| Literature DB >> 34943523 |
Paolo Giuseppe Bonacci1, Dalida Angela Bivona1, Dafne Bongiorno1, Stefano Stracquadanio1, Mariacristina Massimino1, Carmelo Bonomo1, Alessia Stracuzzi2, Paolo Pennisi2,3, Nicolò Musso1, Stefania Stefani1.
Abstract
Starting in 2019, the COVID-19 pandemic is a global threat that is difficult to monitor. SARS-CoV-2 is known to undergo frequent mutations, including SNPs and deletions, which seem to be transmitted together, forming clusters that define specific lineages. Reverse-Transcription quantitative PCR (RT-qPCR) has been used for SARS-CoV-2 diagnosis and is still considered the gold standard method. Our Eukaryotic Host Pathogens Interaction (EHPI) laboratory received six SARS-CoV-2-positive samples from a Sicilian private analysis laboratory, four of which showed a dropout of the E gene. Our sequencing data revealed the presence of a synonymous mutation (c.26415 C > T, TAC > TAT) in the E gene of all four samples showing the dropout in RT-qPCR. Interestingly, these samples also harbored three other mutations (S137L-Orf1ab; N439K-S gene; A156S-N gene), which had a very low diffusion rate worldwide. This combination suggested that these mutations may be linked to each other and more common in a specific area than in the rest of the world. Thus, we decided to analyze the 103 sequences in our internal database in order to confirm or disprove our "mutation cluster hypothesis". Within our database, one sample showed the synonymous mutation (c.26415 C > T, TAC > TAT) in the E gene. This work underlines the importance of territorial epidemiological surveillance by means of NGS and the sequencing of samples with clinical and or technical particularities, e.g., post-vaccine infections or RT-qPCR amplification failures, to allow for the early identification of these SNPs. This approach may be an effective method to detect new mutational clusters and thus to predict new emerging SARS-CoV-2 lineages before they spread globally.Entities:
Keywords: E gene; Next Generation Sequencing; molecular testing
Year: 2021 PMID: 34943523 PMCID: PMC8700258 DOI: 10.3390/diagnostics11122286
Source DB: PubMed Journal: Diagnostics (Basel) ISSN: 2075-4418
Figure 1Amplification curves obtained by RT-PCR with the MOLgen SARS-CoV-2 Real Time RT-PCR Kit: (a) amplification curves of a sample negative for E gene amplification; (b) amplification curves of a sample positive for E gene amplification (orange line).
Study sample NGS Average Coverage, coverage of four cluster mutations and Q-Score of NGS runs.
| Patient | Average Coverage | c.26415 Coverage | A156S Coverage | N439K Coverage | S139L Coverage | Quality Score (Probability of Incorrect Base Call) |
|---|---|---|---|---|---|---|
| 1 | 5505 | 2930 | 14,584 | 7345 | 4105 | 95% > Q30 (1 in 1.000) |
| 2 | 5390 | 3025 | 13,304 | 8207 | 4625 | |
| 3 | 16,937 | 3125 | 75,924 | 2366 | 24,526 | |
| 4 | 13,607 | 1301 | 51,036 | 2505 | 26,154 | |
| 5 | 4732 | 194 | - | 7160 | 826 |
Primers used for E and Spike genes amplification in the PCR.
| Gene | Primer Sequences 5′-3′ | Position in Reference Genome | Amplicon Size (bp) | |
|---|---|---|---|---|
| E gene | 329 | |||
| E1 | F | TCTTTTTCTTGCTTTCGTGGT | 26,298 | |
| R | ACAACCGTATCCGTTTAACA | 26,627 | ||
| S gene | ||||
| FS-4 | F | CCGCATCATTTTCCACTTTT | 22,674 | 825 |
| R | CACGTCCGACAAATTATCCCC | 23,499 | ||
| FS-5 | F | TTTGGTTAAAAACAAATGTGTCAA | 23,158 | 828 |
| R | AGGTAGTTTTGGTTCGTTCT | 23,986 | ||
Figure 2Chromatograms and sequences of some of the sequenced samples. Patients 110 and 111 have the synonymous mutation in the E gene, whereas the two control patients 112 and 113 have not.
Function and frequency of the three mutations.
| Mutation | Gene | GISAID Function | GISAID Frequency | EHPI Frequency | World Frequency |
|---|---|---|---|---|---|
| S137L | Orf 1ab | Not reported | 0.12% | 6.42% | 0.21% |
| N439K | Spike | Surface Receptor Binding Antibody Recognition Sites—Viral Oligomerization Interfaces-Antigenic Drift | 1.43% | 7.33% | 1.07% |
| A156S | Nucleocapsid | Viral Oligomerization Interface—Ligand Binding—Antigenic Drift | 0.25% | 21.20% | 0.21% |
Figure 3Dendrogram representing the 109 samples used for the analysis, the assigned lineages, and the characteristics of the 20 Alpha samples showing the three “extra-lineage” mutations identified in our work.
Correlation p-values calculated for each mutation (S137L, N439K and A156S). Above: comparison between the EHPI, Italy and World database populations. Below: comparison between the samples from our internal database with the mutated E gene and samples from our internal database with wild-type E gene. Statistically significant p-values: ≤0.05 *; ≤0.01 **; ≤0.001 ***; ≤0.0001 ****.
| EHPI vs. Italy | EHPI vs. World | Italy vs. World | |
|---|---|---|---|
| S137L | 0.290604089 | 1 × 107—126 **** | 2.38 × 10—11 **** |
| N439K | 0.000146076 *** | 8.99 × 10—10 **** | 2.00 × 10—81 **** |
| A156S | 3.95 × 10—53 **** | 0 **** | 0 **** |
| E gene c.26415 C > T vs. Wild Type | |||
| S137L | 0.000433736 *** | ||
| N439K | 0.001565402 ** | ||
| A156S | 0.389423696 | ||