| Literature DB >> 34925260 |
Bingjie Shen1,2,3, Yunjiao Li1,2,3, Anchun Cheng1,2,3, Mingshu Wang1,2,3, Ying Wu1,2,3, Qiao Yang1,2,3, Renyong Jia1,2,3, Bin Tian1,2,3, Xumin Ou1,2,3, Sai Mao1,2,3, Di Sun1,2,3, Shaqiu Zhang1,2,3, Dekang Zhu2,3, Shun Chen1,2,3, Mafeng Liu1,2,3, Xin-Xin Zhao1,2,3, Juan Huang1,2,3, Qun Gao1,2,3, Yunya Liu1,2,3, Yanling Yu1,2,3, Ling Zhang1,2,3, Leichang Pan1,3.
Abstract
Duck plague virus (DPV) can cause high morbidity and mortality in many waterfowl species within the order Anseriformes. The DPV genome contains 78 open reading frames (ORFs), among which the LORF2, LORF3, LORF4, LORF5, and SORF3 genes are unique genes of avian herpesvirus. In this study, to investigate the role of this unique LORF5 gene in DPV proliferation, we generated a recombinant virus that lacks the LORF5 gene by a two-step red recombination system, which cloned the DPV Chinese virulent strain (DPV CHv) genome into a bacterial artificial chromosome (DPV CHv-BAC); the proliferation law of LORF5-deleted mutant virus on DEF cells and the effect of LORF5 gene on the life cycle stages of DPV compared with the parent strain were tested. Our data revealed that the LORF5 gene contributes to the cell-to-cell transmission of DPV but is not relevant to virus invasion, replication, assembly, and release formation. Taken together, this study sheds light on the role of the avian herpesvirus-specific gene LORF5 in the DPV proliferation life cycle. These findings lay the foundation for in-depth functional studies of the LORF5 gene in DPV or other avian herpesviruses.Entities:
Keywords: LORF5 gene; cell-to-cell spread; duck plague virus; non-essential; virus replication
Year: 2021 PMID: 34925260 PMCID: PMC8674210 DOI: 10.3389/fmicb.2021.744408
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
FIGURE 1Schematic diagram of CHv-BAC-ΔLORF5 construction. (A) DPV genome structure. (B) Detection of protein expression of LORF5 gene in eukaryotic plasmid-transfected cells by western blotting. 293T and DEF cells were transfected and harvested at 24 hpi (293T) and 36 hpi (DEF cells). Proteins were detected using a mouse anti-FLAG MAb. (C) The principle of knocking out the DPV LORF5 gene. In the first step of homologous recombination, the LORF5 gene was replaced by the Kan resistance gene through 40-bp homology arms (sequences a and b). In the second step, L-arabinose induced recombinase to recognize the I-SecI cleavage site and delete the Kan fragment. Then, the LORF5 gene ORF was deleted in the DPV genome without any reservation.
FIGURE 2Construction and identification of recombinant viruses. (A) Rescue of the LORF5-deleted mutant and its revertant virus. Plasmids from a positive colony were transfected into DEF cells by Lipofectamine 3000, and with continuous observation, the recombinant virus fluorescent marker protein EGFP was expressed in DEFs. (B) PCR identification of LORF5 gene deletion (245 bp) or restoration (968 bp) using primers ΔLORF5-F and ΔLORF5-R compared with the parental virus DPV CHv-BAC and the US8 gene (1,473 bp) as a DPV gene control. (C) RFLP analysis. The ΔLORF5, RΔLORF5, and BAC plasmids extracted by the Qiagen Plasmid Midi Kit were cut with restriction enzymes EcoRI or XhoI and then imaged by 1% gel electrophoresis; the left is the simulated imaging after restriction digestion. The arrows in the figure show the difference between the deletion strain with WT and the reverting strain after digestion. The corresponding LORF5 gene-deleted strain has a band around 4 kb after EcoRI digestion, and a band around 3 kb has been added. (D) Reverse-transcription q-PCR was performed to verify the mRNA expression of the gene LORF5 and surrounding genes UL55 and LORF4 of the viruses.
Viral content of DPV extracellular virions (partial).
|
|
|
|
|
|
|
|
|
| US8 | Glycoprotein E | 25 | 54,873 | 1 (1) | 1 (1) | 0.06 |
|
| LORF5 | Virion protein | 61 | 106,375 | 11 (5) | 10 (5) | 0.16 |
|
FIGURE 3Determination of viral titers in growth kinetics of CHv-BAC-ΔLORF5, CHv-BAC-RΔLORF5, and CHv-BAC. DEF cells in 12-well plates were infected with CHv-BAC, CHv-BAC-RΔLORF5, and CHv-BAC-ΔLORF5 (MOI = 0.01). Samples were collected at the indicated time points, and viral titers were determined. The data were presented as the mean ± standard deviation (SD, P > 0.05) of three independent experiments. (A) Supernatant viral titers. (B) Cell viral titers. (C) Statistical analysis of the difference of virus titer in the supernatant at each time point. (D) Statistical analysis of the difference of virus titer in the cell at each time point. Asterisks indicate significant differences compared to WT virus (∗∗P < 0.01; ∗P < 0.05).
FIGURE 4The influence of LORF5 on virus adsorption, invasion, and replication. ΔLORF5, RΔLORF5, and CHv-BAC (0.001 MOI) were inoculated into DEF cells. On the one hand, the number of virus plaques was calculated to study the ability to adsorb on the cell surface (A) or invade cells (C) after 24 hpi; on the other hand, cell samples were collected 0–2 h after incubating viruses, and the copies were separately detected simultaneously (B,D). (E) Cell samples infected with ΔLORF5, RΔLORF5, and CHv-BAC (1 MOI) were collected, RNAs were extracted and reverse-transcribed into cDNA as a template to detect the virus copy number by q-PCR (t-test, ∗P < 0.05).
FIGURE 5The role of LORF5 in the assembly and release of virus particles. (A) Electron microscopy analysis of DEF cells infected with CHv-BAC-ΔLORF5. DEF cells were infected with 5 MOI of virus and examined by electron microscopy analysis (N, nucleus; C, cytoplasm). The white box in the middle indicates virus particles. (B) Eighteen hours after the cells were infected with the viruses, the medium was replaced with 2% maintenance solution; the supernatant was collected at 30, 60, 90, and 120 min after changing; and the infectious mature virus particles in the supernatant were detected. (C) At the same time, the cells were used as control. The means and standard deviations were measured with GraphPad Prism 8. Standard deviations are shown by error bars.
Virions observed in ΔLORF5-infected DEF cells by electron microscopy.
|
| |||||
|
|
|
|
| ||
|
|
|
|
| ||
|
| |||||
| 66.7% (28) | 33.3% (14) | 42/4 | 67.6% (75) | 32.4% (36) | 111/2 |
FIGURE 6Plaque size assays of indicated recombinant viruses. DEF cells in six-well plates were infected with 0.001 MOI of ΔLORF5, RΔLORF5, or CHv-BAC. After incubation at 37°C for 2 h, the infected cells were covered with 1.5% methylcellulose and cultured in a 37°C, 5% CO2 incubator. (A) Green fluorescent plaques produced by ΔLORF5, RΔLORF5, and CHv-BAC. The cells were observed under a fluorescence microscope (Nikon TI-SR, Japan). (B) Statistical analysis of the data in panel (A) and shown as a scatter plot with minimum and maximum values (plaque diameters: mm). (C) Images of viral plaques after 0.5% crystal violet staining. (D) Statistical analysis of the data in panel (C) and shown as a scatter plot with minimum and maximum values. All data have been carried out in three independent experiments. The plaque size of the deletion virus and the reverted virus was compared with that of the parental virus (WT, CHv-BAC) set to 100%. Asterisks indicate significant differences compared to WT virus (∗∗∗P < 0.001; ∗∗P < 0.01; n > 50). The means and standard deviations were measured with GraphPad Prism 8. Standard deviations are shown by error bars.
Primers used in this paper.
|
|
|
|
| ΔLORF5-Kan-F | cgtactaactgaagttgaatctgatcta gtaaccggggcctagggataacagggta atcgatttatgtgaaagacgtcaaaagttaaa accggtatattaaatgggccccggtt | Target ΔLORF5 fragment |
| ΔLORF5-Kan-R | actagatcagattcaacttcagttagtacggcca gtgttacaaccaat | |
| ΔLORF5-F | gccaacggtagggactg | ΔLORF5/RΔLORF5 identification |
| ΔLORF5-R | gacacggtaaacaatgaagg | |
| RΔLORF5-F | aacagatgtccgtatgtaatcgtactaactg aagttgaatctgatctagtaaccg gggccatggcatcttcaaaagcgtt | Target RΔLORF5 fragment |
| RΔLORF5-R | aaagttaaaaccggtatattaaatgctaata gtcatctctggtat | |
| RΔLORF5-Kan-F | catttaatataccggtttt aacttttgacgtctttcacattacttaaatat agggataacagggtaatcgat | |
| RΔLORF5-Kan-R | cgagactgattcgtttaatcatatttatttt atttaagtaatgtgaaagacgtcaaaagtt aaaaccggtatattaaatgt gttacaaccaattaacc | |
| US8-F | tctcaagacgctctggaatc | US8 (gE) |
| US8-R | gacgcagagaagtactcgct | |
| LORF5-F | aacgactggtgggagtaacg | LORF5 |
| LORF5-R | gcagcggaacaaatgaaac | |
| LORF4-F | cgcaccctatgctatcgtc | LORF4 |
| LORF4-R | cgttgtcggattacccattt | |
| UL55-F | tattcttctgcgggctca | UL55 |
| UL55-R | catagacgatgctcc | |
| UL30-F | tttcctcctcctcgctgagtg | UL30 |
| UL30-R | ccagaaacatactgtgagagt |