| Literature DB >> 34900974 |
Gen Zou1, Juanbao Ren1,2, Di Wu1, Henan Zhang1, Ming Gong1, Wen Li1, Jingsong Zhang1, Yan Yang1.
Abstract
Hericium erinaceus is an important medicinal fungus in traditional Chinese medicine because of its polysaccharides and other natural products. Compared terpenoids and polyketides, the analysis of synthetic pathway of polysaccharides is more difficult because of the many genes involved in central metabolism. In previous studies, A6180, encoding a putative UDP-glucose 4-epimerase (UGE) in an H. erinaceus mutant with high production of active polysaccharides, was significantly upregulated. Since there is no reliable genetic manipulation technology for H. erinaceus, we employed Escherichia coli and Saccharomyces cerevisiae to study the function and activity of A6180. The recombinant overexpression vector pET22b-A6180 was constructed for heterologous expression in E. coli. The enzymatic properties of the recombinant protein were investigated. It showed that the recombinant A6180 could strongly convert UDP-α-D-glucose into UDP-α-D-galactose under optimal conditions (pH 6.0, 30°C). In addition, when A6180 was introduced into S. cerevisiae BY4742, xylose was detected in the polysaccharide composition of the yeast transformant. This suggested that the protein coded by A6180 might be a multifunctional enzyme. The generated polysaccharides with a new composition of sugars showed enhanced macrophage activity in vitro. These results indicate that A6180 plays an important role in the structure and activity of polysaccharides. It is a promising strategy for producing polysaccharides with higher activity by introducing A6180 into polysaccharide-producing mushrooms.Entities:
Keywords: Hericium erinaceus; enzymatic properties; heterologous expression; immune activity; polysaccharide; polysaccharide synthesis
Year: 2021 PMID: 34900974 PMCID: PMC8655778 DOI: 10.3389/fbioe.2021.796278
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Primer design of the Hericium erinaceus A6180 gene and related functional fragment.
| Primer | Sequence (5′-3′) | Descriptions |
|---|---|---|
| A6180EC-F | AACTTTAAGAAGGAGATATACATATGGCTGTTGCCGATACCTC | For full-length |
| A6180EC-R | TCAGTGGTGGTGGTGGTGGTGCTCGAGCTTGGACTCGGTATCGTAGCCG | |
| A6180SC-F | CACACATAAACAAACAAAGCGGCCGCATGGCTGTCGCTGATACCTCTCT | For full-length |
| A6180SC-R | CCTTGTAATCCATCGATACTAGTTCAATGATGATGATGATGATGCTTCGACTCGGTATCGTATCCATTC | |
| TDH3-F | AACCCTCACTAAAGGCATATGATACTAGCGTTGAATGTTAGCGTC | For full-length |
| TDH3-R | ATCAGCGACAGCCATGCGGCCGCTTTGTTTGTTTATGTGTGTTTATTC |
FIGURE 1Phylogenetic and structural analysis of UDP-glucose-4-epimerases in fungi. (A) Phylogenetic analysis of UDP-glucose-4-epimerases of fungi including: Hericium erinaceus (DATA S1), H. alpestre (accession no. TFY78463.1), Dentipellis_fragilis (accession no. TFY62748.1), Punctularia_strigosozonata (accession no. XP_009540529.1), Xerocomus_badius (accession no. KAF8559888.1), Postia_placenta (accession no. KAF8559888.1), Ganoderma_sinensis_ZZ0214-1 (accession no. PIL31081.1), Trametes_cinnabarina (accession no. CDO77294.1), Lentinus_tigrinus_(Aga) (accession no. RPD64555.1), Lentinus_tigrinus_(Sec) (accession no. RPD82942.1), Volvariella_volvacea_(accession no. KAF8665304.1) Pleurotus_eryngii_(accession no. KDQ31371.1), Hypsizygus_marmoreus (accession no. RDB19506.1), Agaricus_bisporus (accession no. XP_006454268.1), Lentinula_edodes (accession no. GAW00910.1), Saccharomyces_cerevisiae (accession no. AJQ11874.1:), and Cordyceps_militaris (accession no. XP_006672787.1). A neighbor-joining tree was built using MEGA5.0 and the bootstrap method with 1000 replicates. The superscript numbers represent three types of orthologs shown in B. (B) The structural functional domain analysis of UDP-glucose-4-epimerases. 1) Typical UGE with unique functional domain. 2) A yeast UGE containing N-terminal epimerase domain and a C-terminal mutarotase domain. 3) An exclusive UGE to basidiomycetes containing N-terminal THO complex subunit 1 transcription elongation factor domain and C-terminal epimerase domain.
FIGURE 2Three-dimensional structures of UDP-glucose-4-epimerases in H. erinaceus. (A) Homodimer was developed by homology modeling. (B) Active sites (N126, S150, Y174, K178) were illustrated in colored sticks. (C) NAD binding sites of H. erinaceus UGE were shown in colored sticks (G16, A18, G19, Y20, I21, C80, D81, L82, V106, A107, A108, K110, N125, S148, S149, S150, Y174, K178, Y203, F204, and P206). (D) Homology modeling of substrate binding sites (S150, A151,T152, Y174, Y203, F204, N205, G222, N225, L226, L243, K244, V245, F246, C257, R259, Y260, and V307). (E) Monomer interactions caused by peptide binding sites in homodimer interface (T116, I118, P119, V120, Y123, H124, V127, S128, I131, F132, L134, Q135, D138, P173, K176, M180, T183. I184, D186. D187, and L188). All models were generated by PyMOL.
FIGURE 3Heterologous expression of A6180 in E. coli. (A) Schematic diagram of the construction of recombinant overexpression vector. (B) SDS-PAGE analysis of the protein expression of positive transformants under the four inductive expression conditions. M: protein marker; 1: 37°C 1.0 mmol/L IPTG induced precipitation; 2: 37°C 1.0 mmol/L IPTG induced supernatant sample; 3: 37°C 0.2 mmol/L IPTG induced precipitation sample; 4: 37°C 0.2 mmol/L IPTG induced supernatant sample; 5: 15°C 1.0 mmol/L IPTG induced precipitation sample; 6: 15°C 1.0 supernatant sample after induction of mmol/L IPTG; 7: precipitation sample after induction of 0.2 mmol/L IPTG at 15°C; 8: sample of supernatant after induction of 0.2 mmol/L IPTG at 15°C. (C) Purified recombinant protein expressed in E. coli. M: marker; S: Purified protein.
FIGURE 4Activities of recombinant protein expressed in E. coli. (A) High performance liquid chromatography detection separation UDP-Glu and UDP-Gal. Peak 1: UDP-Glu; Peak 2: UDP-Gal. (B) Double reciprocal graph. (C) Optimal pH for activity. (D) Optimal temperature for activity. (E) The effect of metal ions on enzyme activity. (F) The effect of chemical reagents on enzyme activity.
FIGURE 5Expression of A6180 in yeast. (A) Schematic diagram of the construction of recombinant overexpression vector pESC-Leu-A6180. (B) Verification for positive transformants of yeast. M: D2000 Marker; 1–3: blank controls; 4–9: transformants 1–6. (C) Western blot results of positive transformants. M: Prestained protein Marker 10–180 kDa; 1: Parent strain. 2–3: Positive transformants.
FIGURE 6Effect on polysaccharide after expressing A6180 in yeast. (A) The trend of glucan in S. cerevisiae control group and transformation group. The result of the control group is a blue curve and the result of the transformation group is a black curve. (B) Monosaccharide composition results of S. cerevisiae control group and transformation group on day 3. The result of the control group can be seen in the blue curve, and the result of the transformation group is present in the black curve. (C) Immune activity of polysaccharides from S. cerevisiae control group and transformation group. PBS (phosphate-buffered saline): blank control; SCT: polysaccharides from S. cerevisiae control group; SCA: polysaccharides from S. cerevisiae transformation group; LPS (Lipopolysaccharides): positive control.
The proportion of monosaccharide composition in S. cerevisiae and its transformant on day 3.
| Monosaccharide type | Monosaccharide in control group | Monosaccharide in transformed group (%) | Increased monosaccharides in transformed group | Reduced monosaccharides in transformed group |
|---|---|---|---|---|
| Rhamnose | N.Da | 0.55 | 0.55% | N.A |
| Arabinose | 0.15% | 3.25 | 3.10% | N.A. |
| Glucosamine | 0.82% | 0.53 | N.A. | 0.29% |
| Galactose | N.D | 9.24 | 9.24% | N.A. |
| Glucose | 33.50% | 25.62 | N.A. | 7.88% |
| Xylose | N.D. | 11.83 | 11.83% | N.A. |
| Mannose | 61.81% | 44.94 | N.A. | 16.87% |
| Fructose | 3.72% | 2.49 | N.A. | 1.23% |
| GalA | N.D. | 1.54 | 1.54% | N.A. |
N.D: not detected.
N.A: not application.
FIGURE 7Schematic diagram of this study.