  Chunyan Wang; Enqi Liu; Wen Li; Jue Cui; Tongxiang Li
Journal:  Front Pharmacol       Date:  2018-12-11       Impact factor: 5.810

7.  Circ-SFMBT2 promotes the proliferation of gastric cancer cells through sponging miR-182-5p to enhance CREB1 expression.

Authors:  Handong Sun; Pengcheng Xi; Zhiqiang Sun; Qian Wang; Bin Zhu; Jian Zhou; Hui Jin; Wubin Zheng; Weiwei Tang; Hongyong Cao; Xiufeng Cao
Journal:  Cancer Manag Res       Date:  2018-11-16       Impact factor: 3.989

8.  Circular RNA hsa_circ_0008305 (circPTK2) inhibits TGF-β-induced epithelial-mesenchymal transition and metastasis by controlling TIF1γ in non-small cell lung cancer.

Authors:  Longqiang Wang; Xin Tong; Zhengyu Zhou; Shengjie Wang; Zhe Lei; Tianze Zhang; Zeyi Liu; Yuanyuan Zeng; Chang Li; Jun Zhao; Zhiyue Su; Cuijuan Zhang; Xia Liu; Guangquan Xu; Hong-Tao Zhang
Journal:  Mol Cancer       Date:  2018-09-27       Impact factor: 27.401

Review 9.  Circular RNAs in cancer: opportunities and challenges in the field.

Authors:  L S Kristensen; T B Hansen; M T Venø; J Kjems
Journal:  Oncogene       Date:  2017-10-09       Impact factor: 9.867

10.  Circular RNA circ_0001287 inhibits the proliferation, metastasis, and radiosensitivity of non-small cell lung cancer cells by sponging microRNA miR-21 and up-regulating phosphatase and tensin homolog expression.

Authors:  Chuan-Cui Zhang; Yuhua Li; Xian-Zhen Feng; Dian-Bo Li
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

View more
  2 in total

1.  Circular RNA CDK6 suppresses cervical cancer proliferation and metastasis by sponging miR-449a.

Authors:  Peilin Zhong; Aihua Guo; Linhua Wang; Xiurong Lin; Mei Feng
Journal:  Bioengineered       Date:  2022-03       Impact factor: 3.269

2.  Hsa_circ_0017639 regulates cisplatin resistance and tumor growth via acting as a miR-1296-5p molecular sponge and modulating sine oculis homeobox 1 expression in non-small cell lung cancer.

Authors:  Feiyun Chang; Jiali Li; Quan Sun; Shuqing Wei; Yongming Song
Journal:  Bioengineered       Date:  2022-04       Impact factor: 6.832

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.