| Literature DB >> 34884525 |
Mari Gogniashvili1, Yoshihiro Matsuoka2, Tengiz Beridze1.
Abstract
The aim of the presented study is a genetic characterization of the hexaploid wheat Triticum aestivum L. Two approaches were used for the genealogical study of hexaploid wheats-the complete sequencing of chloroplast DNA and PCR-based haplotype analysis of the fourth intron of Wknox1d and of the fifth-to-sixth-exon region of Wknox1b. The complete chloroplast DNA sequences of 13 hexaploid wheat samples were determined: Free-threshing-T. aestivum subsp. aestivum, one sample; T. aestivum subsp. compactum, two samples; T. aestivum subsp. sphaerococcum, one sample; T. aestivum subsp. carthlicoides, four samples. Hulled-T. aestivum subsp. spelta, three samples; T. aestivum subsp. vavilovii jakubz., two samples. The comparative analysis of complete cpDNA sequences of 20 hexaploid wheat samples (13 samples in this article plus 7 samples sequenced in this laboratory in 2018) was carried out. PCR-based haplotype analysis of the fourth intron of Wknox1d and of the fifth-to-sixth exon region of Wknox1b of all 20 hexaploid wheat samples was carried out. The 20 hexaploid wheat samples (13 samples in this article plus 7 samples in 2018) can be divided into two groups-T. aestivum subsp. spelta, three samples and T. aestivum subsp. vavilovii collected in Armenia, and the remaining 16 samples, including T. aestivum subsp. vavilovii collected in Europe (Sweden). If we take the cpDNA of Chinese Spring as a reference, 25 SNPs can be identified. Furthermore, 13-14 SNPs can be identified in T. aestivum subsp. spelta and subsp. vavilovii (Vav1). In the other samples up to 11 SNPs were detected. 22 SNPs are found in the intergenic regions, 2 found in introns, and 10 SNPs were found in the genes, of which seven are synonymous. PCR-based haplotype analysis of the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b provides an opportunity to make an assumption that hexaploid wheats T. aestivum subsp. macha var. palaeocolchicum and var. letshckumicum differ from other macha samples by the absence of a 42 bp insertion in the fourth intron of Wknox1d. One possible explanation for this observation would be that two Aegilops tauschii Coss. (A) and (B) participated in the formation of hexaploids through the D genome: Ae. tauschii (A)-macha (1-5, 7, 8, 10-12), and Ae. tauschii (B)-macha M6, M9, T. aestivum subsp. aestivum cv. 'Chinese Spring' and cv. 'Red Doly'.Entities:
Keywords: Illumina; SNP; Triticum aestivum L.; Wknox1 gene; chloroplast DNA; sequencing
Mesh:
Substances:
Year: 2021 PMID: 34884525 PMCID: PMC8657936 DOI: 10.3390/ijms222312723
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
List of hexaploid wheats.
| Species | Genome | Plasmon | |
|---|---|---|---|
| Hulled | GGAuAuAmAm | G | |
| Hulled | |||
| BBAuAuDD | B | ||
| T. | |||
| Free-threshing | |||
Jacubciner’s classification system (1958) According to Yen a. Yang [2].
| Congretio | Species | Distribution Areas | Habits |
|---|---|---|---|
| Hexaploidea | Cultivated hulled | ||
| 2n = 42 | Georgia | Springness | |
| Georgia | Winterness | ||
| Iran, south Germany, Spain | Winterness, Springness | ||
| Cultivated naked grain | |||
| All over the world | Springness, winterness, half winterness | ||
| Transcaucasia, Kazakhstan, Asia Minor, Afghan, Chile | Springness, winterness, half-winterness | ||
| Armenia | Winterness | ||
| Pakistan, India | Springness |
Hexaploid wheat accessions used in the study.
| Botanical Name | GenBank Accession Number | ||
|---|---|---|---|
| Hulled | |||
| M1 | LC372826 | ISU | |
| M2 | LC373211 | ISU | |
| M3 | LC375536 | ISU | |
| M4 | LC374397 | ISU | |
| M5 | LC375773 | ISU | |
| M6 | NC_025955 | ISU | |
| M7 | ISU | ||
| M8 | ISU | ||
| M9 | ISU | ||
| M10 | ISU | ||
| M11 | ISU | ||
| M12 | ISU | ||
| Splt2 | LC625352 | PI 348000 | |
| Splt1 | LC625353 | PI 348220 | |
| Splt3 | LC625866 | PI 191393 | |
| Vav1 | LC621349 | PI 326319 | |
| Vav2 | LC625865 | PI 428342 | |
| Free-threshing | |||
| RD | LC377169 | ISU | |
| CS | LC622404 | ||
| Cc1 | LC621350 | PI 262678 | |
| Cc3 | LC621195 | SRCA | |
| Cc2 | LC622405 | PI 532901 | |
| Cc4 | LC621194 | SRCA | |
| Com2 | LC623766 | KU-9873 | |
| Com1 | LC623764 | ISU | |
| Sph1 | LC623765 | Cltr17737 | |
Figure 1Complete chloroplast genome phylogeny of hexaploid wheats.
SNPs specific for chloroplast DNA of hexaploid wheats.
| Nucleotide Position According to CS | Locus | CS | M6 | Vav1 | Cc2 | Cc1, | RD | Sph1 | M2, | M4 | M1 | Com1 | Com2 | Splt1 | Splt2 | Splt3 | Vav2 | Amino Acid Substitution |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2903 | Gene | G | C | A–G | ||||||||||||||
| 3400 | Intergenic | C | A | A | A | A | ||||||||||||
| 4918 | Intron | T | C | |||||||||||||||
| 13,015 | Intergenic | T | C | C | C | C | ||||||||||||
| 14,580 | Intergenic | C | G | |||||||||||||||
| 15,371 | Intergenic | A | G | G | G | G | ||||||||||||
| 16,481 | Intergenic | C | T | T | T | T | ||||||||||||
| 20,853 | Gene | C | T | T | T | T | Syn | |||||||||||
| 25,444 | Gene | C | A | A | A | A | Syn | |||||||||||
| 32,710 | Intergenic | C | T | |||||||||||||||
| 44,509 | Intergenic | C | A | |||||||||||||||
| 45,856 | Intergenic | A | C | C | C | C | ||||||||||||
| 46,434 | Intergenic | G | T | T | T | T | ||||||||||||
| 47,628 | Intergenic | G | A | A | G | G | G | G | ||||||||||
| 50,332 | Intergenic | G | T | T | T | T | ||||||||||||
| 50,716 | Intergenic | T | C | C | C | C | ||||||||||||
| 52,295 | Gene | G | T | T | T | T | Q–K | |||||||||||
| 56,472 | Intergenic | A | G | G | G | G | G | |||||||||||
| 56,670 | Intergenic | C | T | T | T | T | ||||||||||||
| 63,289 | Gene | A | T | T | T | T | Syn | |||||||||||
| 64,318 | Intergenic | C | T | T | T | T | ||||||||||||
| 72,207 | Intergenic | C | T | T | T | T | ||||||||||||
| 73,742 | Intergenic | T | C | C | C | C | ||||||||||||
| 78,113 | Intron | C | T | T | T | T | ||||||||||||
| 78,732 | Intergenic | G | T | T | T | T | ||||||||||||
| 82,499 | Intergenic | T | G | |||||||||||||||
| 100,961 | Gene | T | G | Syn | ||||||||||||||
| 102,561 | Gene | C | T | T | T | Syn | ||||||||||||
| 104,993 | Intergenic | A | C | C | C | C | ||||||||||||
| 105,477 | Intergenic | C | A | A | A | A | ||||||||||||
| 106,672 | Gene | C | T | T | T | T | Syn | |||||||||||
| 113,487 | Gene | T | G | Syn | ||||||||||||||
| 114,943 | Gene | A | C | F–L | ||||||||||||||
| 133,405 | Intergenic | A | C |
Indels specific for chloroplast DNA of hexaploid wheats.
| Nucleotide Position According to CS | Locus | CS | M6 | Vav1 | Cc2 | Cc1, | RD | Sph1 | M2, | M4 | M1 | Com2 | Com1 | Splt1 | Splt2 | Splt3 | Vav2 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 4175 | Intergenic | - | AAAAT | AAAAT | AAAAT | AAAAT | |||||||||||
| 7422 | Intergenic | 15T | 18T | 12T | 12T | 12T | |||||||||||
| 8219 | Intergenic | 10T | 11T | ||||||||||||||
| 8407 | Intergenic | - | TATTTCT | ATTTCT | ATTTCT | ATTTCT | ATTTCT | ||||||||||
| 11,183 | Intergenic | 14A | 13A | 13A | 13A | 13A | |||||||||||
| 17,991 | Intergenic | 10A | 11A | 11A | 11A | 11A | 11A | 11A | 11A | ||||||||
| 18,757 | Intergenic | 19C | 9C | 8C | 8C | ||||||||||||
| 31,609 | Intergenic | 12T | 11T | ||||||||||||||
| 32,442 | Intergenic | +A | +A | +A | +A | ||||||||||||
| 33,718 |
| 14A | 13A | 13A | 13A | 13A | 12A | ||||||||||
| 42,920 |
| 10T | 9T | 9T | 9T | ||||||||||||
| 42,931 |
| 3T | 2T | ||||||||||||||
| 45,993 | Intergenic | 8A | 9A | 9A | 9A | 9A | |||||||||||
| 47,788 | Intergenic | 15A | 14A | 11A | 11A | 11A | 10A | ||||||||||
| 56,724 | Intergenic | 10T | 9T | ||||||||||||||
| 60,767 | Intergenic | +CATT | +CATT | +CATT | +CATT | ||||||||||||
| 60,773 | Intergenic | 17T | 16T | 16T | 16T | 16T | 16T | 16T | 16T | 16T | 16T | 15T | 16T | ||||
| 62,041 | Intergenic | - | +TA | +TA | +TA | +TA | |||||||||||
| Duplication_70,856 | Intron | TATT | TATT | TATT | TATT | ||||||||||||
| 71,219 | Intron | 6T | 7T | 7T | 7T | 7T | |||||||||||
| 73,586 | Intergenic | 5T | 6T | 6T | 6T | 6T | |||||||||||
| 75,699 | Intergenic | 10A | 11A | 11A | 11A | ||||||||||||
| 76,051-62_duplication | CTGTCATATTTT | ||||||||||||||||
| 76,599 | Intergenic | 10T | 11T | 11T | 11T | 9T | 9T | 9T | |||||||||
| 77,140 | Intergenic | 10T | 9T | 9T | 9T | 9T | 9T | ||||||||||
| 86,581 |
| 5T | 4T | ||||||||||||||
| 104,113 | Intergenic | 13A | 11A | 12A | 14A | ||||||||||||
| 129,319 |
| 5A | 4A |
Inversions and a long insertion specific for chloroplast DNA of hexaploid wheats.
| Nucleotide Position According to CS | Locus | Splt1, Splt2, Splt3, Vav2 | Length | |
|---|---|---|---|---|
| 79,532 | Gene | GATGGATCTAAAGGTTATTTAGATTTCTTTACTAT | Insertion | 35 bp |
| 105,139–105,196 | Intergenic | ACTTTTCATAATTTTCATAATAGAATCCT | Inversion with 14 bp loop | 58 bp |
| 106,795–106,819 | Intergenic | AAAACCTTCATGAAATGAAGGTTTT | Inversion with 3 bp loop | 25 bp |
| 135,896-52 | Intergenic | AAAGACAGAAATACCCAATATCTTGCTA | Inversion with 6 bp loop | 56 bp |
PCR-based haplotype analysis of the fourth intron of Wknox1d. A 122-bp MITE insertion specifically observed at the D-genome locus of Wknox1 generates the upper bands (411 bp) in hexaploid wheat accessions (except Triticum aestivum L. subsp. compactum) and 453 bp in macha accessions.
| Sample | PCR Product, bp | ||||
|---|---|---|---|---|---|
| 277, 284 | 375 | 400 | 411 | 453 | |
| + | + | + | |||
| + | + | + | |||
| + | + | + | |||
| + | |||||
| + | + | + | |||
| + | + | + | |||
| + | + | + | |||
| + | + | + | |||
| + | + | + | |||
| + | + | + | |||
| + | + | + | |||
| + | |||||
| + |
Figure 2Image of 2% agarose gel electrophoresis of PCR-amplified fourth intron of Wknox1d DNA region of hexaploid wheat. Lanes: 2—T. turgidum subsp. carthlicum, 3—T. turgidum subsp. durum (Ldn), 4—T. aestivum subsp. aestivum (CS), 5—T. aestivum subsp. carthlicoides, 6—T. aestivum subsp. carthlicoides, 7—T. aestivum subsp. macha (M_6), 8—T. aestivum subsp. macha (M_9), 9—T. aestivum subsp. macha (M_1), 10—T. aestivum subsp. macha (M_2), 11—T. aestivum subsp. macha (M_3); Lanes 1, 12—100 bp DNA marker.
PCR-based haplotype analysis of the fifth-to-sixth exon region of Wknox1b.
| Sample | PCR Product, bp | |||
|---|---|---|---|---|
| 410 | 429, 430 | 560 | 588 | |
| + | + | + | ||
| + | + | + | ||
| + | ||||
| + | + | + | ||
| + | ||||
| + | + | + | ||
| + | ||||
| + | ||||
| + | + | + | ||
| + | + | |||
| + | + | + | ||
| + | ||||
| + | + | + | ||
Hexaploid wheats with matching values of fourth intron of Wknox1d and fifth-to-sixth exon region of Wknox1b.