Magnaporthe oryzae as an expression host for the production of the unspecific peroxygenase AaeUPO from the basidiomycete Agrocybe aegerita.

The filamentous fungus Magnaporthe oryzae has the potential to be developed as an alternative platform organism for the heterologous production of industrially important enzymes. M. oryzae is easy to handle, fast-growing and unlike yeast, posttranslational modifications like N-glycosylations are similar to the human organism. Here, we established M. oryzae as a host for the expression of the unspecific peroxygenase from the basidiomycete Agrocybe aegerita (AaeUPO). Note, UPOs are attractive biocatalysts for selective oxyfunctionalization of non-activated carbon-hydrogen bonds. To improve and simplify the isolation of AaeUPO in M. oryzae, we fused a Magnaporthe signal peptide for protein secretion and set it under control of the strong EF1α-promoter. The success of the heterologous production of full-length AaeUPO in M. oryzae and the secretion of the functional enzyme was confirmed by a peroxygenase-specific enzyme assay. These results offer the possibility to establish the filamentous ascomycete M. oryzae as a broad applicable alternative expression system.

INTRODUCTION

Almost 20 years ago, the filamentous fungus Magnaporthe oryzae was established as a model organism for the investigation of the molecular basis of plant/pathogen interactions, infection‐related differentiation processes, and fungal mitogen‐activated protein kinases (MAPK) signaling by the pioneers: Dean, Talbot, Valent, and Xu (Dean et al., 2005, 2012). In the last few years, we worked intensively with this organism to unravel signal transduction mechanisms and fungicide action in a phosphorelay system called the high osmolarity glycerol (HOG) pathway (Bohnert, Antelo, et al., 2019; Bohnert et al., 2019; Jacob et al., 2014, 2015). M. oryzae is easy to cultivate in the laboratory, and bioinformatics pipelines as well as efficient transformation systems for directed genetic manipulation, including the possibility of generating “multistage mutants” as multiple selection markers, are established. A major advantage of M. oryzae compared to established yeasts’ expression systems is that posttranslational modifications, such as N‐glycosylation, are in the standard repertoire of filamentous fungi whereas hyper‐glycosylation is not a problem (Maras et al., 1999; Punt et al., 2002; Salovuori et al., 1987). Yeasts often perform hyper‐glycosylation, and invariably hyper‐mannosylated glycoproteins might not be converted into a functional enzyme. Furthermore, the differences of chaperones and different post‐translational modifications in yeasts (disulfide bridge, and N‐terminal and C‐terminal processing) are important hurdles that must be circumvented (Carro et al., 2019) (Gomez de Santos et al., 2020). To extend the repertoire for heterologous expression systems for industrial applications, we established M. oryzae as an expression host for the unspecific peroxygenase from the basidiomycete Agrocybe aegerita (AaeUPO), which is under the most important industrial relevant glycoproteins (Aranda & del Carmen, 2019). The unspecific peroxygenases (UPO, EC 1.11.2.1) belong to peroxide‐using enzymes that are of considerable interest due to their wide range of potential biotechnological applications (Burek et al., 2019). The UPOs are amongst the most attractive biocatalysts for the regioselective and stereoselective introduction of oxygen into organic molecules (Molina‐Espeja et al., 2015). They are compact proteins with a thiolate axial ligand of the pivotal Fe3+ that controls the heme domain. The UPOs secreted by fungi represent an intriguing enzyme type that selectively transfers peroxide‐borne oxygen with high efficiency to diverse substrates including unactivated hydrocarbons (Hofrichter & Ullrich, 2014). Also, UPOs have been shown to modify pharmacological compounds by mimicking the role of human liver P450 monooxygenases, including O‐dealkylations and hydroxylations, thereby simulating drug metabolism (Gomez de Santos et al., 2019). And, UPOs perform these reactions under mild conditions with only H2O2 as the oxygen source (Sigmund & Poelarends, 2020). The rapidly expanding field of environmentally friendly and sustainable chemistry bears a great potential to promote biocatalysts for selective oxyfunctionalizations, such as these hydrogen peroxide‐utilizing enzymes. Consequently, further optimization of their properties is required for their effective use in industrial applications. Although thousands of genes encoding (hypothetical) UPOs have been identified in the sequences of fungal genomes, only a few UPO enzymes have been experimentally characterized to date (Linde et al., 2020). That's down to the fact that the challenges as mentioned above associated with the functional expression in heterologous hosts like yeasts are extremely difficult to solve (Martínez et al., 2017). Nevertheless, there have been some works that address protein engineering of UPOs. Many of them without fully satisfactory yields and activities (Molina‐Espeja et al., 2016; Mate et al., 2017; Gomez de Santos et al., 2018; Knorrscheidt et al., 2021), although a few also delivered good results (Kinner et al., 2021) (Hofrichter et al., 2020).

Therefore, the expression of functional full‐length AaeUPO in M. oryzae can be regarded as highly technical and industrially relevant. Even more important is that such an expression system can potentially be broadly applied for the expression of further eukaryotic (heme)‐enzymes and glycoproteins.

MATERIALS AND METHODS

Strains andculture/growth conditions

The fungal strain used in this study was Magnaporthe oryzae (Fungal Genetics Stock Center, Kansas City, USA) (Jacob et al., 2015). The strain was grown at 26°C on complete medium (CM) at pH 6.5, agar (2%) containing per liter: glucose (10 g), yeast extract (1 g), peptone (2 g), casamino acids (1 g), nitrate salt solution (50 mL; containing per liter: NaNO3 (120 g), KCl (10.4 g), KH2PO4 (30.4 g), MgSO4 (10.4 g) × 7 H2O) and a trace element solution (1 ml; containing per liter: ZnSO4 (22 g) × 7 H2O, H3BO3 (11 g), MnCl2 (5 g) × 4 H2O, FeSO4 (5 g) × 7 H2O, CoCl2 (1.7 g) × 6 H2O, CuSO4 (1.6 g) × 5 H2O, Na2MoO4 (1.5 g) × 2 H2O and Na2EDTA (50 g), at pH 6.5 adjusted by 1 M KOH). Minimal medium (pH 6.5) contains per liter: glucose (10 g), a 0.01% biotin solution (0.25 ml), nitrate salt solution (50 ml), a trace element solution (1 ml) and a 1% thiamine dichloride solution (1 ml). All chemicals used were pa quality unless otherwise stated.

To produce AaeUPO, the production strain MoEF1::AaeUPO(SP) was grown at 26°C and 120 rpm in a 5 L glass flask in 2.5 L liquid CM (+30 µM hemin) for 7 days.

DNA manipulations, construction of the expression vector, and fungal transformation

The DNA of Magnaporthe oryzae was isolated from mycelium of three‐day‐old liquid cultures (grown in CM at 26°C and 120 rpm) using the DNeasy® plant mini Kit (Qiagen GmbH, Hilden, Germany), following the manufacturer's instructions for the purification of DNA from plants and filamentous fungi. The DNA manipulation followed standard procedures (Green & Sambrook, 2012). NEB® 10‐ß Competent Escherichia coli strains (High Efficiency) were used for the routine bacterial transformations and construction of plasmids. Fungal transformation of M. oryzae was conducted using Agrobacterium tumefaciens‐mediated transformation (ATMT). The detailed procedures followed those described previously (Odenbach et al., 2007). To generate the expression mutant MoEF1::AaeUPO(SP), the plasmid used for fungal transformation is based on a backbone of a binary Agrobacterium‐compatible vector pSJ + GFP(BAR) (Bohnert, Antelo, et al., 2019). The mutants were generated by using a glufosinate‐ammonium resistance (modified bialaphos resistance gene, BAR). The selection of transformants resistant to glufosinate‐ammonium was performed by using 100 µg ml−1 of the antibiotic in a minimal medium. The plasmid used for fungal transformation of the Magnaporthe wildtype strain (MoWT) was generated by the Gibson Assembly® cloning method (Gibson et al., 2009). The 8205 bp expression‐plasmid pSJ + MoEF1::AaeUPO(SP) was generated by using the NcoI/BsrGI‐restricted pSJ + GFP(BAR) as backbone. The cDNA sequence of AaeUPO was amplified from the plasmid pUC57_AaeUPOcDNA using the primer pair SJ‐904/SJ‐839. With this primer pair, the signal peptide for protein secretion of the gene MGG_08253 (AAGTTCCTCACCCCGCTCGCCGCCCTTCTCAGCACCGCCTCGGCGGCC) was cloned directly in front of the AaeUPO sequence to be expressed. The signal peptide of the gene MGG_08253 was selected because the corresponding protein is present in large quantity in the secretome of M. oryzae (Antelo/IBWF, unpublished results). The start codon (ATG) from the AaeUPO to be expressed is removed and placed in front of the MGG_08253 signal‐peptide (Figure 1).

FIGURE 1

Schematic representation of the expression cassette of the plasmid pSJ + MoEF1::AaeUPO(SP). The coding sequence for the strong Magnaporthe own promoter EF1α is followed by the ATG‐modified secretion signal peptide sequence (from MGG_08253) and subsequently by the cDNA‐sequence of AaeUPO from Agrocybe aegerita. The NOS terminator (terminator of the nopaline synthase gene from A. tumefaciens) was introduced at the 3′end to stop translation directly followed by the trpC + BAR glufosinate‐ammonium resistance gene from pCB1635 (Sweigard et al., 1997). The primer pair SJ‐1095/1096 indicates the location of the DIG‐probe for southern blot analysis

Sequence details can be found in the supplementary section and the primers used are listed in Table 1. The accurate assembly of the expression plasmid was confirmed by sequencing. Finally, the plasmid pSJ + MoEF1::AaeUPO(SP) was used to transform MoWT via ATMT, resulting in the mutant strains MoEF1::AaeUPO(SP). The integration into the genome was confirmed by southern blot analysis (Figure A1).

TABLE 1

List of oligonucleotides used in this study

Name	Sequence (5′→3′)
SJ − 904 (SP + AaeUPO1‐for2)	acattatcatcaaaaagagagcaccaaaccgccacatgaagttcctcaccccgctcgccgcccttctcagcaccgcctcggcggccAAATATTTTCCCCTGTTCCCAACCTTG
SJ − 839 (AaeUPO1‐rev)	acgatctgcagccgggcggccgctttacttTCAATCTCGCCCGTATGGGA
SJ − 1095 (DIG‐AaeUPO1‐for)	CTCCGCGCAAAACTTTG
SJ − 1096 (DIG‐AaeUPO1‐rev)	GAGTGTTGGGATTATAGCG

Protein purification

Culture broth that exhibited activity in the NBD assay (see below) was concentrated (approximately 20‐fold) and dialyzed against 10 mM potassium phosphate buffer pH 7 by ultrafiltration over a 10 kDa cutoff membrane (Sartorius Vivaflow 200, PES, 10 kDa). The sample exhibited an NBD activity of 1.3 U ml−1. The sample was applied to an FPLC system (Knauer Azura, Berlin, Germany) equipped with a HiPrep DEAE FF 16/10 column (GE Healthcare, Solingen, Germany) and protein was eluted with a NaCl gradient from 0 to 1 M (in 10 mM potassium phosphate pH7) over four column volumes with a flow rate of 5 ml min−1. Fractions with significant heme‐specific absorption (410 nm) were probed for enzyme activity using the NBD assay and visualized via SDS‐PAGE.

Enzymatic assay

Enzymatic activity was determined using 5‐nitro‐1,3‐benzodioxole (NBD) as a substrate (Poraj‐Kobielska et al., 2012). Note, NBD assays were carried out in 1 ml PMMA cuvettes using a Shimadzu UV‐1800 photometer. The assay consisted of 550 µl 100 mM potassium phosphate buffer pH 7, 100 µl 5 mM NBD in acetonitrile, 200 µl H2O, 50 µl 20 mM H2O2, and 100 µl sample. Absorption was measured at 425 nm. Product formation was calculated with an extinction coefficient of 9700 M−1 cm−1.

RESULTS AND DISCUSSION

Heterologous expression of AaeUPO in Magnaporthe oryzae

The cDNA sequence of AaeUPO was fused to a Magnaporthe‐specific signal peptide for secretion and we integrated the modified sequence into the genome of M. oryzae under control of a constitutively strong Magnaporthe‐specific promoter, EF1‐α (Figure 1).

The correct integration of multiple MoEF1::AaeUPO(SP)‐constructs into the fungal genome and consequently, the molecular modification was confirmed by southern blot analysis of the mutant strain MoEF1::AaeUPO(SP) (Figure A1). The accurate expression and translation of the recombinant basidiomycetous DNA as well the secretion of the functional enzyme AaeUPO was verified in a specific assay using 5‐nitro‐1,3‐benzodioxole (NBD assay, (Poraj‐Kobielska et al., 2012) (Figure 2).

FIGURE 2

Purification of AaeUPO produced in M. oryzae. Purification was performed from the culture broth via FPLC on a HiPrep DEAE FF 16/10 column using a NaCl gradient. Enzyme activity (turquoise bars) was determined using NBD as substrate. Corresponding fractions (F1‐F11) were analyzed via SDS‐PAGE (insert). The lanes of the SDS gel contain (from left to right) molecular markers, fractions 1–11. The arrow indicates the protein bands corresponding to the theoretical molecular weight of AaeUPO

The enzyme was purified from the supernatant of a shake flask culture by ion‐exchange chromatography. Fractions with increased absorbance at 410 nm, characteristic of heme‐containing proteins, corresponded to the fractions with peroxygenase activity when NBD was used as substrate. The culture broth of MoEF1::AaeUPO(SP) was concentrated (approximately 20‐fold) and the concentrated sample exhibited an NBD activity of 1.3 U/ml. The control samples (i.e. MoWT) did not show any enzyme expression at all. No peroxygenase activity was detectable in other fractions (Figure 2). By SDS‐PAGE, a predominant protein band with an apparent molecular weight slightly below 55 kDa could be visualized, among others. This corresponds approximately to the molecular weight of the glycosylated enzyme homologously produced in Agrocybe aegerita (46 kDa) (Ullrich et al., 2004). The UPO protein engineers have a long and diverse wish list, which has not yet been addressed comprehensively in yeast expression systems: the improvement of the turnover numbers, the modification of selectivity, avoid overoxidation reactivities, the removal of the unwanted peroxidase activity during oxyfunctionalizations, to improve oxidative stability as well as its performance in the presence of organic co‐solvents and/or at high temperatures (Hobisch et al., 2020). A major positive aspect of M. oryzae is that posttranslational modifications, such as N‐glycosylation, are correctly carried out by filamentous fungi (Maras et al., 1999; Punt et al., 2002; Salovuori et al., 1987). Yeasts sometimes perform hyper‐glycosylation, and invariably hyper‐mannosylated glycoproteins might not be converted into higher fungus type glycoproteins such as AaeUPO.

As mentioned above, for all these goals, M. oryzae appears to be optimally suited to functionally produce the AaeUPO enzyme to sculpture its properties by molecular manipulation. In conclusion, this report is the starting point to improve the use of non‐specific peroxygenases in sustainable and resource‐efficient chemistry in a much more flexible way than before.

The AaeUPO is one of the important enzymes for industrial biotechnology (Molina‐Espeja et al., 2015). Nevertheless, AaeUPO has not been subjected to successful heterologous production in a filamentous fungus to date (Hobisch et al., 2020). Despite their broad presence in the fungal kingdom, only a handful of UPOs have been characterized so far, and almost nothing substantial is known on their biological function (Bormann et al., 2021). Furthermore, the reliable heterologous expression of UPOs remains challenging, despite all progress in this field (Hofrichter et al., 2020). Missing chaperones along with different post‐translational modifications (glycosylation, disulfide bridge, N‐terminal and C‐terminal processing) among natural and heterologous hosts are high hurdles that must be avoided (Hobisch et al., 2020). Here, we demonstrate that the filamentous fungus Magnaporthe oryzae is applicable as a suitable platform organism to functionally produce this specialized eukaryotic glycoprotein or further heme enzymes.

CONFLICT OF INTEREST

None declared.

AUTHOR CONTRIBUTIONS

Stefan Jacob: Conceptualization (equal); Investigation (equal); Methodology (equal); Project administration (equal); Resources (equal); Supervision (equal); Writing‐original draft (equal). Sebastian Bormann: Conceptualization (equal); Data curation (equal); Formal analysis (equal); Methodology (equal); Project administration (equal); Writing‐original draft (equal). Michael Becker: Investigation (equal); Methodology (equal); Visualization (equal). Luis Antelo: Conceptualization (equal); Data curation (equal); Investigation (equal); Methodology (equal); Supervision (equal); Writing‐review & editing (equal). Dirk Holtmann: Conceptualization (equal); Funding acquisition (equal); Methodology (equal); Project administration (equal); Resources (equal); Supervision (equal); Writing‐review & editing (equal). Eckhard Thines: Conceptualization (equal); Funding acquisition (equal); Project administration (equal); Resources (equal); Supervision (equal); Writing‐review & editing (equal).

ETHICS STATEMENT

None required.