| Literature DB >> 34917599 |
Ekaterina Semenova1, Mariusz P Grudniak1, Katarzyna Bocian1,2, Magdalena Chroscinska-Krawczyk3, Marzena Trochonowicz1, Igor M Stepaniec1, Magdalena Murzyn1,4, Ilona Szablowska-Gadomska5, Dariusz Boruczkowski1, Tomasz Oldak1, Eugeniusz K Machaj1.
Abstract
Processing of MSCs to obtain a therapeutic product consists of two main steps: 1) the in vitro expansion of the cells until an appropriate number of them is obtained, and 2) freezing and storage of the expanded cells. The last step is critical and must be optimized so that after thawing the cells retain all their physiological properties including the secretory function. In this paper, we evaluated physiological parameters of AT-MSC's after a full cycle of their processing, particularly freezing and storing at the liquid nitrogen vapor temperature. Based on the recovered proliferative and secretory capacities of the thawed cells, we have designed the optimal technique for processing of MSCs for clinical applications. In our work, we tried to select the best DMSO-based cryoprotectant mixture on the base of post thawing fully retain their properties. We have demonstrated the effectiveness of the use of DMSO in various configurations of the constituent cryoprotective fluids. We have also shown that AT-MSCs that show control levels in most standard tests (viability, shape, culture behaviour, and proliferative properties) after thawing, may show transient variations in some important physiological properties, such as the level of secreted growth factors. Obtained results let us to indicate how to optimize the AT-MSC preparation process for clinical applications. We suggest that before their clinical application the cells should be cultured for at least one passage to recover their physiological stability and thus assure their optimal therapeutic potential.Entities:
Keywords: ADSC; application; banking; cryopreservation; cryoprotectant
Year: 2021 PMID: 34917599 PMCID: PMC8670380 DOI: 10.3389/fbioe.2021.773123
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
FIGURE 1The freezing procedure was implemented using the IceCube device. The freezing program started at 4°C and finished at −80°C. After freezing AT-MSCs were transferred to cryogenic containers (−170°C).
Primers used in the qPCR.
| Target gen | Primer | Sequence (5′--> 3′) |
|---|---|---|
| ADIPO | ||
| ADIPOQ | F | GCAGTCTGTGGTTCTGATTCC |
| R | CCCTTGAGTCGTGGTTTCCT | |
| FABP4 | F | GAAAGGCGTCACTTCCACGA |
| R | ATGCGAACTTCAGTCCAGGTC | |
| CHONDRO | ||
| COL10A1 | F | GCTGAACGATACCAAATGCCC |
| R | CCTTGCTCTCCTCTTACTGCT | |
| COL2A1 | F | TGGTGCTGCTGACGCT |
| R | CTGTCCCTTTGGTCCTGGTT | |
| OSTEO | ||
| RUNX2 | F | ACGGGGCACTGGGCTT |
| R | GTGAGGGATGAAATGCTTGGG | |
| BGLAP | F | CCTCACACTCCTCGCCCTAT |
| R | CTCTTCACTACCTCGCTGCC | |
| PLURI | ||
| SOX-2 | F | CGGAAAACCAAGACGCTCA |
| R | GACCCCGCTCGCCAT | |
| C-MYC | F | CGCCTTCTCTCCGTCCTC |
| R | TCTTCCTCATCTTCTTGTTCCTCC | |
Note: ADIPO—genes associated with adipogenesis, CHONDRO—genes associated with chondrogenesis, OSTEO—genes associated with osteogenesis, PLURI—genes associated with pluripotency.
FIGURE 2Morphology of cultured MSCs without freezing (Control) and after cryopreservation with four cryoprotectants. The cells were grown attached to the bottom of the flasks and exhibited typical morphology of mesenchymal cells.
Flow cytometry of non-frozen (Control) and frozen/thawed (Cryo1 through Cryo4) AT-MSCs. The Lin cocktail contained antibodies against the CD34, CD45, CD19, CD14, HLA-DR antigens. The flow cytometry analysis of the surface antigen profile was performed from 5 samples.
| Control | Lin cocktail | CD73 | CD90 | CD105 |
| P3 | 0.35 ± 0.04 | 98.38 ± 4.1 | 99.85 ± 13.1 | 96.73 ± 9.03 |
| P4 | 0.72 ± 0.02 | 98.18 ± 10.1 | 99.67 ± 10.5 | 96.38 ± 8.1 |
| P5 | 1.84 ± 0.4 | 96.2 ± 11.7 | 95.18 ± 6.8 | 98.43 ± 6.1 |
| Cryo1 | Lin cocktail | CD73 | CD90 | CD105 |
| After thawing | 0.9 ± 1.8 | 96.67 ± 12.5 | 99.08 ± 7.23 | 77.14 ± 12.1 |
| P4 | 0.13 ± 0.08 | 99.32 ± 8.1 | 98.92 ± 9.1 | 94.93 ± 8.1 |
| P5 | 0.1 ± 0.03 | 93.31 ± 9.6 | 95.84 ± 11.1 | 92.06 ± 5.6 |
| Cryo2 | Lin cocktail | CD73 | CD90 | CD105 |
| After thawing | 0.2 ± 1.22 | 98.02 ± 10.6 | 99.08 ± 6.3 | 84.29 ± 12.3 |
| P4 | 0.1 ± 0.03 | 99.02 ± 15.1 | 99.1 ± 16.2 | 96.37 ± 7.15 |
| P5 | 0.01 | 90.73 ± 7.3 | 99.08 ± 10.6 | 93.11 ± 8.27 |
| Cryo3 | Lin cocktail | CD73 | CD90 | CD105 |
| After thawing | 0.3 ± 1 | 96.6 ± 13.5 | 99.01 ± 10.9 | 72.64 ± 5.2 |
| P4 | 0.03 | 99.6 ± 9.5 | 99.72 ± 21.6 | 88.08 ± 9.2 |
| P5 | 0 | 88.17 ± 12.3 | 98.91 ± 9.7 | 93.29 ± 4.1 |
| Cryo4 | Lin cocktail | CD73 | CD90 | CD105 |
| After thawing | 0.7 ± 0.92 | 98.86 ± 10.6 | 98.13 ± 12.2 | 90.95 ± 11.1 |
| P4 | 0.6 ± 0.01 | 99.47 ± 15.5 | 85.72 ± 9.4 | 85.92 ± 9.3 |
| P5 | 0 | 93.46 ± 11.7 | 99.09 ± 12 | 86.87 ± 8.8 |
FIGURE 3Comparison of PDTs of the non-frozen (Control) and frozen with cryoprotectans 1 through 4 (Cryo 1 through Cryo 4) AT- MSCs from passages 4 and 5. Mean values ± SEM are shown. The PDT analysis was performed from 5 samples.
FIGURE 4Clonogenic potential of the non-frozen (Control) and frozen/thawed (Cryo 1 through Cryo 4) AT-MSCs obtained from passages 4 and 5. Mean values ± SEM are shown. The CFU-F analysis was performed from 5 samples.
Viability of the frozen-thawed (Cryo 1 through Cryo 4) cells after their incubation for 30 min at 37°C. Mean values ± SEM are shown. The viability was performed from 5 samples.
| Cryoprotectant | Viability |
|---|---|
| Cryo1 | 90 ± 4.1 |
| Cryo2 | 92.3 ± 7 |
| Cryo3 | 83 ± 11.6 |
| Cryo4 | 77 ± 7.1 |
FIGURE 5Representative images of the non-frozen (Control) and frozen/thawed (Cryo 1 through Cryo 4) AT-MSCs cells stained for the detection of actin filaments using TRITC-conjugated Phalloidin (red color) and the nucleus of the cells revealed with DAPI (blue color).
FIGURE 6Representative images showing the potential to differentiate into chondrocytes (CH), adipocytes (AD), and osteoblasts (OST) of the non-frozen (Control) and cryoprocessed AT-MSCs. Chondrogenic differentiation was confirmed by Alcian blue staining, blue color indicates glycosaminoglycans in cartilage (red arrows); adipogenic differentiation was evaluated by Oil Red, the differentiated culture demonstrates lipid vacuoles, which typical for mature adipocytes (blue arrows); osteogenic differentiation was assessed by Alizarin Red staining of deposition of matrix calcification (black arrows).
FIGURE 7Gene expression of pluripotency related gene C-MYC (A) and differentiation-related genes: chondrogenic COL10A1 (B), osteogenic RUNX2 (C), adipogenic FABP4 (D) of the non-frozen (Control) and frozen/thawed AT-MSCs obtained from passages 4 and 5. Mean values ± SEM are shown; * indicates statistical significance (p < 0.05) of the differences between groups marked above with the horizontal solid line.
Cytokines secreted by the non-frozen (Control) and cryopreserved (Cryo1, Cryo2, Cryo3, Cryo4) AT-MSCs obtained from passages 4 (P4) and 5 (P5). Cytokine levels detected in the medium from the non-frozen cells served as the Control values. Mean values ± SEM are shown.
| Protein/pg/ml | Control | Cryo1 | Cryo2 | Cryo3 | Cryo4 |
|---|---|---|---|---|---|
| AT-MSCs P4 | |||||
| IL-6 | 625.12 ± 229.06 | 703.28 ± 237.24 | 1781.56 ± 2028.14 | 247.91 ± 100.3 | 337.1 ± 170.6 |
| IL-8 | 371.64 ± 68.35 | 265.11 ± 74.49 | 237.24 ± 85.92 | 198.65 ± 86.43 | 80.66 ± 38.14* |
| MCP-1 | 2,666.47 ± 1,227.97 | 2,102.08 ± 648.99 | 4,003.92 ± 2,575.54 | 1,410.89 ± 597.92 | 1,460.74 ± 521.18 |
| TGF-β1 | 851.71 ± 90.08 | 596.94 ± 37.12 | 862.97 ± 263.54 | 755.38 ± 141.27 | 659.64 ± 78.28 |
| TGF-β2 | 221.66 ± 16.99 | 46.53 ± 11.20* | 59.71 ± 22.22* | 47.44 ± 13.31* | 34.68 ± 7.30* |
| PDGF AA | 139.31 ± 69.10 | 168.36 ± 13.96 | 7.71 ± 0.26* | 110.87 ± 10.22 | 92.65 ± 5.08 |
| Fractalkine | 33.64 ± 15.61 | 48.84 ± 30.48 | 22.33 ± 4.99 | 40.01 ± 31.33 | 36.77 ± 17.21 |
| G-CSF | 55.15 ± 31.17 | 33.01 ± 17.92 | 17.25 ± 8.57 | 27.20 ± 17.30 | 19.38 ± 13.35 |
| IL-1β | 1.45 ± 1.27 | 1.05 ± 0.34 | 9.30 ± 0.92* | 0.80 ± 0.69 | 0.36 ± 0.10 |
| IL-4 | 11.53 ± 4.16 | 6.55 ± 2.35 | 9.75 ± 2.53 | 4.35 ± 1.84 | 5.14 ± 2.11 |
| IP-10 | 24.46 ± 14.77 | 6.04 ± 2.12 | 32.33 ± 3.44 | 4.71 ± 1.50 | 3.24 ± 1.31 |
| MIP-1α | 2.65 ± 1.01 | 1.52 ± 0.87 | 3.47 ± 1.60 | 1.83 ± 0.69 | 1.36 ± 0.77 |
| MIP-1β | 4.61 ± 2.27 | 1.95 ± 1.85 | 0.61 ± 0.36 | 0.35 ± 0.15 | 0.61 ± 0.22 |
| Flt-3L | 14.34 ± 2.32 | 5.36 ± 2.12* | 5.07 ± 2.34* | 3.90 ± 1.60* | 3.92 ± 1.01* |
| IL-13 | 5.96 ± 1.73 | 5.40 ± 0.66 | 18.52 ± 1.86* | 6.24 ± 1.81 | 5.19 ± 0.34 |
| IL-10 | 2.13 ± 1.21 | 1.58 ± 0.37 | 2.36 ± 1.96 | 0.71 ± 0.47 | 0.66 ± 0.27 |
| TNFα | 6.10 ± 2.28 | 1.60 ± 1.05 | 0.90 ± 0.57 | 0.60 ± 0.25 | 0.64 ± 0.31 |
| IFNα | 2.13 ± 1.21 | 1.58 ± 0.37 | 2.36 ± 1.96 | 0.71 ± 0.47 | 0.66 ± 0.27 |
| AT-MSCs P5 | |||||
| IL-6 | 345.60 ± 190.75 | 356.69 ± 124.05 | 336.70 ± 68.42 | 306.10 ± 73.96 | 356.36 ± 62.05 |
| IL-8 | 44.50 ± 5.00 | 59.84 ± 5.45 | 39.12 ± 15.60 | 40.45 ± 17.93 | 56.75 ± 24.19 |
| MCP-1 | 546.02 ± 203.06 | 780.73 ± 167.34 | 641.12 ± 40.04 | 732.53 ± 116.44 | 1,025.61 ± 121.07 |
| TGF-β1 | 549.45 ± 156.81 | 633.04 ± 78.26 | 383.50 ± 40.74 | 382.94 ± 91.64 | 459.39 ± 90.48 |
| TGF-β2 | 88.65 ± 5.20 | 83.56 ± 32.16 | 60.49 ± 19.69 | 60.22 ± 15.43 | 70.61 ± 31.27 |
| PDGF AA | 156.75 ± 51.65 | 111.44 ± 50.78 | 107.66 ± 31.16 | 89.54 ± 36.34 | 116.66 ± 48.64 |
| Fractalkine | 28.64 ± 12.37 | 51.25 ± 33.99 | 23.04 ± 18.77 | 12.33 ± 3.68 | 30.68 ± 24.66 |
| G-CSF | 31.53 ± 5.00 | 36.97 ± 7.00 | 38.71 ± 2.26 | 40.74 ± 1.61 | 34.55 ± 6.79 |
| IL-1β | 1.20 ± 0.69 | 0.76 ± 0.52 | 0.65 ± 0.30 | 1.32 ± 0.76 | 0.87 ± 0.15 |
| IL-4 | 4.00 ± 1.41 | 5.60 ± 0.00 | 4.44 ± 1.63 | 22.72 ± 4.72* | 3.56 ± 1.00 |
| IP-10 | 3.44 ± 1.31 | 8.20 ± 3.24 | 3.30 ± 0.26 | 5.82 ± 3.33 | 3.15 ± 1.12 |
| MIP-1α | 1.45 ± 0.78 | 1.53 ± 1.00 | 1.36 ± 0.77 | 1.79 ± 1.23 | 1.38 ± 0.81 |
| MIP-1β | 1.10 ± 0.34 | 0.65 ± 0.24 | 0.78 ± 0.04 | 0.56 ± 0.25 | 0.75 ± 0.04 |
| Flt-3L | 6.76 ± 3.96 | 4.20 ± 1.94 | 4.27 ± 2.56 | 7.08 ± 4.95 | 4.74 ± 2.75 |
| IL-13 | 3.91 ± 1.03 | 4.89 ± 1.22 | 3.88 ± 0.75 | 9.92 ± 0.89* | 4.89 ± 1.22 |
| IL-10 | 1.20 ± 0.03 | 1.24 ± 0.00 | 1.40 ± 0.21 | 2.63 ± 0.63 | 1.48 ± 0.24 |
| TNFα | 1.45 ± 1.43 | 0.32 ± 0.12 | 0.56 ± 0.41 | 1.49 ± 1.23 | 1.03 ± 0.72 |
| IFNα | 1.20 ± 0.03 | 1.23 ± 0.00 | 1.40 ± 0.21 | 2.62 ± 0.63 | 1.48 ± 0.24 |
*indicates statistically significant (p < 0.05) difference from the control value.