Literature DB >> 34884525

Genetic Analysis of Hexaploid Wheat (Triticum aestivum L.) Using the Complete Sequencing of Chloroplast DNA and Haplotype Analysis of the Wknox1 Gene.

Mari Gogniashvili1, Yoshihiro Matsuoka2, Tengiz Beridze1.   

Abstract

The aim of the presented study is a genetic characterization of the hexaploid wheat Triticum aestivum L. Two approaches were used for the genealogical study of hexaploid wheats-the complete sequencing of chloroplast DNA and PCR-based haplotype analysis of the fourth intron of Wknox1d and of the fifth-to-sixth-exon region of Wknox1b. The complete chloroplast DNA sequences of 13 hexaploid wheat samples were determined: Free-threshing-T. aestivum subsp. aestivum, one sample; T. aestivum subsp. compactum, two samples; T. aestivum subsp. sphaerococcum, one sample; T. aestivum subsp. carthlicoides, four samples. Hulled-T. aestivum subsp. spelta, three samples; T. aestivum subsp. vavilovii jakubz., two samples. The comparative analysis of complete cpDNA sequences of 20 hexaploid wheat samples (13 samples in this article plus 7 samples sequenced in this laboratory in 2018) was carried out. PCR-based haplotype analysis of the fourth intron of Wknox1d and of the fifth-to-sixth exon region of Wknox1b of all 20 hexaploid wheat samples was carried out. The 20 hexaploid wheat samples (13 samples in this article plus 7 samples in 2018) can be divided into two groups-T. aestivum subsp. spelta, three samples and T. aestivum subsp. vavilovii collected in Armenia, and the remaining 16 samples, including T. aestivum subsp. vavilovii collected in Europe (Sweden). If we take the cpDNA of Chinese Spring as a reference, 25 SNPs can be identified. Furthermore, 13-14 SNPs can be identified in T. aestivum subsp. spelta and subsp. vavilovii (Vav1). In the other samples up to 11 SNPs were detected. 22 SNPs are found in the intergenic regions, 2 found in introns, and 10 SNPs were found in the genes, of which seven are synonymous. PCR-based haplotype analysis of the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b provides an opportunity to make an assumption that hexaploid wheats T. aestivum subsp. macha var. palaeocolchicum and var. letshckumicum differ from other macha samples by the absence of a 42 bp insertion in the fourth intron of Wknox1d. One possible explanation for this observation would be that two Aegilops tauschii Coss. (A) and (B) participated in the formation of hexaploids through the D genome: Ae. tauschii (A)-macha (1-5, 7, 8, 10-12), and Ae. tauschii (B)-macha M6, M9, T. aestivum subsp. aestivum cv. 'Chinese Spring' and cv. 'Red Doly'.

Entities:  

Keywords:  Illumina; SNP; Triticum aestivum L.; Wknox1 gene; chloroplast DNA; sequencing

Mesh:

Substances:

Year:  2021        PMID: 34884525      PMCID: PMC8657936          DOI: 10.3390/ijms222312723

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   5.923


1. Introduction

Wheat is the leading grain crop in the world. It originated in the Fertile Crescent approximately 10,000 years ago and has since spread worldwide. There are two biological species of hexaploidy wheat—T. aestivum, genome BBAuAuDD and Triticum zhukovskyi Menabde & Ericz., GGAuAuAmAm. T. zhukovskyi and its predecessors (Triticum monococcum L. and Triticum timopheevii (Zhuk.) Zhuk.) form a separate lineage irrelevant to the evolution of the principal wheat lineage, which is formed by T. aestivum and its predecessors Aegilops tauschii Coss. And Triticum turgidum L. [1]. The T. aestivum lineage is divided into the domesticated, hulled lineage and the free-threshing lineage. The free-threshing lineage includes T. aestivum subsp. Aestivum, T. aestivum subsp. Compactum (Host) Mackey, T. aestivum subsp. Sphaerococcum (Percival) Mackey, and T. aestivum subsp. carthlicoides nom. nud. (Table 1 and Table 2).
Table 1

List of hexaploid wheats.

SpeciesGenomePlasmon
HulledT. zhukovskyi GGAuAuAmAmG
HulledT. aestivum
T. aestivum subsp. spelta Thell.BBAuAuDDB
T. aestivum subsp. macha (Dekapr. and Menabde) Mackey
T. aestivum subsp. vavilovii Jakubz.
Free-threshingT. aestivumT. aestivum subsp. aestivum
T. aestivum subsp. compactum (Host) Mackey
T. aestivum subsp. sphaerococcum (Percival) Mackey
T. aestivum subsp. carthlicoides nom. nud.
Table 2

Jacubciner’s classification system (1958) According to Yen a. Yang [2].

CongretioSpeciesDistribution AreasHabits
HexaploideaCultivated hulled
2n = 42T. zhukovskyi Men.et Er.GeorgiaSpringness
T. macha Dek.et Men.GeorgiaWinterness
T. spelta L.Iran, south Germany, SpainWinterness, Springness
Cultivated naked grain
T. aestivum L.All over the worldSpringness, winterness, half winterness
T. compactum HostTranscaucasia, Kazakhstan, Asia Minor, Afghan, ChileSpringness, winterness, half-winterness
T. vavilovii Jakubz.ArmeniaWinterness
T. sphaerococcum Perc.Pakistan, IndiaSpringness
Hexaploid wheat T. aestivum subsp. carthlicoides was found by Kuckuck [3] near the border of Turkey, Armenia and West Georgia. This hexaploid wheat showed the subsp. carthlicum-like spike morphology. The hulled lineage includes spelt wheat T. aestivum subsp. spelta Thell., macha T. aestivum subsp. macha (Dekapr. and Menabde) Mackey and T. aestivum subsp. vavilovii Jakubz. In hulled wheats, glumes tenaciously enclose seeds, and strong mechanical force is needed to liberate seeds from glumes during threshing. According to Dekaprelevich, Georgia is characterized by the largest number of cultivated wheat species in the world; altogether, 12 species of are found here. Only three narrowly endemic species, Triticum abyssinicum Vav., T. sphaerococcum and T. spelta, are absent [4]. South Caucasus (notably Georgia) and its earlier residents played an important role in wheat formation. In total, 17 domesticated species and subspecies of Triticum are known. Georgian endemic wheat species include one Triticum species and four subspecies [5,6,7]: Triticum turgidum subsp. palaeocolchicum (Menabde) A. Love Triticum turgidum subsp. carthlicum (Nevski) A. Love Triticum timopheevii subsp. zhukovskyi (Menabde & Ericzjan) L. B. Cai Triticum zhukovskyi Menabde & Ericzjan Triticum aestivum subsp. macha (Dekapr. & Menabde) McKey All these cultivated species and subspecies have been found only in West Georgia, except subsp. carthlicum which has been distributed in East Georgia as well. All these species and subspecies grew in the territory of Georgia until the middle of the last century. The “Wheat Enigma” was a term for the observation that wild predecessors of five Georgian endemic wheat subspecies are found in Fertile Crescent, quite far from the South Caucasus [8,9]. One possibility to explain the “Wheat Enigma” is that speakers of ProtoGeorgian language could have moved to Mesopotamia after migration from Africa to the Arabian Peninsula, where wheat was domesticated. Furthermore, they could have migrated to South Caucasus together with domesticated wheat subspecies [9,10]. The examination of genealogical data provides insights into the evolutionary history of a species. The wide application of gene genealogies for evolutional studies in plants involves identifying DNA sequences with levels of ordered variation within chloroplast, mitochondrial, or nuclear genomes [11]. Traditionally, extranuclear DNA, such as chloroplast DNA (cpDNA), has been considered as an effective tool for genealogic studies [12,13,14]. The sequences of wheat plasmons B and G (complete cpDNA sequences) of the genus Triticum were determined in our laboratory [8,15,16]. Plasmon B is detected in polyploid species—Triticum turgidum and T. aestivum. Plasmon of T. zhukovskyi belong to the G type. Another effective tool for gene genealogy studies for Triticum species is the three homoeologous loci of wheat Wknox1 gene, functioning at shoot apical meristems (SAM) [17]. A comparative study of the three Wknox1 genomic sequences revealed accumulation of numerous mutations, particularly in the fourth intron and the 5′-upstream region. Later, Takumi a. Morimoto [18] reported the discovery of a new allele for the fifth-to-sixth exon region of the Wknox1b KNOTTED1-type homeobox gene in a common wheat subspecies (T. aestivum subsp. carthlicoides). The purpose of the present investigation was to carry out the comparative analysis of complete cpDNA sequences of 20 hexaploid wheat accessions (T. aestivum subsp. aestivum, two samples; T. aestivum subsp. compactum, two samples; T. aestivum subsp. sphaerococcum, one sample; T. aestivum subsp. carthlikoides, four samples; T. aestivum subsp. spelta, three samples; T. aestivum subsp. macha, six samples; T. aestivum subsp. vavilovii, two samples. The second aim of the present investigation was to carry out a PCR-based haplotype analysis of the fourth intron of Wknox1d and of the fifth-to-sixth exon region of Wknox1b of all 20 hexaploid wheat samples.

2. Results

2.1. Complete cpDNA Sequence of Hexaploid Wheats

For comparative analysis of chloroplast DNA of hexaploid wheats, 20 hexaploid wheat samples were selected. CpDNA sequences from 13 of them were sequenced in this study, and the remaining 7 were sequenced earlier [15] (Table 3).
Table 3

Hexaploid wheat accessions used in the study.

Botanical NameGenBank Accession Number
Hulled
M1Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. megrelicum (Menabde)LC372826ISU
M2Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. georgicum (Menabde)LC373211ISU
M3Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. colchicum (Dekapr. and Menabde)LC375536ISU
M4Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. scharaschidzei (Menabde)LC374397ISU
M5Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. palaeoimereticum (Dekapr. and Menabde)LC375773ISU
M6Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. palaeocolchicum (Dekapr. and Menabde)NC_025955ISU
M7Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. ericzjanae Menabde ISU
M8Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. ibericum Dekapr. and Menabde ISU
M9Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. letshchumicum Dekapr. and Menabde ISU
M10Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. subcolchicum Dekapr. and Menabde ISU
M11Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. submegrelicum Dekapr. and Menabde ISU
M12Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. subletshchumicum Dekapr. and Menabde ISU
Splt2Triticum aestivum L. subsp. spelta (L.) Thell.LC625352PI 348000
Splt1Triticum aestivum L. subsp. spelta (L.) Thell.LC625353PI 348220
Splt3Triticum aestivum L. subsp. spelta (L.) Thell.LC625866PI 191393
Vav1Triticum vavilovii Jakubz.LC621349PI 326319
Vav2Triticum vavilovii Jakubz.LC625865PI 428342
Free-threshing
RDTriticum aestivum L. subsp. aestivum var. ferrugineum (Alef.) Mansf. cv. ‘Red Doly’LC377169ISU
CSTriticum aestivum L. subsp. aestivum cv. ‘Chinese Spring’LC622404
Cc1Triticum aestivum L. subsp. carthlicoides nom. nud.LC621350PI 262678
Cc3Triticum aestivum L. subsp. carthlicoides nom. nud.LC621195SRCA
Cc2Triticum aestivum L. subsp. carthlicoides nom. nud.LC622405PI 532901
Cc4Triticum aestivum L. subsp. carthlicoides nom. nud.LC621194SRCA
Com2Triticum aestivum L. subsp. compactum (Host) MackeyLC623766KU-9873
Com1Triticum aestivum L. subsp. compactum (Host) MackeyLC623764ISU
Sph1Triticum aestivum L. subsp. sphaerococcum (Percival) MackeyLC623765Cltr17737
The samples were structured as follows: free-threshing—T. aestivum subsp. aestivum, two samples—Chinese Spring and Red Doly; T. aestivum subsp. compactum—two samples; T. aestivum subsp. sphaerococcum—one sample; T. aestivum subsp. carthlicoides—four samples; Hulled—T. aestivum subsp. spelta—three samples; T. aestivum subsp. vavilovii two samples; T. aestivum subsp. macha—six samples. To illustrate the evolutionary relationship among the studied cultivars, a phylogenetic tree was constructed based on complete nucleotide sequences of cpDNA of 20 hexaploid wheat samples (Figure 1).
Figure 1

Complete chloroplast genome phylogeny of hexaploid wheats.

If we take the cpDNA of Chinese Spring as a reference, 25 SNPs can be identified. Furthermore, 13–14 SNPs can be identified in T. aestivum subsp. Spelta and subsp. Vavilovii (Vav1) (collected in Armenia) (Table 4). In the other samples, up to 11 SNPs were detected. In total, 22 SNPs are found in the intergenic regions, 2 were found in introns, and 10 SNPs were found in the genes, of which seven are synonymous and do not alter the amino acids. Indels specific for 20 cpDNA are given in Table 5.
Table 4

SNPs specific for chloroplast DNA of hexaploid wheats.

Nucleotide Position According to CSLocusCSM6Vav1Cc2Cc1,Cc3,Cc4RDSph1M2,M3,M5M4M1Com1Com2Splt1Splt2Splt3Vav2Amino Acid Substitution
2903Gene matKG C A–G
3400Intergenic matK-trnK-UUUC AAAA
4918Intron rps16T C
13,015Intergenic trnfM-CAT-trnT-GGTT CCCC
14,580Intergenic trnfM-CAT-trnT-GGTC G
15,371Intergenic trnY-GTA-trnD-GTCA GGGG
16,481Intergenic trnD-GTC-psbMC TTTT
20,853Gene rpoBC TTTTSyn
25,444Gene rpoC2C AAAASyn
32,710Intergenic atpH-atpFC T
44,509Intergenic ycf3 trnS-GGAC A
45,856Intergenic rps4-trnT-TGTA CCCC
46,434Intergenic trnT-TGT trnF-GAAG TTTT
47,628Intergenic trnT-TGT-trnF-GAAG AA GGGG
50,332Intergenic ndhC-trnM-CATG TTTT
50,716Intergenic ndhC-trnM-CATT CCCC
52,295Gene atpBG TTTTQ–K
56,472Intergenic rbcL-psaIA G GGGG
56,670Intergenic rbcL-psaIC TTTT
63,289Gene petGA TTTTSyn
64,318Intergenic psaJ-rpl33C TTTT
72,207Intergenic petB-petDC TTTT
73,742Intergenic petD-rpoAT CCCC
78,113Intron rpl16C TTTT
78,732Intergenic rpl16-rps3G TTTT
82,499Intergenic rpl23-trnI-CATT G
100,961Gene rps15T G Syn
102,561Gene ndhFC TTT Syn
104,993Intergenic rpl32-trnL-TAGA CCCC
105,477Intergenic rpl32-trnL-TAGC AAAA
106,672Gene ccsAC TTTTSyn
113,487Gene ndhHT GSyn
114,943Gene rps15A C F–L
133,405Intergenic trnI-CAT-rpl23A C
Table 5

Indels specific for chloroplast DNA of hexaploid wheats.

Nucleotide Position According to CSLocusCSM6Vav1Cc2Cc1,Cc3,Cc4RDSph1M2,M3,M5M4M1Com2Com1Splt1Splt2Splt3Vav2
4175Intergenic matK-rps16- AAAATAAAATAAAATAAAAT
7422Intergenic psbI-trnS-GCT15T 18T12T12T12T
8219Intergenic trnS-GCT-psbD10T 11T
8407Intergenic trnS-GCT-psbD- TATTTCT ATTTCTATTTCTATTTCTATTTCT
11,183Intergenic psbC-trnS-TGA14A 13A 13A13A13A
17,991Intergenic petN-trnC-GCA10A11A 11A 11A 11A11A11A11A
18,757Intergenic trnC-GCA-rpoB19C 9C8C8C
31,609Intergenic atpI-atpH12T 11T
32,442Intergenic atpH-atpF +A+A+A+A
33,718 Intron atpH 14A 13A 13A13A13A12A
42,920 I intron ycf3 10T 9T9T9T
42,931 I intron ycf3 3T 2T
45,993Intergenic rps4-trnT-TGT8A 9A9A9A9A
47,788Intergenic trnF-GAA-ndhJ15A 14A 11A11A11A10A
56,724Intergenic rbcL-psaI10T 9T
60,767Intergenic petA psbJ +CATT+CATT+CATT+CATT
60,773Intergenic petA-psbJ17T16T16T16T16T16T 16T16T16T16T15T 16T
62,041Intergenic psbE-petL- +TA+TA+TA+TA
Duplication_70,856Intron petB TATTTATTTATTTATT
71,219Intron petB6T 7T7T7T7T
73,586Intergenic petD-rpoA5T 6T6T6T6T
75,699Intergenic rpl36-infA10A 11A11A11A
76,051-62_duplication Intergenic infA-rps8 CTGTCATATTTT
76,599Intergenic rps8-rpl1410T 11T 11T11T 9T9T9T
77,140Intergenic rpl14-rpl1610T 9T9T9T9T9T
86,581 Intron ndhB 5T 4T
104,113Intergenic ndhF-rpl3213A 11A12A14A
129,319 Intron ndhB 5A 4A
One 35bp insertion and three inversions (56bp, 58bp and 25bp in length) have been identified in Triticum aestivum subsp. spelta (Splt1, Splt2, Splt3) and T. aestivum subsp. vavilovii (Vav2) samples (Table 6). One 38bp inversion (TCGGCTCAATCTTTTTTTTCTAAAAAAGATTGAGCCGA) with a 4bp loop has been identified in T. aestivum subsp. vavilovii (Vav1) (collected in Armenia) in the position 56,120–56,157 (intergenic rbcL—psaI).
Table 6

Inversions and a long insertion specific for chloroplast DNA of hexaploid wheats.

Nucleotide Position According to CSLocusSplt1, Splt2, Splt3, Vav2 Length
79,532Gene rpl22GATGGATCTAAAGGTTATTTAGATTTCTTTACTATInsertion35 bp
105,139–105,196Intergenic rpl32—trnL-TAGACTTTTCATAATTTTCATAATAGAATCCTCATATTTTATTATGAAAATTATGAAAAGTInversion with 14 bp loop58 bp
106,795–106,819Intergenic ccsA—ndhDAAAACCTTCATGAAATGAAGGTTTTInversion with 3 bp loop25 bp
135,896-52Intergenic rps19—psbAAAAGACAGAAATACCCAATATCTTGCTAGAACAAGATATTGGGTATTTCTGTCTTTInversion with 6 bp loop56 bp
This section may be divided into subheadings. It should provide a concise and precise description of the experimental results, their interpretation, as well as the experimental conclusions that can be drawn.

2.2. PCR Analysis of Three Homoeologous Loci of Wheat Wknox1 Gene

2.2.1. Wknox1d Fourth Intron Region

In the present investigation, the genomic sequences of the Wknox1d fourth intron regions were amplified by PCR using the primer pair of Takumi a. Morimoto [18] (Table 7). A common wheat, T. aestivum subsp. aestivum cv. ‘Chinese Spring’ (CS), and a durum wheat, T. turgidum subsp. durum cv. ‘Langdon’ (Ldn), were used for PCR as control and the amplified DNA fragments were visualized on an agarose gel. In the fourth intron of Wknox1d in common wheat, a 122-bp MITE insertion has been reported [17]. The MITE-containing band (411 bp) was missing in all tetraploid wheat accessions and was observed in all subspecies of common wheat. In the case of subsp. macha (11 samples) the 453 bp band was observed. In the case of two macha samples (M6 and M9) the MITE-containing band typical for other hexaploid subspecies (411 bp) were detected.
Table 7

PCR-based haplotype analysis of the fourth intron of Wknox1d. A 122-bp MITE insertion specifically observed at the D-genome locus of Wknox1 generates the upper bands (411 bp) in hexaploid wheat accessions (except Triticum aestivum L. subsp. compactum) and 453 bp in macha accessions.

SamplePCR Product, bp
277, 284375400411453
Triticum aestivum subsp.aestivum cv. ‘Chinese Spring’ (CS)++ +
Triticum aestivum subsp. aestivum var. ferrugineum (Alef.) Mansf. cv. ‘Red Doly’ (RD)++ +
Triticum aestivum subsp. carthlicoides (Cc1, Cc2. Cc3. Cc4)++ +
Triticum aestivum subsp. compactum (Com2)+
Triticum aestivum subsp. compactum (Com1)++ +
Triticum aestivum subsp. sphaerococcum (Sph1)++ +
Triticum aestivum subsp. macha (M6, M9)++ +
Triticum aestivum subsp. macha (M1, M2, M3, M4, M5, M7, M8 M10, M11, M12)+ + +
Triticum aestivum subsp. spelta (splt1, splt2, splt3)++ +
Triticum vavilovii (Arm) (Vav1)++ +
Triticum vavilovii (Eur) (Vav2)++ +
Triticum turgidum subsp. carthlicum var. rubiginosum+
Triticum turgidum subsp. durum cv. ‘Langdon’ (Ldn)+
In 2% agarose-gel, the PCR-amplified, fourth intron of the Wknox1d DNA region of hexaploid wheat gives four bands: N1 (280 bp), N2 (375 bp), N3 (411 bp), and N4 (453). Bands N3 and N4 were cut out and sequenced. In the case of band N4 (453), a 42 bp insertion was detected in the position 7009—AGTTTGCACACCTGAACATTTTGCATTATGTTCGGGAGCCTA (Figure 2).
Figure 2

Image of 2% agarose gel electrophoresis of PCR-amplified fourth intron of Wknox1d DNA region of hexaploid wheat. Lanes: 2—T. turgidum subsp. carthlicum, 3—T. turgidum subsp. durum (Ldn), 4—T. aestivum subsp. aestivum (CS), 5—T. aestivum subsp. carthlicoides, 6—T. aestivum subsp. carthlicoides, 7—T. aestivum subsp. macha (M_6), 8—T. aestivum subsp. macha (M_9), 9—T. aestivum subsp. macha (M_1), 10—T. aestivum subsp. macha (M_2), 11—T. aestivum subsp. macha (M_3); Lanes 1, 12—100 bp DNA marker.

2.2.2. Fifth-to-Sixth Exon Region of Wknox1b

PCR-based haplotype analysis of the fifth-to-sixth exon region of Wknox1b showed that the 157-bp MITE inserted band (588 bp) is present in T. turgidum subsp. durum cv. ‘Langdon’; CS; Red Doly (Table 8). This band is absent in tetraploid T. turgidum subsp. carthlicum, T. aestivum L. subsp. carthlicoides, T. aestivum subsp. macha (M1–M13).
Table 8

PCR-based haplotype analysis of the fifth-to-sixth exon region of Wknox1b.

SamplePCR Product, bp
410429, 430560588
Triticum aestivum subsp.aestivum cv. ‘Chinese Spring’ (CS) +++
Triticum aestivum subsp. aestivum var. ferrugineum cv. ‘Red Doly’ (RD) +++
Triticum aestivum subsp. carthlicoides (Cc1, Cc2, Cc3, Cc4) +
Triticum aestivum subsp. compactum (Com2) +++
Triticum aestivum subsp. compactum (Com1) +
Triticum aestivum subsp. sphaerococcum (Sph1) +++
Triticum aestivum subsp. macha (M6, M9) +
Triticum aestivum subsp. macha (M1, M2, M3, M4, M5, M7, M 8, M10, M11, M12) +
Triticum aestivum subsp. spelta (splt1, splt2, splt3) +++
Triticum vavilovii (Arm) (Vav1)++
Triticum vavilovii (Eur) (Vav2) +++
Triticum turgidum subsp. carthlicum var. rubiginosum +
Triticum turgidum subsp. durum cv. ‘Langdon’ (Ldn) +++
Hexaploid wheats with matching values of the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b are given in Table 9.
Table 9

Hexaploid wheats with matching values of fourth intron of Wknox1d and fifth-to-sixth exon region of Wknox1b.

Triticum aestivum subsp. carthlicoides (Cc1, Cc2, Cc3, Cc4)
Triticum aestivum subsp. compactum (Host) (Com1)
Triticum aestivum subsp. macha (M6, M9)
Triticum vavilovii (Arm) (Vav1)

3. Discussion

It is widely believed that the birthplace of T. aestivum is in a region between Transcaucasia and southwestern Caspian Iran [19]. The first step in the evolution of cultivated wheat was the formation in northern Mesopotamia of a tetraploid species with an AuAuBB genome [20]. Approximately 7000 years ago, the hexaploid bread wheat T. aestivum L. (BBAuAuDD) arose in southwestern Caspian Iran and Transcaucasia by allopolyploidization of the cultivated Emmer wheat Triticum dicoccum Schrank with the Caucasian Ae. tauschii [19,21,22,23,24]. It should be noted that Ae. tauschii was found in the western Caucasus as well [25,26]. According to authors “Ae. squarrosa (Ae. tauschii) grows in lowlands and mountain foothills, rarely in dry and humid silty areas up to the middle of the mountain, mainly in desert, semi-desert and field vegetation, as well as weeds in Abkhazia, Samegrelo, Imereti, Guria, Adjara, Kartli, in outer Kakheti, Gardabani” [25]. It can be assumed that two Ae. tauschii (A) and (B) participated in the formation of hexaploids through the D genome: Ae. tauschii (A)—macha (1–5, 7, 8, 10–12)—and Ae. tauschii (B)—macha M6, M9, CS, RD (Table 3 and Table 7). T. aestivum subsp. catrhlicoides most likely originated in western Transcaucasia [3]; In 1967 Kuckuck had found populations with carthlicium and carthlicoides types near the border of East Turkey (Ardahan and Kars Provinces, Turkey) and West Georgia. This hexaploid wheat accession showed the subsp. carthlicum-like morphology. Subsp. carthlicum was proposed to have originated from spontaneous hybridization between subsp. carthlicoides and cultivated emmer wheat, T. turgidum subsp. dicoccon (Schrank) Thell. Subsp. carthlicoides should be considered as the original and elder genotype from which genes for this particular morphology of the ear were transferred together with the Q-factor to T. carthlicum [3,18]. According to Kuckuck, this region was distinguished by a tremendous genetic variation in wheat including T. dicoccum, T. carthlicum and T. aestivum subsp. macha [3]. It can be assumed that subsp. carthlicoides took part in the formation of the subsp. macha as an ancestor. One of the four subspecies of wheat detected in Georgia is hexaploid, domesticated, hulled wheat T. aestivum subsp. macha [15]. This subspecies was detected in West Georgia in 1928 and described by Dekaprelevich and Menabde [27]. It is endemic to Georgia and is cultivated along with tetraploid West Georgian wheat (T. turgidum subsp. palaeocolchicum) [28]. It is proposed that macha and West Georgian wheats are sibling cultivars that arose in a hybrid swarm involving T. aestivum and wild emmer wheat [29]. It is accepted that spelt wheat is derived from free-threshing hexaploid wheat (T. aestivum subsp. aestivum) by hybridization with hulled emmer (T. turgidum). Experimental data suggest that European and Asian spelt may be polyphyletic. Free-threshing, hexaploid wheat seems to precede spelt. At least some European spelt originated from hybridization of club wheat (T. aestivum subsp. compactum) with emmer (domesticated hulled Triticum turgidum). Free-threshing hexaploid wheat was an ancestor of not only European spelt but also of some of the Asian forms of spelt, although the exact role free-threshing wheat has played is debatable [1]. The comparative analysis of complete nucleotide sequence 20 samples of hexaploid wheats offers the opportunity to draw several conclusions: 20 hexaploid wheat samples are divided into two groups—Triticum aestivum subsp. spelta three samples + T. aestivum subsp. vavilovii (Vav1) (collected in Armenia), and the remaining 16 samples including T. aestivum subsp. vavilovii (Vav2) (Collected in Sweden). Hirosawa et al. [30] found two cpDNA SSR lineages in T. aestivum: Plastogroup I and II. Most subsp. aestivum, compactum, macha, and sphaerococcum accessions belonged to Plastogroup I. Subspecies spelta was split into Plastogroup I (70% of accessions examined) and Plastogroup II (30%). So, given the numbers of subsp. spelta accessions used (27 accessions in Hirosawa et al. and 3 in our work), the cpDNA trees (Hirosawa et al.’s and ours) appear quite consistent. Plastogroup I (and our major lineage) might represent a major lineage that was transmitted from cultivated T. turgidum via hybrid cross with Ae. tauschii and its subsequent allopolyploidization. Plastogroup II (and our minor lineage) might have resulted from introgression between hexaploid and tetraploid wheats, because subsp. spelta has the emmer wheat ancestry in Europe and Asia [1]. PCR-based haplotype analysis of the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b of all 20 hexaploid wheat samples was carried out. PCR-based haplotype analysis of the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b provides an opportunity to make an assumption that hexaploid wheats T. aestivum subsp. macha var. palaeocolchicum and var. letshckumicum differ from other macha samples by the absence of a 42 bp insertion in the fourth intron of Wknox1d. It can be assumed that two Ae. tauschii (A) and (B) participated in the formation of hexaploids through the D genome: Ae. tauschii (A)—macha (1–5, 7,8,10–12)—and Ae. tauschii (B)—macha M6, M9, T. aestivum subsp. aestivum cv. ‘Chinese Spring’ and cv. ‘Red Doly’. Another possible explanation would be that the insertion might have arisen during the diversification process of common wheat after polyploidization. In recent years, wheat yields have not increased per hectare, which is important due to the growing world population. Transferring agronomically important genes from wild relatives to common wheat has been shown to be an effective genetic resource for hexaploid wheat improvement. Advances in new technologies have made the complete wheat reference genome available, which offers a promising future for the study of wheat improvement which is essential to meet global food demand [31].

4. Materials and Methods

4.1. Plant Material, DNA Isolation, PCR Analysis, Genomic DNA Library Preparation and Sequencing on an Illumina NovaSeq 6000 Platform

The seeds of hexaploid wheat samples were received from the seed bank of The Agricultural University of Georgia (the late Prof. P. Naskidashvili) and Institute of Botany (Ilia State University, Tbilisi, Georgia) (ISU); The U.S. National Plant Germplasm System (GRINGlobal); The National BioResource Project—WHEAT Centre (Graduate School of Agriculture, Kyoto University, Kyoto, Japan); The Scientific Research Center of Agriculture (SRCA) (Georgia) and Tel Aviv University (Israel). The seeds were germinated in water at room temperature. Total genomic DNA extraction from young leaves, the construction of genomic DNA libraries and assembly of cpDNA have been described earlier [15,31]. An automatic annotation of cpDNA was performed by CpGAVAS [32]. For detection of SNPs (single nucleotide polymorphism) and Indels (insertion/deletion) and phylogeny tree construction, computer programs Mafft and Blast were used [33,34].

4.2. Construction of Shotgun Genomic DNA Libraries

Construction of 13 shotgun genomic libraries and sequencing on the NovaSeq 6000 was carried out at the Roy J. Carver Biotechnology Center, University of Illinois at Urbana-Champaign (UIUC). The shotgun genomic DNA libraries were constructed from 50 ng of DNA after sonication with a Covaris ME220 (Covaris, MA, USA) to an average fragment size of 400 bp with the Hyper Library Preparation Kit from Kapa Biosystems (Roche, CA, USA). To prevent index switching, the libraries were constructed using unique dual-indexed adaptors from Illumina (San Diego, CA, USA). The individually barcoded libraries were amplified with 6 cycles of PCR and run on a Fragment Analyzer (Agilent, CA, USA) to confirm the absence of free primers and primer dimers and to confirm the presence of DNA of the expected size range. Libraries were pooled in equimolar concentration and the pool was further quantitated by qPCR on a BioRad CFX Connect Real-Time System (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

4.3. Sequencing of Libraries in the NovaSeq

The pooled, barcoded, shotgun libraries were loaded on a NovaSeq SP lane for cluster formation and were sequenced for 150 cycles from each side of the DNA fragments. The fastq read files were generated and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina, San Diego, CA, USA).

4.4. PCR Analysis of Three Homoeologous Wheat Wknox1 Gene

The genomic sequences of the Wknox1d 4th intron regions were amplified by PCR using the primer pair of Takumi a. Morimoto [18]: 5′-AAAAAAAAGGTTAAATGGAC-3′ and 5′-ACCTTATACATGATTGGGAA-3′. The Wknox1b 5th-to-6th exon region was amplified by PCR using the primer pair 5′-GCTGAAGCACCATCTCCTGA-3′ and 5′-CATGTAGAAGGCGGCGTTAG-3′. The DNA fragments (PCR products) were excised from the agarose gel. The DNA extraction and purification from the agarose gel was performed by the QIAquick Gel Extraction Kit (QIAGEN). PCR products were purified with GenElute PCR Clean-Up Kit (Sigma-Aldrich), dye labeled using a Big Dye Terminator Kit (Applied Biosystems), and sequenced on Applied Biosystems 3700 genetic analyzer (Laboratory Services Division of the University of Guelph, Guelph, ON, Canada).

5. Conclusions

Based on complete chloroplast DNA sequences, the 20 hexaploid wheat samples can be divided into two groups—T. aestivum subsp. spelta three samples + T. aestivum subsp. vavilovii collected in Armenia, and the remaining 16 samples, including T. aestivum subsp. vavilovii collected in Europe (Sweden). Based on the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b hexaploid wheats, T. aestivum subsp. macha var. palaeocolchicum and var. letshckumicum were found to differ from other macha samples by the absence of a 42 bp insertion in the fourth intron of Wknox1d. Two Aegilops tauschii Coss. (A) and (B) participated in the formation of hexaploids through the D genome: Ae. tauschii (A)—macha (1–5, 7, 8, 10–12)—and Ae. tauschii (B)—macha M6, M9, T. aestivum subsp. aestivum cv. ‘Chinese Spring’ and cv. ‘Red Doly’.
  16 in total

1.  Gene genealogies and population variation in plants.

Authors:  B A Schaal; K M Olsen
Journal:  Proc Natl Acad Sci U S A       Date:  2000-06-20       Impact factor: 11.205

2.  Intra- and interspecific phylogenetic relationships among diploid Triticum-Aegilops species (Poaceae) based on base-pair substitutions, indels, and microsatellites in chloroplast noncoding sequences.

Authors:  Kyoko Yamane; Taihachi Kawahara
Journal:  Am J Bot       Date:  2005-11       Impact factor: 3.844

3.  Chloroplast and nuclear DNA variation in common wheat: insight into the origin and evolution of common wheat.

Authors:  Shujiro Hirosawa; Shigeo Takumi; Takashige Ishii; Taihachi Kawahara; Chiharu Nakamura; Naoki Mori
Journal:  Genes Genet Syst       Date:  2004-10       Impact factor: 1.517

4.  Ultraconserved words point to deep language ancestry across Eurasia.

Authors:  Mark Pagel; Quentin D Atkinson; Andreea S Calude; Andrew Meade
Journal:  Proc Natl Acad Sci U S A       Date:  2013-05-06       Impact factor: 11.205

5.  The origin of spelt and free-threshing hexaploid wheat.

Authors:  Jan Dvorak; Karin R Deal; Ming-Cheng Luo; Frank M You; Keith von Borstel; Hamid Dehghani
Journal:  J Hered       Date:  2012-02-29       Impact factor: 2.645

6.  Geographic mosaics and changing rates of cereal domestication.

Authors:  Robin G Allaby; Chris Stevens; Leilani Lucas; Osamu Maeda; Dorian Q Fuller
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2017-12-05       Impact factor: 6.237

7.  Genealogical use of chloroplast DNA variation for intraspecific studies of Aegilops tauschii Coss.

Authors:  Yoshihiro Matsuoka; Naoki Mori; Taihachi Kawahara
Journal:  Theor Appl Genet       Date:  2005-05-14       Impact factor: 5.699

8.  Aegilops tauschii single nucleotide polymorphisms shed light on the origins of wheat D-genome genetic diversity and pinpoint the geographic origin of hexaploid wheat.

Authors:  Jirui Wang; Ming-Cheng Luo; Zhongxu Chen; Frank M You; Yuming Wei; Youliang Zheng; Jan Dvorak
Journal:  New Phytol       Date:  2013-02-04       Impact factor: 10.151

Review 9.  Genome plasticity a key factor in the success of polyploid wheat under domestication.

Authors:  Jorge Dubcovsky; Jan Dvorak
Journal:  Science       Date:  2007-06-29       Impact factor: 47.728

10.  MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization.

Authors:  Kazutaka Katoh; John Rozewicki; Kazunori D Yamada
Journal:  Brief Bioinform       Date:  2019-07-19       Impact factor: 11.622

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.