Literature DB >> 34900030

Protective Effect of Fasudil on Hydrogen Peroxide-Induced Oxidative Stress Injury of H9C2 Cardiomyocytes.

Yu Zhang1, Shanxin Liu2, Xiaochun Li3, Jian Ye1.   

Abstract

OBJECTIVE: Oxidative damage is a pathological factor that causes cardiovascular damage in the clinic and is increasingly serious. This study focused on the effect of fasudil on H2O2-induced oxidative damage in cardiomyocytes.
MATERIALS AND METHODS: H9C2 cardiomyocytes were cultured in vitro and divided into three groups: control group (Con group), H2O2 treatment (H2O2 group), and fasudil and H2O2 cotreatment (H2O2+fasudil group). The content levels of LDH and MDA in the supernatant were detected, and the morphology of H9C2 cardiomyocytes was observed by light microscopy. 8-OHdG staining was observed by a fluorescence inversion microscope. Cell Counting Kit (CCK-8), western blotting, real-time polymerase chain reaction (RT-PCR), and enzyme-linked immunosorbent assay (ELISA) were used to investigate the effect of fasudil on the Rho/ROCK signaling pathway.
RESULTS: Our results showed that after H2O2 treatment, the H9C2 cardiomyocytes were irregular in shape and elliptical. But the morphology of the H2O2+fasudil group was similar to that of the Con group. The green fluorescence of the H2O2 group was significantly enhancer than that of the Con group, while the green fluorescence of the H2O2+fasudil group was weaker than those of the H2O2 group. By detecting the supernatant, it was found that the contents of LDH were significantly increased, and the contents of SOD and CAT in the H2O2 group were significantly decreased. And the expression of antioxidant indicators in the H2O2 group was significantly decreased by western blotting. The results of RT-PCR showed that SOD1 and SOD2 mRNA in the H2O2 group was significantly reduced, and the contents of GPX1 and GPX3 in the H2O2 group were significantly decreased by enzyme-linked immunosorbent assay (ELISA). The expression of ROCK1, ROCK2, and downstream phosphorylation of myosin phosphatase target subunit-1 (p-MYPT-1) was significantly increased in the H2O2 group, while fasudil inhibited the increase of ROCK1, ROCK2, and p-MYPT-1.
CONCLUSIONS: Fasudil can inhibit the Rho/ROCK signaling pathway induced by H2O2 and reduce oxidative stress response, inhibit apoptosis, and improve antioxidant enzyme activity in H9C2 cardiomyocytes thereby delaying cell senescence.
Copyright © 2021 Yu Zhang et al.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34900030      PMCID: PMC8654537          DOI: 10.1155/2021/8177705

Source DB:  PubMed          Journal:  Dis Markers        ISSN: 0278-0240            Impact factor:   3.434


1. Introduction

The rising trend of cardiovascular disease leading to human death is one of the main causes of sudden death in humans [1]. As people's quality of life improves, the incidence of many underlying diseases increases year by year, including diabetes, high blood pressure, and myocardial ischemia [2]. Among them, the incidence and mortality of cardiovascular diseases have remained at the leading level [3]. In recent years, more studies have shown that oxidative stress- (OS-) induced cardiomyocyte apoptosis plays an important role in the development of cardiovascular diseases [4]. Cardiomyocytes are a type of highly differentiated cells. Apoptosis of cardiomyocytes leads to cardiac dysfunction, which ultimately leads to irreversible changes in the heart [5]. Therefore, the search for new drugs to inhibit OS and reduce myocardial cell apoptosis is currently a hot spot in the treatment of cardiovascular diseases. Fasudil is a novel Rho kinase inhibitor that can inhibit OS and inflammatory responses [6]. It has been reported that fasudil can directly bind to Rho-associated protein kinase (ROCK) and inhibit Rho enzyme activity, thereby attenuating ROS-induced abnormal activation of the Rho/ROCK signaling pathway [7]. Previous studies have found that fasudil can effectively reduce the expression of inflammatory factors in noninfarcted cardiomyocytes of rats with myocardial infarction [8]. Researches have reported that fasudil can regulate macrophage polarization and improve myocardial fibrosis in mice [9]. However, there are few researches on oxidative damage of cardiomyocytes induced by H2O2 in fasudil. Therefore, this research mainly discusses the effect of fasudil on H2O2-induced myocardial injury. Rho protein is a small molecule guanylate binding protein, and Rho protein has GTPase activity and is expressed in mammalian tissue cells [10]. There are two states of Rho protein, one is the inactivation state bound to GDP (GDP-Rho), and the other is the activation state bound to GTP (GTP-Rho). ROCK is divided into two types: ROCK1 and ROCK2 [11]; activated ROCK can inhibit the activity of its downstream MYPT-1 through phosphorylation, while phosphorylated MYPT-1 can affect the contraction of blood vessels [12]. Studies have reported that the Rho/ROCK pathway plays an important role in cell movement, proliferation, and activation of cytokines [13]. Researches have confirmed that the Rho/ROCK signaling pathway is associated with cellular inflammation, OS, and apoptosis [14]. Therefore, fasudil has been studied as a specific inhibitor of the Rho/ROCK pathway in many fields.

2. Material and Methods

2.1. Cell Culture and Treatment

H9C2 cardiomyocytes (Cell Culture Center, Shanghai, China) were cultured in Dulbecco's modified Eagle's medium (DMEM) (Life Technology, Wuhan, China), medium containing 10% fetal bovine serum (FBS) (Life Technology, Wuhan, China) and 1% penicillin/streptomycin (Life Technology, Wuhan, China). H9C2 cardiomyocytes were evenly divided into three groups. When the cells were at the appropriate density, the H2O2 group and the fasudil group were treated with 200 μmol/L H2O2, and the Con group was added with the same amount of DMEM for 24 h. The H2O2+fasudil group was treated with fasudil (Qianmo Biotechnology, Hubei, China) for 3 hours before H2O2 treatment.

2.2. Drug Preparation

Fasudil was formulated into a stock solution with physiological saline and stored in a refrigerator at -20°C. And DMEM was diluted before use.

2.3. Cell Counting Kit (CCK-8) Assay

The optimal concentration and time of fasudil were determined by the CCK-8 (CCK-8, Construction, Nanjing, China) method. H9C2 cardiomyocytes growing in logarithmic phase were inoculated into a 96-well plate and cultured at a density of 100 μL/well for 24 h. Different concentrations of fasudil working solution were added to the plate. Each group was incubated with 10 μL of CCK-8 working solution for 1 h at 1 h, 3 h, 6 h, and 12 h, and the absorbance of the three groups was measured at 450 nm with a microplate reader.

2.4. Lactate Dehydrogenase (LDH), Malondialdehyde (MDA), and Catalase (CAT) Levels Were Determined

The supernatants of each group of cells were collected, and the supernatant was treated with a commercial kit according to the manufacturer's instructions (Jiancheng, Nanjing, China), and the levels of LDH, MDA, and CAT were measured with a microplate reader.

2.5. Superoxide Dismutase (SOD) Detection

H9C2 cardiomyocytes were transferred to a 6-well plate; after treatment, the supernatant was collected and centrifuged. The SOD level in the cells was measured according to the SOD Assay Kit manual (Jiancheng, Nanjing, China).

2.6. RNA Isolation and Real-Time Polymerase Chain Reaction (RT-PCR)

0.5 mL of Trizol (Thermo Fisher Scientific, Shanghai, China) was added into a 24-well plate per well and shaken on ice for 10 minutes, then the liquid in each hole was collected in the EP tube without enzyme, and 0.1 mL chloroform was added to each tube, turned it upside down for 15 seconds, and placed it on top of the ice for 10 minutes. The mixture was centrifuged at 4°C (13,000 rpm, 15 min), the upper aqueous phase was aspirated, and an equal amount of isopropanol was added. The mixture was shaken for 30 seconds and allowed to stand at room temperature for 10 minutes. Then, centrifuged for another 10 minutes and discarded the supernatant. After washing the RNA pellet with 75% ethanol, it was centrifuged at 4°C (13,000 rpm, 10 min). The liquid was discarded and dissolved by the 20 μL of ribonuclease-free water. RNA concentration was measured immediately, and the absorbance at 260 nm and 280 nm was measured. If the A260/A280 was between 1.8 and 2.0, the RNA quality was considered to be standard and can be used in subsequent experiments. mRNA quantitative analysis was achieved using the Prism 7300 Sequence Detection System, using a designed reaction system, including SYBR green, positive and negative strand primers, enzyme-free water (Thermo Fisher Scientific, Shanghai, China), and template DNA. Quantitative amplification was performed under specific PCR conditions. Data were normalized using endogenous glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The comparison threshold period (Ct) method, that is, the 2- method was used to calculate the folding magnification, and the data was analyzed by the SDS software. RT-PCR primers are shown in Table 1.
Table 1

RT-PCR primers.

Gene nameForward (5′ > 3′)Reverse (5′ > 3′)
BaxCAGTTGAAGTTGCCATCAGCCAGTTGAAGTTACCATCAGC
Bcl-2GACTGAGTACCTGAACCGGCATCCTGAGCAGCGTCTTCAGAGACA
Sirt1CCAGATCCTCAAGCCATGTTGGATTCCTGCAACCTG
SOD1GGTGAACCAGTTGTGTTGTCCCGTCCTTTCCAGCAGTC
SOD2CAGACCTGCCTTACGACTATGGCTCGGTGGCGTTGAGATTGTT
P53CAAAATGGTGAAGGTCGGTGTGGATGTTAGTGGGGTCTCGCTC
ROCK1AGATATGGCAAACAGGATTCTTCACAAGATGAGGCAC
ROCK2CTAGAGTGCCGTAGATGCCAGGTTCTAGGGGATGATCGGG
GAPDHACAACTTTGGTATCGTGGAAGGGCCATCACGCCACAGTTTC

qRT-PCR: quantitative reverse-transcription polymerase chain reaction.

2.7. Western Blotting

After adding 200 μL of the lysate to the 6-well plate, it was allowed to stand for 20 minutes on ice, and the liquid was collected and centrifuged (13,000 rpm, 15 min); then, the supernatant was collected. The concentration of the protein was determined by the bicinchoninic acid (BCA) (Camilo Biological, Nanjing, China) method and quantified. The protein was separated using a 10% sodium dodecyl sulfate-polyacrylamide gel, then transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA, USA) for 2 hours at 4°C. 5% skim milk was prepared with Tris-buffered saline with Tween-20 (TBST) to block the specific antigen for 2 hours. After washing with TBST for 1 minute, PVDF membranes were incubated with a specific primary antibody (SOD1, Abcam, Rabbit; 1 : 3000; SOD2, Abcam, Rabbit, 1 : 3000; GPX1, US 1 : 1000, CST; GPX3, US 1 : 1000, CST; Bcl-2, Abcam, Rabbit, 1 : 2000; Bax, Abcam, Rabbit, 1 : 500; Sirt1, Bioworld, mouse, 1 : 500, China; P53, Abcam, Rabbit, 1 : 2000; ROCK1, Abcam, Rabbit, 1 : 500; ROCK2, Abcam, Rabbit, 1 : 1000; MYPT-1, Abcam, Rabbit, 1 : 1000; GAPDH US 1 : 1000 CST) at 4°C overnight. The next day, TBST was washed for 30 minutes. Specific proteins were detected by secondary antibodies and observed by the electrochemiluminescence (ECL) (Pierce, Rockford, IL, USA) system.

2.8. Immunofluorescence

The plate was washed with phosphate-buffered saline (PBS) once, and H9C2 cardiomyocytes were fixed with 4% paraformaldehyde for 30 minutes, and then, goat serum was added to sealing for 1 hour. The diluted primary antibody 8-hydroxydeoxyguanosine (8-OHdG, Abcam, Rabbit, 1 : 500) was added to incubate at 4°C overnight. The next day, the combined secondary antibody was incubated for 1 hour in the dark and stained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Shanghai, China) for nuclear staining. Finally, the film was sealed with a sealing liquid, and the image was observed under a fluorescence microscope (Olympus, Tokyo, Japan).

2.9. Enzyme-Linked Immunosorbent Assay (ELISA)

H9C2 cardiomyocytes were plated at 5,000/well in 6-well plates, and the cells were treated differently. The concentration of GPX1 and GPX3 in the cell supernatant was measured according to the instructions using an ELISA kit (Elabscience, Wuhan, China).

2.10. Reactive Oxygen Species (ROS) Level Detection

Flow cytometry was used to detect intracellular ROS levels. After different treatments of the three groups of cells, H9C2 cardiomyocytes were collected and washed with cold PBS. Total ROS levels were measured using flow cytometry (Becton Dickinson, Heidelberg, Germany) by intubation at 37°C for 20 min using DCFH-DA (10 M Kaiji, Nanjing, China).

2.11. Statistical Analysis

SPSS 21.0 statistical software (SPSS IBM, Armonk, NY, USA) was used to analyze the experimental data. Measurement data is expressed as χ ± s; t-test was used for comparisons between the two groups. Comparison between multiple groups was done using the one-way ANOVA test followed by the post hoc test (least significant difference). The LSD test or SNK test was used for pairwise comparison under the condition of homogeneity of variance. p < 0.05 indicated the significant difference. All experiments were repeated 3 times.

3. Results

3.1. Fasudil Retards Degradation of H9C2 Cardiomyocytes In Vitro

The optimal concentration and optimal culture time point of fasudil-treated H9C2 cardiomyocytes were detected by CCK-8 (Figure 1(a)). We found that the highest cell viability was achieved after 3 hours of incubation with 20 μmol∗L−1. LDH and CAT kits were used to detect cell supernatants. The results showed that LDH was significantly increased in the H2O2 group. CAT levels in the H2O2 group were significantly lower than in the Con group, while fasudil treatment significantly inhibited the reduction of CAT levels and inhibited the rise of LDH (Figures 1(b) and 1(c)).
Figure 1

Fasudil retards degradation of H9C2 cardiomyocytes in vitro. (a) The optimal concentration and time of UTI were determined by the CCK-8 assay. (b) LDH kit detects the supernatant LDH content. (c) CAT kit detects the content of the supernatant CAT level (“∗” indicates statistical difference from the control group p < 0.05, and “#” indicates statistical difference from the ischemic hypoxia group p < 0.05).

3.2. Fasudil Inhibits Oxidative Stress Induced by H2O2 in H9C2 Cardiomyocytes

We detected antioxidant proteins by WB. Compared with the Con group, the expression of SOD1, SOD2, GPX1, and GPX3 in the H2O2 group was significantly decreased, while fasudil significantly promoted the expression of SOD1, SOD2, GPX1, and GPX3 (Figures 2(a) and 2(b)). The mRNA results were similar to the former: the SOD1 and SOD2 mRNA levels were decreased in the H2O2 group; compared with the Con group, the SOD1 and SOD2 mRNA levels in the H2O2+fasudil group were significantly increased (Figures 2(c) and 2(d)). ELISA results show that GPX1 and GPX3 were decreased in the H2O2 group, but the expression of GPX1 and GPX3 was obviously increased in the H2O2+fasudil group (Figures 2(e) and 2(f)).
Figure 2

Fasudil inhibits oxidative stress induced by H2O2 in H9C2 cardiomyocytes. (a, b) Western blot was used to detect the expression of SOD1, SOD2, GPX1, and GPX3 in three groups. GAPDH was used as an internal control. (c, d) SOD1 and SOD2 mRNA expression was determined by real-time PCR. (e, f) ELISA detects the expression of GPX1 and GPX3 (“∗” indicates statistical difference from the control group p < 0.05, and “#” indicates statistical difference from the ischemic hypoxia group p < 0.05).

3.3. Fasudil Inhibits H2O2-Induced Oxidative Damage in H9C2 Cardiomyocytes

First, SOD and MDA levels were measured in the supernatant (Figures 3(a) and 3(b)). It was found that the SOD content was significantly decreased in the H2O2 group and significantly increased in the H2O2+fasudil group, while the MDA content was increased in the H2O2 group, and after fasudil treatment, the MDA content was decreased significantly. Flow cytometry results showed that the ROS levels were significantly increased in the H2O2 group, while ROS levels were significantly lower in the H2O2+fasudil group (Figure 3(c)). Immunofluorescence showed that the expression of 8-OHdG in the H2O2 group was significantly brighter than the Con group, while fasudil can effectively inhibit the expression of 8-OHdG in the H2O2+fasudil group (Figure 3(d)).
Figure 3

Fasudil inhibits H2O2-induced oxidative damage in H9C2 cardiomyocytes. (a) The SOD kit detects the level of cellular SOD. (b) The MDA kit detects the MDA content of the supernatant. (c) Flow cytometry was used to detect ROS levels. (d) Immunofluorescence was used to detect the expression of 8-OHdG in the three groups (“∗” indicates statistical difference from the control group p < 0.05, and “#” indicates statistical difference from the ischemic hypoxia group p < 0.05).

3.4. Fasudil Inhibits H2O2-Induced Apoptosis of H9C2 Cardiomyocytes

WB results showed that H2O2 treatment could induce apoptosis of H9C2 cardiomyocytes. The expression of Bax in the H2O2 group was significantly increased, while the expression of Bcl-2 was significantly inhibited. The treatment of H9C2 cardiomyocytes with fasudil can effectively inhibit the increase of Bax and promote the expression of Bcl-2 (Figures 4(a) and 4(b)). Similar levels were obtained for mRNA levels (Figures 4(c) and 4(d)).
Figure 4

Fasudil inhibits H2O2-induced apoptosis of H9C2 cardiomyocytes. (a, b) Western blot was used to detect the expression of Bcl-2 and Bax in the three groups. GAPDH was used as an internal control. (c, d) Bcl-2 and Bax mRNA expression was determined by real-time PCR (“∗” indicates statistical difference from the control group p < 0.05, and “#” indicates statistical difference from the ischemic hypoxia group p < 0.05).

3.5. Fasudil Inhibits H2O2-Induced Senescence of H9C2 Cardiomyocytes

First, we detected senescence-associated proteins: Sirt1 and P53. Compared with the Con group, Sirt1 expression was significantly inhibited in the H2O2 group, and P53 expression was significantly promoted. In the H2O2+fasudil group, Sirt1 expression was significantly increased, and P53 expression was inhibited compared to the H2O2 group (Figures 5(a) and 5(b)). Second, Sirt1 mRNA was inhibited in the H2O2 group, while the P53 mRNA was significantly increased. However, in the H2O2+fasudil group, Sirt1 mRNA was higher than the H2O2 group, and P53 mRNA expression was inhibited (Figures 5(c) and 5(d)).
Figure 5

Fasudil inhibits H2O2-induced senescence of H9C2 cardiomyocytes. (a, b) Western blot was used to detect the expression of Sirt1 and P53 in the three groups. GAPDH was used as an internal control. (c, d) Sirt1 and P53 mRNA expression was determined by real-time PCR (“∗” indicates statistical difference from the control group p < 0.05, and “#” indicates statistical difference from the ischemic hypoxia group p < 0.05).

3.6. Fasudil Inhibits Rho/ROCK Pathway Activation

We found that ROCK1 and ROCK2 expression was significantly increased in the H2O2 group, and the expression of ROCK1 and ROCK2 was significantly inhibited in the H2O2+fasudil group. Next, we detected the downstream molecule MYPT-1 and p-MYPT-1, and the results showed that the expression ratio of p-MYPT-1/MYPT-1 was significantly increased in the H2O2 group, while fasudil can effectively inhibit the expression ratio of p-MYPT-1/MYPT-1 (Figure 6(a)). In addition, ROCK1 and ROCK2 mRNA was significantly elevated in the H2O2 group but was all inhibited by fasudil (Figures 6(c) and 6(d)).
Figure 6

Fasudil inhibits Rho/ROCK pathway activation. (a) Western blot analysis of ROCK1, ROCK2, p-MYPT-1, and MYPT-1 expression in three groups. GAPDH was used as an internal control. (b) Protein gray value ratio of p-MYPT-1/MYPT-1. (c, d) ROCK1 and ROCK2 mRNA expression was determined by real-time PCR (“∗” indicates statistical difference from the control group p < 0.05, and “#” indicates statistical difference from the ischemic hypoxia group p < 0.05).

4. Discussion

Previous studies have suggested that cell necrosis and apoptosis are the main ways of myocardial damage, but in recent years, extensive research confirmed that OS is another major way of myocardial cell damage [15]. Studies have found that a large number of ROS in the central and surrounding tissues of heart disease patients with heart disease indicate that OS is also one of the main causes of myocardial infarction [16]. Therefore, inhibition of cardiomyocyte OS response is essential for the prevention of cardiovascular disease. To further investigate the mechanism of H2O2-induced OS in cardiomyocytes and to explore new interventions, we constructed a model by treating H9C2 cardiomyocytes with H2O2. Compared with the Con group, the antioxidant capacity of the H2O2 group was significantly reduced, and the apoptosis and senescence were significantly increased. As an inhibitor of the Rho/ROCK pathway, fasudil significantly increases the antioxidant capacity and effectively inhibits H2O2-induced apoptosis and senescence, as well as DNA damage. However, the molecular mechanism of fasudil in preventing H2O2-induced myocardial injury and its protective effects is still unclear and further research is needed. The results confirm that fasudil reduces H2O2-induced H9C2 cardiomyocyte OS by three aspects: (1) Fasudil improves cell clearance of ROS. (2) Fasudil can inhibit cell apoptosis, thereby reducing cell senescence. (3) Fasudil inhibits the Rho/ROCK signaling pathway and reduces H2O2-induced OS, thereby protecting H9C2 cardiomyocytes. H2O2 is often used in cardiovascular disease models such as myocardial ischemia and myocardial ischemia and reperfusion [17]. Studies have shown that ROS can upregulate the expression of caspase family proteins by inhibiting Bcl-2 expression and promoting the transfer of Bax to mitochondria to induce the release of cytochrome C and initiate the mitochondrial apoptosis program [18]. The results of this experiment confirmed that Bax expression in the H2O2 group was significantly increased, but the Bax expression in the fasudil group was significantly inhibited, and the expression of antiapoptotic Bcl-2 was promoted. Previous research confirmed that H2O2 produces OS damage to H9C2 cardiomyocytes. The ROS induced by H2O2 is cytotoxic, and ROS can cause destruction or even cleavage of DNA in the nucleus, eventually leading to apoptosis of a large number of H9C2 cardiomyocytes [19]. We confirmed by immunofluorescence that H2O2 treatment can significantly increase DNA damage in H9C2 cardiomyocytes, while the expression of 8-OHdG in the fasudil group was effectively inhibited, and slowing apoptosis. A large number of articles reported that senescent was also one of the independent risk factors for cardiovascular disease. H2O2-induced oxidative damage can better simulate OS in the elderly, thereby promoting cell senescence [20]. This experiment verified the expression levels of senescence-associated molecule P53 and anti-senescence-related molecule Sirt1. Results show that Sirt1 expression was significantly decreased in the H2O2 group, while P53 expression was significantly increased. Fasudil treatment significantly inhibited the elevation of P53 and promoted the expression of Sirt1. The results showed that fasudil inhibited H2O2-induced H9C2 cardiomyocyte senescence, thereby alleviating H2O2 damage to H9C2 cardiomyocytes. Rho kinase belongs to the serine/threonine protein kinase ACG family, which is an important effector downstream of RhoA of small GTP protein family [21]. Numerous researches have reported that the Rho/ROCK pathway is related in the regulation of inflammation and OS [22]. The results of this experiment show that H9C2 OS increased significantly after H2O2 treatment, which may be related to the activation of the Rho/ROCK pathway and the increase of downstream-related molecules. We confirmed that ROCK1 and ROCK2 expression in the H2O2 group and its downstream p-MYPT-1 was significantly prompted, while the ROCK kinase inhibitor fasudil was effective in inhibiting the increase of ROCK1, ROCK2, and p-MYPT-1 and inhibiting H2O2-induced H9C2 cardiomyocyte OS response.

5. Conclusions

Fasudil inhibits Rho/ROCK signaling and reduces OS, thereby inhibiting cell senescence and apoptosis. Therefore, fasudil is of great value in the intervention of hypoxic cardiomyopathy.
  22 in total

Review 1.  Rho GTPases and their effector proteins.

Authors:  A L Bishop; A Hall
Journal:  Biochem J       Date:  2000-06-01       Impact factor: 3.857

Review 2.  RhoA/Rho-Kinase in the Cardiovascular System.

Authors:  Hiroaki Shimokawa; Shinichiro Sunamura; Kimio Satoh
Journal:  Circ Res       Date:  2016-01-22       Impact factor: 17.367

3.  Myosin phosphatase target subunit 1 (MYPT1) regulates the contraction and relaxation of vascular smooth muscle and maintains blood pressure.

Authors:  Yan-Ning Qiao; Wei-Qi He; Cai-Ping Chen; Cheng-Hai Zhang; Wei Zhao; Pei Wang; Lin Zhang; Yan-Ze Wu; Xiao Yang; Ya-Jing Peng; Ji-Min Gao; Kristine E Kamm; James T Stull; Min-Sheng Zhu
Journal:  J Biol Chem       Date:  2014-06-20       Impact factor: 5.157

Review 4.  The role of mitochondrial dysfunction in cardiovascular disease: a brief review.

Authors:  Dimitry A Chistiakov; Tatiana P Shkurat; Alexandra A Melnichenko; Andrey V Grechko; Alexander N Orekhov
Journal:  Ann Med       Date:  2017-12-18       Impact factor: 4.709

Review 5.  Cardiac oxidative stress and inflammatory cytokines response after myocardial infarction.

Authors:  Margherita Neri; Vittorio Fineschi; Marco Di Paolo; Cristoforo Pomara; Irene Riezzo; Emanuela Turillazzi; Daniela Cerretani
Journal:  Curr Vasc Pharmacol       Date:  2015       Impact factor: 2.719

6.  The matrikine N-acetylated proline-glycine-proline induces premature senescence of nucleus pulposus cells via CXCR1-dependent ROS accumulation and DNA damage and reinforces the destructive effect of these cells on homeostasis of intervertebral discs.

Authors:  Chencheng Feng; Yang Zhang; Minghui Yang; Minghong Lan; Huan Liu; Jian Wang; Yue Zhou; Bo Huang
Journal:  Biochim Biophys Acta Mol Basis Dis       Date:  2016-10-19       Impact factor: 5.187

7.  Long-term inhibition of Rho-kinase suppresses left ventricular remodeling after myocardial infarction in mice.

Authors:  Tsuyoshi Hattori; Hiroaki Shimokawa; Midoriko Higashi; Junko Hiroki; Yasushi Mukai; Hiroyuki Tsutsui; Kozo Kaibuchi; Akira Takeshita
Journal:  Circulation       Date:  2004-04-19       Impact factor: 29.690

8.  Cardiac Specific Overexpression of Mitochondrial Omi/HtrA2 Induces Myocardial Apoptosis and Cardiac Dysfunction.

Authors:  Ke Wang; Yuexing Yuan; Xin Liu; Wayne Bond Lau; Lin Zuo; Xiaoliang Wang; Lu Ma; Kun Jiao; Jianyu Shang; Wen Wang; Xinliang Ma; Huirong Liu
Journal:  Sci Rep       Date:  2016-12-07       Impact factor: 4.379

9.  Hydrogen Peroxide-Responsive Nanoparticle Reduces Myocardial Ischemia/Reperfusion Injury.

Authors:  Soochan Bae; Minhyung Park; Changsun Kang; Serkan Dilmen; Tae Hi Kang; Dong Goo Kang; Qingen Ke; Seung Uk Lee; Dongwon Lee; Peter M Kang
Journal:  J Am Heart Assoc       Date:  2016-11-14       Impact factor: 5.501

Review 10.  Rho GTPases: masters of cell migration.

Authors:  Amine Sadok; Chris J Marshall
Journal:  Small GTPases       Date:  2014-06-30
View more
  4 in total

1.  Epigallocatechin Gallate Relieved PM2.5-Induced Lung Fibrosis by Inhibiting Oxidative Damage and Epithelial-Mesenchymal Transition through AKT/mTOR Pathway.

Authors:  Zhou Zhongyin; Wang Wei; Xiong Juan; Fan Guohua
Journal:  Oxid Med Cell Longev       Date:  2022-06-06       Impact factor: 7.310

2.  Knockdown of ILK Alleviates High Glucose-Induced Damage of H9C2 Cells through TLR4/MyD88/NF-κB Pathway.

Authors:  Qiang Yin; Zhendong Li; Shaoying Lu
Journal:  Dis Markers       Date:  2022-05-05       Impact factor: 3.464

3.  Circ_0000064 promotes high glucose-induced renal tubular epithelial cells injury to facilitate diabetic nephropathy progression through miR-532-3p/ROCK1 axis.

Authors:  Huanlan Wang; Shenghua Huang; Taotao Hu; Shizhi Fei; Huanqiao Zhang
Journal:  BMC Endocr Disord       Date:  2022-03-15       Impact factor: 2.763

Review 4.  Signaling Pathways Related to Oxidative Stress in Diabetic Cardiomyopathy.

Authors:  Meng-Ling Peng; Yu Fu; Chu-Wen Wu; Ying Zhang; Hang Ren; Shan-Shan Zhou
Journal:  Front Endocrinol (Lausanne)       Date:  2022-06-15       Impact factor: 6.055

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.