Chang Xiong1,2, Zhongfeng Sun3, Jinjin Yu1,2, Yaying Lin1,2. 1. Department of Obstetrics and Gynecology, Affiliated Hospital of Jiangnan University, Wuxi, China. 2. Wuxi Medical College, Jiangnan University, Wuxi, China. 3. Department of Gynecology, Maternal and Child Health Hospital of Hubei Province, Wuhan, China.
Abstract
BACKGROUND: Of gynecologic malignancies, ovarian cancer is the leading cause of death, mainly due to the lack of sensitive tumor markers, which means it almost always presents at an advanced stage. Exosome Component 4 (EXOSC4) is involved in RNA degradation, but its role in epithelial ovarian cancer (EOC) is unclear. METHODS: The expression levels of EXOSC4 in EOC and normal ovarian tissue specimens were determined by immunohistochemical staining. The overall survival (OS) and progression-free survival (PFS) of patients with EOC were evaluated after patients were classified into high and low EXOSC4 expression groups, and the Cox regression model was established to identify independent predictors of patient prognosis. The effects of EXOSC4 on proliferation, colony formation, migration, and invasion were examined in the SKOV-3 and HO8910 cell lines by lentivirus-mediated shRNA knockdown. Flow cytometry was used to detect cell cycle changes. The mRNA levels of cyclin D1, CDK4, and c-myc were detected by RT-PCR. The protein expression levels of β-catenin, cyclin D1, CDK4, c-myc, vimentin, N-cadherin, and E-cadherin were assessed by western blot. Wnt/β-catenin activation was measured by TCF/LEF reporter assay. RESULTS: EXOSC4 was significantly elevated in EOC tissues and cell lines. High EXOSC4 expression was correlated with the International Federation of Gynecology and Obstetrics (FIGO) stage and pathological grade, and identified as an independent predictor of shorter OS and PFS. EXOSC4 knockdown suppressed proliferation, migration, and invasion in EOC cell lines. Cells were arrested at G0/G1 phase after EXOSC4 knockdown. The mRNA levels of cyclin D1, CDK4, and c-myc were decreased. β-catenin, cyclin D1, CDK4, c-myc, vimentin, and N-cadherin protein expression levels were reduced, while those of E-cadherin was increased. Wnt/β-catenin activity was suppressed after the EXOSC4 knockdown. CONCLUSIONS: EXOSC4 is involved in EOC. Knockdown of EXOSC4 can inhibit the proliferation, migration, and invasion ability of EOC by suppressing the Wnt pathway. EXOSC4 is expected to be a novel biomarker and molecular target in EOC.
BACKGROUND: Of gynecologic malignancies, ovarian cancer is the leading cause of death, mainly due to the lack of sensitive tumor markers, which means it almost always presents at an advanced stage. Exosome Component 4 (EXOSC4) is involved in RNA degradation, but its role in epithelial ovarian cancer (EOC) is unclear. METHODS: The expression levels of EXOSC4 in EOC and normal ovarian tissue specimens were determined by immunohistochemical staining. The overall survival (OS) and progression-free survival (PFS) of patients with EOC were evaluated after patients were classified into high and low EXOSC4 expression groups, and the Cox regression model was established to identify independent predictors of patient prognosis. The effects of EXOSC4 on proliferation, colony formation, migration, and invasion were examined in the SKOV-3 and HO8910 cell lines by lentivirus-mediated shRNA knockdown. Flow cytometry was used to detect cell cycle changes. The mRNA levels of cyclin D1, CDK4, and c-myc were detected by RT-PCR. The protein expression levels of β-catenin, cyclin D1, CDK4, c-myc, vimentin, N-cadherin, and E-cadherin were assessed by western blot. Wnt/β-catenin activation was measured by TCF/LEF reporter assay. RESULTS: EXOSC4 was significantly elevated in EOC tissues and cell lines. High EXOSC4 expression was correlated with the International Federation of Gynecology and Obstetrics (FIGO) stage and pathological grade, and identified as an independent predictor of shorter OS and PFS. EXOSC4 knockdown suppressed proliferation, migration, and invasion in EOC cell lines. Cells were arrested at G0/G1 phase after EXOSC4 knockdown. The mRNA levels of cyclin D1, CDK4, and c-myc were decreased. β-catenin, cyclin D1, CDK4, c-myc, vimentin, and N-cadherin protein expression levels were reduced, while those of E-cadherin was increased. Wnt/β-catenin activity was suppressed after the EXOSC4 knockdown. CONCLUSIONS: EXOSC4 is involved in EOC. Knockdown of EXOSC4 can inhibit the proliferation, migration, and invasion ability of EOC by suppressing the Wnt pathway. EXOSC4 is expected to be a novel biomarker and molecular target in EOC.
Ovarian cancer is among the most common gynecologic malignancies and a major cause of reproductive system cancer-related deaths in females (1). Epithelial ovarian cancer (EOC) is the primary pathological type and is diagnosed in approximately 90% of ovarian cancer cases (2). Despite significant advances in ovarian cancer treatment over recent decades, over 70% of patients are diagnosed at an advanced stage and have frequent relapses (3). Hence, efforts are required to identify key molecules involved in the pathogenesis of EOC, which could help with early detection and improve prognosis.The eukaryotic RNA exosome is a multi-protein intracellular complex with 3’→5’ exoribonuclease activity (4). Exosomes comprise nine core subunits and are involved in a series of intracellular RNA regulatory processes (5). Exosomes catalyze mRNA turnover and mediate mRNA decay in the cytoplasm, whereas they are involved in the regulation of rRNA, snoRNA, and snRNA maturation, and facilitate degradation of incorrectly processed pre-RNA in the nucleus (6, 7); hence, exosomes may contribute to gene silencing and regulation of non-coding RNA expression (8).Exosome Component 4 (EXOSC4, also named Rrp41), is a core subunit of the exosome and has numerous physiological and pathological functions in cells; it is required for the exosome stability and mRNA turnover in Hep-2 cells (9). Expression of EXOSC4 can efficiently suppress the growth inhibition of yeast on glucose medium (10). Further, EXOSC4 acts as an oncogene in the etiology and development of colorectal cancer (11). However, the relationship between EXOSC4 and EOC remains unclear. In the present study, the functions of EXOSC4 in EOC were explored, and we found that EXOSC4 promotes cell proliferation, migration, and invasion in EOC via the Wnt pathway.
Materials and Methods
Ethics Approval and Consent to Participate
The study was designed to adhere to the Helsinki Declaration strictly, and approved by the Ethics Committee of the Affiliated Hospital of Jiangnan University (no. LS2021001). Informed consent was obtained from each patient before surgery for the use of tissue samples.
Human EXOSC4 Data Analysis
EXOSC4 expression levels were analyzed in 426 ovarian serous cystadenocarcinomas and 88 normal ovarian tissues from The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) databases using Gene Expression Profiling Interactive Analysis (GEPIA2; http://gepia2.cancer-pku.cn/#index); the log 2 fold-change cutoff was set as 1, with a p-value cutoff of 0.01.
Patients and Tissue Samples
A total of 124 ovarian tissue samples, including 104 EOC and 20 normal ovaries, were obtained from patients who underwent surgery from January 2014 to December 2016 in the Gynecology Department at the Affiliated Hospital of Jiangnan University. Patients with EOC who received neoadjuvant chemotherapy before surgery were excluded from the study. More than two senior pathologists diagnosed all the EOC tissues, according to the WHO classification of Tumors of Female Reproductive Organs (2014). Patients were followed up according to the NCCN guidelines, and their progression-free survival (PFS) and overall survival (OS) were recorded.
Immunohistochemical Staining (IHC)
Tissue specimens were fixed with 10% neutral formalin, embedded in paraffin, and sectioned at 4 μm-thick. Sections were dewaxed, hydrated, and boiled in 10 mmol/L of citrate buffer (10 mmol/L, pH 6.0) for 20 min to retrieve the antigen. Next, sections were covered with 5% BSA for 10 min and then incubated with anti-EXOSC4 primary antibody (Abcam, ab66672, diluted 1:150) at 4°C overnight. Subsequently, sections were washed twice with phosphate-buffered saline (pH 7.4) and incubated with secondary antibody for 1 h. Final staining was conducted using a DAB chromogenic reagent kit (Beyotime, Institute of Biotechnology, Shanghai, China), following the manufacturer’s instructions. Two independent pathologists conducted IHC scoring under blinded conditions. The scoring system combined the intensity of the staining (0 = absent, 1 = weak, 2 = moderate, 3 = strong) and the proportion of positive cells (0 = 0–10%, 1 = 10%–25%, 2 = 26%–50%, 3 = 51%–75%, 4 = 76%–100%); final scores (range = 0–7) were calculated by taking the total of the two scores, and interpreted as follows: 0–3, low expression; 4–7, high expression.
Ovarian Cancer Cell Lines and Cell Culture
The EOC cell lines, SKOV-3 and HO8910, were purchased from the American Type Culture Collection (Manassas, VA, USA). The human ovarian immortalized non-tumorigenic ovarian epithelial cell line, IOSE80, was purchased from MINGJING BIOLOGY, Inc. (Shanghai, China). Cells were cultured in RPM1-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 100 μg/ml penicillin, and 100 μg/ml streptomycin. Cells were incubated in a 37°C, 5% CO2, saturated humidity incubator.
Construction and Transfection of Lentiviral Short Hairpin RNA (shRNA)
A lentiviral packaging plasmid, pFH-L, including a green fluorescent protein (GFP) tag, was purchased from GenePharma Co., Ltd. (Suzhou, China). The two shRNA sequences targeting the human EXOSC4 gene and the negative control (NC) sequence were as follows: shEXOSC4(S1), 5’-GGCCCTAGTGAACTGTCAATA-3’; shEXOSC4(S2), 5’-GCTGACGGCTCGGCCTACATT-3’; NC, 5’- TTCTCCGAACGTGTCACGT-3’, respectively. SKOV-3 and HO8910 cells (2 × 105 per well) were seeded in a 6-well culture plate for one day. Then, the lentiviral solution with 5 μg/ml polybrene was added, according to the manufacturer’s instructions (GenePharma, China). Twenty-four hours later, the culture medium containing lentiviral solution was replaced with a complete culture medium. After 72 h, cells were selected for stable expression of shRNA by treating with puromycin (10 μg/mL) for two weeks. The efficiency of shEXOSC4(S1) and shEXOSC4(S2) was validated by quantitative real-time PCR and western blot analyses.
Quantitative RT-PCR Assay
Total RNA was isolated from EOC cell lines using Trizol solution (Vazyme Biotech, Nanjing, China). Then, the RNA was reverse transcribed to cDNA using a cDNA Synthesis kit (RR036A, Takara Bio, Tokyo, Japan). Quantitative real-time PCR was conducted by SYBR Green PCR Master Mix (RR820A, Takara Bio, Tokyo, Japan) and performed on an Applied Biosystems ViiA 7 Dx instrument (Life Technologies Inc., Gaithersburg, MD, USA). Relative mRNA expressions were calculated using the 2-ΔΔCt method. Gene-specific primers are listed in
.
Table 1
Primers for qRT-PCR.
Gene
Primer
Sequence
EXOSC4
Forward
GCTCGGCCTACATTGAGCAG
Reverse
GGACTTACGGTCCCCATGTG
cyclinD1
Forward
CCATCCAGTGGAGGTTTGTC
Reverse
AGCGTATCGTAGGAGTGGGA
CDK4
Forward
CCCGAAGTTCTTCTGCAGTC
Reverse
GTCGGCTTCAGAGTTTCCAC
c-myc
Forward
CGGATTCTCTGCTCTCCTCG
Reverse
CCACAGAAACAACATCGATTTCTT
β-actin
Forward
GTGGACATCCGCAAAGAC
Reverse
AAAGGGTGTAACGCAACTA
Primers for qRT-PCR.
Western Blot Analysis
Total protein was collected from EOC cells using RIPA buffer (Beyotime, Institute of Biotechnology, Shanghai, China) and quantified with a BCA Protein Quantification Kit (Beyotime, Institute of Biotechnology, Shanghai, China). Proteins were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, Billerica, USA). Membranes were blocked with 5% nonfat milk and 0.1% Tween 20 in TBS, and incubated with corresponding primary antibody (Anti-EXOSC4 (ab66672, Abcam, Cambridge, UK), Anti-CDK4 (CST, Danvers, MA, US), Anti-Cyclin D1 (CST, Danvers, MA, US), Anti-Vimentin (CST, Danvers, MA, US), Anti-E-Cadherin (CST, Danvers, MA, USA), Anti-N-Cadherin (CST, Danvers, MA, USA), Anti-β-catenin (CST, Danvers, MA, US), Anti-c-myc (CST, Danvers, MA, USA), or Anti-β-actin (AF0003, Beyotime, Shanghai, China)) at 4°C overnight. Membranes were then incubated with matched secondary antibodies (Fcmacs, Nanjing, China), followed by examination using an ECL analysis kit (Beyotime, Institute of Biotechnology, Shanghai, China) and the Bio-Rad ChemiDoc XRS Imaging System (Bio-rad Laboratories Inc., California, USA).
CCK-8 Assay
Transfected cells in the log phase of growth were seeded into 96-well plates at a density of 3 × 103 cells/well and cultured for 8, 24, 48, 72, or 96 h. After incubation with CCK-8 reagent (Dojindo, Japan) for 2 h at 37°C, the optical density of each well was measured at 450 nm using a microplate reader (Hidex, Finland).
Colony Formation Assay
Transfected cells (800 per well) were seeded in 6−well plates and incubated for ten days. Crystal violet (0.05%; Solarbio, Haidian, Beijing, China) was applied to stain the cell colonies after fixing with 4% paraformaldehyde. Clones were counted under a microscope, and samples with ≥ 50 cells were regarded as positive clones. Results are expressed as the relative rate, compared with the NC group.
Cell Cycle Assay
Cells in the log growth phase were uniformly plated into six-well plates (5 × 105 cells/well), cultured until 80% confluence, prepared into single-cell suspensions, and fixed with 70% ethanol at 4°C overnight. Then, cells were washed with phosphate-buffered saline (PBS) twice, resuspended in 800 μl propidium iodide staining solution (Beyotime, Institute of Biotechnology, Shanghai, China), and incubated at room temperature for 30 min in the dark. The cell cycle distribution was determined on the FACS caliber system (BD Biosciences, CA, USA).
Scratch Assay
Transfected cells were seeded into a 6‐well plate (density, 5 × 105 cells per well) and cultured in a quiescent medium until 90% confluence. A sterile 10‐μl pipette tip was used to scratch a constant‐diameter stripe in each dish. Cultures were washed with PBS, and the medium was replaced with RPMI-1640 culture medium containing 1% FBS. Wounded areas were photographed at 0 and 24 h, and cell migration ability was calculated as the wound healing rate.
Transwell Assay
For migration assays, transwell chambers (Corning, Inc.) with 8 μm pores were incubated in 24-well plates containing FBS-free RPMI-1640 medium at 37°C for 1 h. Cells (1 × 105/150 μl) in FBS-free medium were added to the upper transwell chambers, while 500 μl culture medium supplemented with 10% FBS was added in the bottom wells. After incubated at 37°C for 18 h, migrating cells were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for 5 min. Images were captured under an inverted microscope, and migrated cells were counted. Invasion assays followed the same protocol as the migration assay, except that the Matrigel (BD Biosciences, San Jose, CA, USA) was coated onto the transwell chambers to form a matrix barrier.
Dual-Luciferase Reporter Assay
SKOV-3 and HO8910 cells transfected with lentivirus were seeded in 24-well plates with 60%-80% density overnight. Then, the plasmid containing LEF/TCF homologous sequences (TOP Flash) or mutation sequences (FOP Flash) and PGMR-TK Renilla vectors were transfected with Lipofectamine 2000 according to the manufacturer’s protocol. After 48 h incubation, the cells were lysed and added with Firefly luciferase reagent or Renilla luciferase reagent (Beyotime, Institute of Biotechnology, Shanghai, China). The OD values of TOP Flash (560 nm) and FOP Flash (465 nm) were measured using a microplate reader (Hidex, Finland). The TOP/FOP ratio was used to represent Wnt/β-catenin activity.
Statistical Analysis
Statistical analyses were performed using SPSS 24.0 software (IBM, Armonk, NY, USA). Image J software (National Institutes of Health, Bethesda, MD, USA) was used to analyze the grayscale intensity values of protein bands, the scratch wound area, and migratory and invasive cells. GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA) was used to draw figures. Each experiment was repeated at least three times. Continuous variables were compared using the student’s t test, and categorical variables were compared using the chi-square (χ2) test. OS and PFS survival curves were evaluated by the Kaplan-Meier method with the log-rank test. A Cox regression model was built to perform multivariate survival analysis of characteristics identified as significantly different by univariate analysis. P-values < 0.05 were considered statistically significant.
Results
EXOSC4 Levels Were Elevated in EOC Tissues and Cell Lines
The expression of EXOSC4 was significantly higher in EOC tissues than in normal ovarian tissues, according to the analysis of TCGA and GTEx datasets (
). To verify this finding, we performed IHC assays using samples collected at our hospital. EXOSC4 staining was distributed in the nucleus and cytoplasm, and mainly localized in ovarian epithelial cells (
). Further, EXOSC4 expression was significantly higher in ovarian cancer tissues than in normal ovarian tissues (
;
). Consistently, EXOSC4 was upregulated in the ovarian cancer cell lines, SKOV-3 and HO8910, compared with the normal ovarian cell line, IOSE80 (
). Furthermore, the clinical significance of EXOSC4 in EOC was evaluated. As shown in
, EXOSC4 expression was significantly associated with The International Federation of Gynecology and Obstetrics (FIGO) stage (
, p = 0.047) and pathology grade (p = 0.028); however, there were no significant correlations of EXOSC4 expression with age, histological type, or residual tumor status.
Figure 1
Elevated EXOSC4 was observed in EOC tissues and cell lines, and predicted poor outcomes. (A) EXOSC4 expression levels in EOC tissues compared with normal tissues in TCGA and GTEx datasets. (B) Comparison of EXOSC4 expression levels between EOC and normal ovarian tissues using IHC. (C) EXOSC4 expression levels in EOC cell lines (SKOV-3 and HO8910) and a human ovarian cell line (IOSE80) were detected by western blot assay, and its band quantification. (D) Representative IHC of EXOSC4 expression in normal ovarian epithelial and ovarian cancer tissue samples at different FIGO stages. Original magnification, × 100. (E) Kaplan-Meier curves for OS time in patients with EOC according to EXOSC4 levels. (F) Kaplan-Meier curves for PFS time in patients with EOC according to EXOSC4 levels. *p < 0.01, **p < 0.001.
Table 2
Association of EXOSC4 expression levels with features of epithelial ovarian tissue.
Feature
Number of patients
Expression (n, %)
P value
Low
High
Tissue type
0.007*
Normal
20
14 (70.0)
6 (30.0)
EOC
104
39 (37.5)
65 (62.5)
Age (years)
0.685
<50
48
17 (35.4)
31 (64.6)
≥50
56
22 (39.3)
34 (60.7)
FIGO stage
0.047*
I–II
26
14 (53.8)
12 (46.2)
III–IV
78
25 (32.1)
53 (67.9)
Histological type
0.570
Serous
83
30 (36.1)
53 (63.9)
Non-serous
21
9 (42.9)
12 (57.1)
Pathology grade
0.028
Low
32
17 (53.1)
15 (46.9)
High
72
22 (30.6)
50 (69.4)
Residual tumor
0.515
<1 cm
79
31 (39.2)
48 (60.8)
≥1 cm
25
8 (32.0)
17 (68.0)
*P < 0.05.
Elevated EXOSC4 was observed in EOC tissues and cell lines, and predicted poor outcomes. (A) EXOSC4 expression levels in EOC tissues compared with normal tissues in TCGA and GTEx datasets. (B) Comparison of EXOSC4 expression levels between EOC and normal ovarian tissues using IHC. (C) EXOSC4 expression levels in EOC cell lines (SKOV-3 and HO8910) and a human ovarian cell line (IOSE80) were detected by western blot assay, and its band quantification. (D) Representative IHC of EXOSC4 expression in normal ovarian epithelial and ovarian cancer tissue samples at different FIGO stages. Original magnification, × 100. (E) Kaplan-Meier curves for OS time in patients with EOC according to EXOSC4 levels. (F) Kaplan-Meier curves for PFS time in patients with EOC according to EXOSC4 levels. *p < 0.01, **p < 0.001.Association of EXOSC4 expression levels with features of epithelial ovarian tissue.*P < 0.05.
Overexpression of EXOSC4 Predicted Poor Clinical Outcomes in EOC
Clinical information from patients with EOC was reviewed to investigate the prognostic implications of EXOSC4 expression. Patients with EOC and high EXOSC4 expression had shorter OS compared with patients with low EXOSC4 expression (
, median OS: 30 vs. 39 months), as well as shorter PFS (
, median PFS: 16 vs. 22 months). In addition, univariate analysis revealed that advanced FIGO stage, high pathology grade, ≥ 1 cm residual tumor after surgery, and high EXOSC4 expression predicted poorer OS and PFS in patients with EOC (
). Furthermore, multivariate analysis found that high EXOSC4 level was an independent prognostic factor for patient OS and PFS (
).
Table 3
Univariate analysis to predict factors associated with PFS and OS.
Characteristic
Groups
P value
PFS
OS
Age (years)
≥50 vs. <50
0.636
0.858
FIGO stage
III–IV vs. I–II
0.016*
0.022*
Histological type
Serous vs. Non-serous
0.433
0.996
Pathology grade
High vs. Low
0.006*
0.009*
Residual tumor
<1 cm vs. ≥1 cm
<0.001*
<0.001*
EXOSC4 expression
High vs. Low
0.006*
0.015*
*P < 0.05.
Table 4
Multivariate analysis of factors predicting PFS and OS.
Characteristics
Groups
PFS
OS
P value
Hazard ratio (95% CI)
P value
Hazard ratio (95% CI)
FIGO stage
III–IV vs. I–II
0.121
–
0.034*
1.835 (1.046, 3.220)
Pathology grade
High vs. Low
0.013*
1.826 (1.135, 2.937)
0.041*
1.777 (1.024, 3.084)
Residual tumor
<1 cm vs. ≥1 cm
<0.001*
0.358 (0.215, 0.597)
<0.001*
0.255 (0.148, 0.440)
EOXSC4 expression
High vs. Low
0.003*
1.973 (1.261, 3.088)
0.004*
2.137 (1.281, 3.565)
*P < 0.05.
Univariate analysis to predict factors associated with PFS and OS.*P < 0.05.Multivariate analysis of factors predicting PFS and OS.*P < 0.05.
EXOSC4 Expression Was Significantly Knocked Down by Lv-shRNA in EOC Cell Lines
To further study the function of EXOSC4, Lv-shRNA was transfected to knockdown EXOSC4 in EOC cell lines. The number of cells expressing GFP was observed using a fluorescence microscope, and the infection efficiency was found to be > 90% in both SKOV3 and HO-8910 cells (
). RT-PCR and western blot analyses were performed to evaluate the mRNA and protein expression of EXOSC4 in SKOV3 and HO8910 cells following transfection in each group. Compared with the NC group, the shEXOSC4 group had decreased EXOSC4 mRNA (
) and protein (
) levels, suggesting successful inhibition of EXOSC4 in SKOV3 and HO8910 cells.
Figure 2
Lv-shRNA mediated EXOSC4 silencing in SKOV-3 and HO8910 cell lines. (A) EXOSC4 (GFP) expression in SKOV-3 and HO8910 cells as detected by fluorescence microscope (magnification 100×). Infection efficiency was > 90%. (B) Depletion of EXOSC4 mRNA in SKOV-3 and HO8910 cell lines treated with Lv-shEXOSC4 was determined by RT-PCR. (C) EXOSC4 protein in SKOV-3 and HO8910 cell lines was detected by western blot. (D) Analysis of EXOSC4 protein levels in SKOV-3 and HO8910 cell lines by Image J software analysis. **p < 0.01.
Lv-shRNA mediated EXOSC4 silencing in SKOV-3 and HO8910 cell lines. (A) EXOSC4 (GFP) expression in SKOV-3 and HO8910 cells as detected by fluorescence microscope (magnification 100×). Infection efficiency was > 90%. (B) Depletion of EXOSC4 mRNA in SKOV-3 and HO8910 cell lines treated with Lv-shEXOSC4 was determined by RT-PCR. (C) EXOSC4 protein in SKOV-3 and HO8910 cell lines was detected by western blot. (D) Analysis of EXOSC4 protein levels in SKOV-3 and HO8910 cell lines by Image J software analysis. **p < 0.01.
Downregulation of EXOSC4 Inhibits Cell Proliferation and Colony Formation in EOC Cells
Growth curves generated using CCK8 assays revealed that downregulation of EXOSC4 markedly inhibited EOC cell proliferation (
). Further, the colony-forming ability was reduced in SKOV-3 and HO8910 cells with EXOSC4 silenced (
).
Figure 3
Knockdown of EXOSC4 inhibits cell proliferation, and induces G0/G1 arrest in the SKOV-3 and HO8910 cell lines. (A) CCK8 assays showed that knockdown of EXOSC4 inhibited cell proliferation in SKOV-3 and HO8910 cells. (B) Clone formation ability was also reduced by EXOSC4 knockdown. (C) Cells were arrested at G0/G1 phase following EXOSC4 knockdown. (D) mRNA levels of cyclin D1 and CDK4 detected by RT-PCR. (E) Western-blot assays to determine the protein levels of cyclin D1 and CDK4, and its band quantification. *p < 0.05, **p < 0.01, ***p < 0.001.
Knockdown of EXOSC4 inhibits cell proliferation, and induces G0/G1 arrest in the SKOV-3 and HO8910 cell lines. (A) CCK8 assays showed that knockdown of EXOSC4 inhibited cell proliferation in SKOV-3 and HO8910 cells. (B) Clone formation ability was also reduced by EXOSC4 knockdown. (C) Cells were arrested at G0/G1 phase following EXOSC4 knockdown. (D) mRNA levels of cyclin D1 and CDK4 detected by RT-PCR. (E) Western-blot assays to determine the protein levels of cyclin D1 and CDK4, and its band quantification. *p < 0.05, **p < 0.01, ***p < 0.001.
Knockdown of EXOSC4 Induced G0/G1 Arrest in EOC Cells
Flow cytometry was conducted to measure cell cycle distribution after knockdown of EXOSC4 and revealed that a substantial proportion of cells were arrested at the G0/G1 phase compared with the NC group, resulting in a sharp decline in the proportion of cells in the S phase (
). These data are consistent with a potential role for EXOSC4 in the positive regulation of ovarian cancer cell proliferation. RT-PCR and western blot analysis showed that the expression levels of cyclin D1 and CDK4 were markedly decreased in response to EXOSC4 knockdown (
).
Repression of EXOSC4 Suppresses Migration and Invasion of EOC Cells
The effect of EXOSC4 knockdown on EOC cell migration and invasion was evaluated by scratch and transwell assays. As shown in
, the cell-free regions in the wound-healing area of EXOSC4 knockdown group cells were markedly wider than those in the NC group (
). Further, transwell assays showed that migration and invasion cells from the upper chamber were significantly decreased in both SKOV-3 and HO8910 cell lines following EXOSC4 knockdown (
). Epithelial-mesenchymal transition (EMT)-related proteins were next detected by western blot. It was found that knockdown of EXOSC4 significantly increased E-cadherin, but reduced N-cadherin and vimentin, expression levels in SKOV-3 and HO8910 cells, compared with NC group cells (
). These results indicate that EXOSC4 may mediate EMT initiation and progression in EOC.
Figure 4
EXOSC4 knockdown inhibits the migration and invasion of SKOV-3 and HO8910 cell lines. (A) Migration ability after EXOSC4 knockdown in SKOV-3 and HO8910 cells were assessed using the scratch assay (magnification 100×), and migration rate was calculated. (B, C) Transwell assay to test invasion and migration ability. The number of invasion and migration SKOV-3 cells and HO8910 cells were counted; magnification 200×. (D) Western-blot assays to determine the protein levels of E-cad, N-cad, and vimentin, and its band quantification. *p < 0.05, **p < 0.01, ***p < 0.001.
EXOSC4 knockdown inhibits the migration and invasion of SKOV-3 and HO8910 cell lines. (A) Migration ability after EXOSC4 knockdown in SKOV-3 and HO8910 cells were assessed using the scratch assay (magnification 100×), and migration rate was calculated. (B, C) Transwell assay to test invasion and migration ability. The number of invasion and migration SKOV-3 cells and HO8910 cells were counted; magnification 200×. (D) Western-blot assays to determine the protein levels of E-cad, N-cad, and vimentin, and its band quantification. *p < 0.05, **p < 0.01, ***p < 0.001.
Suppression of EXOSC4 Impaired Wnt Signaling Pathway Activity in EOC Cells
EXOSC4 has been identified previously as a upstream factor of Wnt pathway by bioinformatics analysis (11). To determine the mechanism by which EXOSC4 suppression inhibited EOC cell proliferation, migration, and invasion, we analyzed changes in the Wnt signaling pathway. Since cyclin D1 and vimentin were downregulated after EXOSC4 knockdown, we next analyzed levels of β-catenin and c-myc expression in EOC cells, and found they were also significantly inhibited (
). The TCF/LEF luciferase reporter assay also revealed that the Wnt/β-catenin activity was suppressed after EXOSC4 knockdown (
). These results suggested that the Wnt pathway may participate in EXOSC4-induced proliferation, migration, and invasion of EOC cells.
Figure 5
Knockdown of EXOSC4 suppressed the Wnt signaling pathway. (A) mRNA levels of c-myc were detected using RT-PCR in SKOV-3 and HO8910 cells. (B) Western-blot assays to determine the protein levels of c-myc and β-catenin, and its band quantification. (C) The relative luciferase activity of TCF/LEF after EXOSC4 knockdown in SKOV-3 and HO8910 cells. **p < 0.01, ***p < 0.001.
Knockdown of EXOSC4 suppressed the Wnt signaling pathway. (A) mRNA levels of c-myc were detected using RT-PCR in SKOV-3 and HO8910 cells. (B) Western-blot assays to determine the protein levels of c-myc and β-catenin, and its band quantification. (C) The relative luciferase activity of TCF/LEF after EXOSC4 knockdown in SKOV-3 and HO8910 cells. **p < 0.01, ***p < 0.001.
Discussion
EOC is the most lethal gynecological malignancy worldwide (1). Most patients are diagnosed with EOC at an advanced stage and have poor prognosis (12). Therefore, we searched for novel targets for early detection and effective treatment of EOC. As a component of the human exosome complex, EXOSC4 is related to exosome stability and participates in RNA degradation (9, 13). Aberrant EXOSC4 expression is associated with several pathologies, including childhood obesity (14) and sepsis (15). Moreover, downregulation of EXOSC4 has been proven to have anticancer effects in colorectal (11), liver (16), and breast (17) cancers; however, the function and mechanism of EXOSC4 in EOC are unknown.In this study, we demonstrated that EXOSC4 is overexpressed in EOC tissues and cell lines. Further, EXOSC4 expression was associated with FIGO stage and pathology grade, and our data reveal that EOC patients with high EXOSC4 expression had significantly shorter OS and PFS than those with low expression, similar to the findings of the bioinformatic analysis in mantle cell lymphoma (18). Moreover, high EXOSC4 levels were identified as an independent prognostic factor predicting OS and PFS. These results suggest that EXOSC4 may act as an oncogene in EOC.To investigate the biological properties of EXOSC4 in EOC, we knocked down EXOSC4 expression in SKOV3 and HO8910 cell lines and found that it resulted in suppression of cell proliferation, and arrest of cell cycle progression at G0/G1 phase. Further, downregulation of EXOSC4 decreased cyclin D1 and CDK4 expression levels in EOC cells. These findings are consistent with the results of Pan et al. in the study of colorectal cancer (11). Deregulation of the G1/G1 phase is a critical process in abnormal cancer cell proliferation (19), and dysregulation of cell cycle-related proteins is frequently observed. For example, cyclin D1 is upregulated in approximately 18% of serous epithelial ovarian cancer, and its upregulation is associated with a more aggressive phenotype and dismal prognosis (20). Moreover, overexpression of CDK4 is found in approximately 15% of patients with EOC (21). Thus, agents targeting G0/G1 phase-related proteins, such as cyclin D1 and CDKs, are promising treatment targets in EOC (22, 23).Downregulation of EXOSC4 can inhibit cancer cell migration and invasion (11, 16); however, the mechanism has not been adequately studied. Here, we demonstrated that knockdown of EXOSC4 significantly inhibits the migration and invasion of EOC cells. Expression of EMT-related proteins, including E-cadherin, N-cadherin, and vimentin, was also considerably altered. There are multiple steps involved in EOC metastasis, and EMT plays a vital role in progression (24). Bioinformatics analysis revealed that EXOSC4 is mainly related to the MAPK, p53, and Wnt pathways, which are closely related to EMT and tumor metastasis (11, 15). These results indicate that EXOSC4 may promote cell migration and invasion by activating EMT-related pathways.Previous studies have demonstrated that the Wnt signaling pathway contributes to rapid cell proliferation, distal metastasis, multidrug resistance, and recurrence of ovarian cancer (25). It is established that Wnt-mediated receptor activation can transmit signals along different pathways, which can be roughly divided into β-catenin-dependent and β-catenin-independent signaling (26). The canonical β-catenin-dependent pathway plays a crucial role in EOC carcinogenesis, and the downstream transcription factors and proteins in this pathway have been explored (27). Dysregulation of Wnt/β‐catenin can induce EMT in ovarian cancer, which is characterized by decreased expression of the epithelial marker, E‐cadherin, and increased levels of mesenchymal markers, such as vimentin (28). Suppression of the Wnt/β-catenin pathway should always be considered when developing alternative therapies for ovarian cancer (29). For example, XAV939 and ICG‐001, two Wnt/β-catenin inhibitors with different modes of action, reduced ovarian cancer cell proliferation by suppressing the expression of cyclin D1 and c-myc (30). In this study, inhibition of EXOSC4 significantly decreased the expression levels of β-catenin, cyclin D1, vimentin, and c-myc, as well as the transcriptional activity of LEF/TCF, indicating that the Wnt/β-catenin pathway may participate in EXOSC4-induced EOC progression. Hence, our data expand understanding of the role of Wnt/β-catenin signaling pathway in EOC progression. Nevertheless, the detailed mechanism involved remains to be determined by further study.Our study provides evidence that overexpression of EXOSC4 may promote EOC cell proliferation, migration, and invasion via the Wnt pathway; however, further studies should be performed to fully explore the mechanisms underlying the function of EXOSC4 in EOC. As STX2 drives cell proliferation through upregulating EXOSC4 in colorectal cancer (31), identifying specific sites in the upstream region of the EXOSC4 gene is warranted. Verification of the protein-protein interaction network in RPS6KA5–EXOSC4 and EXOSC4–EXOSC5 determined in previous work also warrants further attention (15). Moreover, the EXOSC4 function in EOC requires in vivo exploration in the future.
Conclusion
In conclusion, EXOSC4 is upregulated in EOC cell lines and tissues, and its overexpression may be an adverse prognostic factor in patients with EOC. Knockdown of EXOSC4 may inhibit EOC cell proliferation, migration, and invasion by suppressing the Wnt pathway. Our data suggest that EXOSC4 is a potential diagnostic marker in EOC and that downregulation of EXOSC4 using therapeutic agents may be valuable for EOC treatment.
Data Availability Statement
The original contributions presented in the study are included in the article/
. Further inquiries can be directed to the corresponding authors.
Ethics Statement
The study was designed to strictly adhere to the Helsinki Declaration, and approved by the Ethics Committee of the Affiliated Hospital of Jiangnan University (no. LS2021001). The patients/participants provided their written informed consent to participate in this study.
Author Contributions
CX, ZS, JY, and YL designed the study, performed the experiments, collected and analyzed the data, wrote the manuscript, and were involved in revising the manuscript. All authors contributed to the article and approved the submitted version.
Funding
This study was funded by the Health Research Project of the Wuxi Health and Family Planning Commission (Q201766), the Wuxi Taihu Lake Talent Plan, Support for Leading Talents in Medical and Health Profession, and the Municipal Health and Family Planning Commission Medical Key Discipline Construction Project (ZDXKJS002).
Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Authors: Laychiluh Bantie; Solomon Tadesse; Jimma Likisa; Mingfeng Yu; Benjamin Noll; Gary Heinemann; Noor A Lokman; Carmela Ricciardelli; Martin K Oehler; Andrew Beck; Rupal Pradhan; Robert Milne; Hugo Albrecht; Shudong Wang Journal: Gynecol Oncol Date: 2020-09-18 Impact factor: 5.482
Authors: Sérgio F de Almeida; Ana García-Sacristán; Noélia Custódio; Maria Carmo-Fonseca Journal: Nucleic Acids Res Date: 2010-08-10 Impact factor: 16.971