Literature DB >> 34852710

A novel circRNA-miRNA-mRNA network revealed exosomal circ-ATP10A as a biomarker for multiple myeloma angiogenesis.

Manya Yu1, Jie Yu2, Yanyu Zhang1, Xiaoqi Sun1, Runjie Sun1, Mengting Xia3, Sumei Li1, Xing Cui4.   

Abstract

The importance of angiogenesis in multiple myeloma (MM) is unquestionable; however, to date, the success of antiangiogenic therapies has been fairly limited. Exosomal circular RNAs (circRNAs) have been proven to be pivotal players in angiogenesis in various cancers. Nevertheless, their role in MM remains unknown. Therefore, we aimed to identify differentially expressed circRNAs in peripheral blood exosomes from MM patients and explore their diagnostic and prognostic values. We screened 2,052 circRNAs with significant differential expression between MM patients and healthy controls via high-throughput sequencing. qRT-PCR confirmed that the expression of circ-ATP10A was significantly increased in MM patients. The bioinformatics analyses suggested that circ-ATP10A can act as a microRNA (miRNA) sponge and regulate the expression of downstream vascular endothelial growth factor-B (VEGFB), hypoxia-inducible factor-1alpha (HIF1A), platelet-derived growth factor subunit A (PDGFA), and fibroblast growth factor (FGF). The immunohistochemical results indicated that the circ-ATP10A level was positively correlated with the protein levels of VEGFB and marrow microvessel density (MVD) in MM patients, and the receiver operating characteristic (ROC) curve, area under the ROC curve (AUC) and Kaplan-Meier survival curve analyses confirmed it as a prognostic biomarker. Collectively, our study indicates that exosomal circ-ATP10A is a valuable prognostic biomarker in MM and may promote MM angiogenesis by targeting hsa-miR-6758-3p/hsa-miR-3977/hsa-miR-6804-3p/hsa-miR-1266-3p/hsa-miR-3620-3p and modulating their downstream mRNAs, such as VEGFB, HIF1A, PDGF, and FGF.

Entities:  

Keywords:  Multiple myeloma; angiogenesis; biomarkers; circRNA; exosome

Mesh:

Substances:

Year:  2022        PMID: 34852710      PMCID: PMC8805983          DOI: 10.1080/21655979.2021.2012553

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   3.269


Introduction

Multiple myeloma (MM) is an incurable malignancy characterized by the accumulation of terminally differentiated plasma cells growing within a permissive bone marrow microenvironment (BMM). The interaction between MM cells and the BMM plays an important role in the pathogenesis, progression, and prognosis of MM[, [2]. Compared with those with quiescent monoclonal gammopathy of undetermined significance (MGUS) and smoldering multiple myeloma (SMM), the bone marrow microvessel density (MVD) in the BMM of MGUS and SMM patients who subsequently developed MM is increased at diagnosis, suggesting that angiogenesis in the BMM may be conducive to the switch from MGUS and SMM to MM3-[3,[4,5]]. Moreover, among patients receiving autologous transplantation as a frontline treatment, MVD at the initial diagnosis affects the overall survival (OS) and progression-free survival (PFS) [6]. Therefore, increased angiogenesis serves as a hallmark of BMM in MM, paving the way for the development of antiangiogenic therapeutics. A body of evidence indicates that thalidomide reduces MVD and exerts an antiangiogenic effect [7,8], and vascular endothelial growth factor (VEGF) monoclonal antibodies, such as bevacizumab, have been developed [9,10]. Despite the growing number of antiangiogenic drugs, to date, the success of antiangiogenic therapies has been fairly limited, providing only short-term remission (in terms of tumor growth) before resistance develops and generally achieving modest survival benefits [11,12]. Therefore, finding effective therapeutic targets is extremely urgent. Exosomes, which are extracellular vesicles with diameters of 40–100 nm, are released from various cell types into the surrounding extracellular space or circulate to distant locations [13]. Therefore, exosomes are widely distributed in blood and various body fluids and are key mediators of cell-to-cell communication that deliver bioactive molecules, such as proteins, mRNAs, microRNAs (miRNAs), circular RNAs (circRNAs), and lipids [14]. It has been reported that exosomes shed from bone marrow stromal cells (BMSCs) are involved in the viability, proliferation, survival, migration, and drug resistance of MM cells [15] and that exosomes derived from hypoxic MM cells enhance angiogenesis and modulate the BMM, thereby facilitating MM progression and inducing drug resistance [16,17]. The exosome cargo of noncoding RNA seems to play a relevant role in MM cell proliferation and the mechanisms of angiogenesis. There is a significant difference between MM patients and healthy individuals in terms of the levels of serum exosome-derived miRNAs, such as miR-20a-5p, miR-103a-3p, and miR-4505 [18]. Deng M provided new evidence suggesting that exosomal LINC00461 increased MM cell proliferation and suppressed apoptosis by targeting miR-15a/16 and BCL-2 [19]. In addition, it has been demonstrated that exosomal miR-135b shed from hypoxic multiple myeloma cells accelerates angiogenesis by targeting the hypoxia-inducible factor (HIF)/factor–inhibiting hypoxia-inducible factor (FIH) signaling pathway [16]. However, the role of exosomal circRNA in MM angiogenesis is unknown, and relatively few studies have been performed. As a novel class of functional molecules discovered in recent years, circRNAs have a special covalent loop structure without a 5′ cap and 3ʹ tail, are mainly from exons or introns, and are differentially generated by back splicing or lariat introns [20]. CircRNAs often show tissue/developmental stage-specific expression and can function specifically as microRNA (miRNA) sponges [21]. Increasing evidence reveals that circRNAs may participate in the pathogenesis and progression of MM, such as by modulating cell viability, proliferation, apoptosis, migration, drug resistance and bone lesion formation [22-26]. Here, we hypothesize that exosome-derived circRNAs might play a role in MM angiogenesis and may serve as novel diagnostic or prognostic biomarkers. We extracted and identified exosomes from the peripheral blood of MM patients and healthy people, performed high-throughput sequencing of circRNAs and used bioinformatics analyses to predict potentially valuable circRNAs and their underlying mechanism. The aim and goal of this research was to investigate serum exosomal circ-ATP10A in MM patients, which may promote MM disease progression by sponging miRNAs and regulating their targeted proangiogenic genes to promote angiogenesis and may be a promising biomarker for evaluating the pathogenesis and progression of MM.

Materials and methods

Patients and samples

In total, 25 peripheral blood samples were obtained from 20 MM patients (B1-B20) and 5 matched healthy controls (A1-A5) at the Department of Hematology, Affiliated Hospital of Shandong University of Traditional Chinese Medicine. All cases were diagnosed by experienced clinicians and met the diagnostic criteria for active MM established by the International Myeloma Working Group (IMWG). Patients with other diseases that result in M protein production were excluded, as were patients with SMM, or with severe cognitive impairment who were unable to communicate. The basic characteristics of the 20 patients are summarized in Table S1. For the serum collection, peripheral blood was collected in vacuum coagulation tubes, centrifuged at 2,500 rpm for 5 minutes, and then stored at −80°C for the exosome isolation. This study was approved by the ethics committee of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine (2020) ethical review No. (010) – KY, and informed consent was obtained from all participants.

Total exosome isolation

ExoQuick exosome precipitation kit (System Bioscience, Palo Alto, CA, USA) was used to isolate exosomes from serum as previously described [27]. According to the instructions, 250 μl serum was mixed with 63 μl ExoQuick solution, and incubated at 4°C for 30 minutes. The pellets of exosomes were collected by centrifuging the ExoQuick/serum mixture at 1500 g for 30 minutes and then for another 5 minutes, with the supernatant carefully aspirated each time. After that, the isolated exosomes were purified and eluted by purification columns

Transmission electron microscopy (TEM)

We fixed the exosomes purified from serum with 4% paraformaldehyde, washed them with PBS, and then placed them on formvar-/carbon 200-mesh copper grids at room temperature for 20 minutes. After fixing the samples in 1% glutaraldehyde for 5 minutes, we used ultrapure water to wash the grids 3 times and then used uranyl oxalate to stain for 5 minutes. Then, 4% uranyl acetate and 2% methylcellulose were added to the samples on ice at a ratio of 1:9, and the samples were allowed to dry before we finally utilized transmission electron microscopy (Hitachi, HT7700) to detect the exosomes [28].

Nanoparticle tracking analysis (NTA) of exosomes

The size distribution and concentration of the exosomes in the liquid suspension were measured using a NanoSight NS300 system (NanoSight, Amesbury, UK) according to the characteristics of light scattering and Brownian motion [29]. The sample was diluted 150–3000 times with Dulbecco’s PBS (DPBs) without any nanoparticles to reach a concentration of 1–20 × 108 capsules per ml for the analysis. Each sample was measured in triplicate using a high-sensitivity sCMOS camera configured with the NanoSight NS300 system to record and track each visible particle. The data were analyzed using NTA software (NanoSight version 2.3), and the exosome numbers and size distribution were calculated using the Stokes-Einstein equation.

Western blot (WB) analysis

The protein extraction from the exosomes from MM patient serum was performed by using RIPA lysis buffer (Sparkjade, Jinan, China) and quantified using bicinchoninic acid (BCA) protein assay kits (Beyotime, Shanghai, China) following the manufacturer’s protocol. We separated the protein samples via SDS-polyacrylamide gel electrophoresis. Then, the separated protein samples were transferred onto a polyvinylidene fluoride (PVDF) membrane (Sparkjade) and blocked in 5% nonfat milk powder for 2 h at room temperature, followed by incubation overnight at 4°C with primary antibodies against calnexin (Santa Cruz Biotechnology, USA), CD63 (Santa Cruz Biotechnology, USA) and TSG101 (Santa Cruz Biotechnology, USA) at a 1:1000 dilution. On the following day, the membrane was incubated with secondary antibodies (1:5000) (Beyotime) for 1 h [30]. Finally, the blot signals were visualized using an Alpha Innotech FluorChem Q imaging analysis system.

RNA-seq analysis

Six serum samples from MM patients and five samples from healthy control were sent to Cloud-Seq Biotech (Shanghai, China) for high-throughput sequencing and subsequent bioinformatics analyses. In brief, the total RNA from each sample was subjected to the Ribo-Zero rRNA Removal Kit (Illumina, San Diego, CA, USA) to remove ribosomal RNA before the construction of RNA-seq libraries. A TruSeq Stranded Total RNA Library Prep Kit (Illumina) was used for the preparation of the RNA libraries according to the manufacturer’s instructions. A BioAnalyzer 2100 system (Agilent Technologies, Palo Alto, CA, USA) was used to analyze the quantity and quality of the RNA libraries. Then, the libraries were reverse transcribed into cDNAs, captured by Illumina flow cells, amplified in situ, and finally sequenced using a HiSeq 4000 sequencing system (Illumina) with 150-bp paired reads.

Bioinformatics analyses

Using a FC ≥ 2.0 and P ≤ 0.05 as the criteria, the differentially expressed circRNAs between the two groups of samples were identified. A hierarchical clustering analysis was implemented using the gplots R package. The Gene Ontology (GO) database (www.geneontology.org) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (www.genome.jp/kegg) were used for the GO and KEGG enrichment analyses, respectively (P ≤ 0.05 was considered significant).

RNA isolation and quantitative real-time PCR (qRT-PCR)

The total RNA was isolated from exosomes with an RNA extraction kit (Sparkjade, Jinan, China) according to the manufacturer’s protocol. A NanoDrop2000 (Thermo) was used to measure the concentration and purity of the isolated RNA. These RNAs were then reverse-transcribed into cDNA by an RT kit (Sparkjade, Jinan, China). Quantitative real-time PCR was conducted using a Roche Light Cycler 480 real-time PCR system with a SYBR Green qPCR kit (Sparkjade, Jinan, China). Each sample was analyzed in triplicate, and the fold changes were calculated using the 2−(ΔΔCt) cycle threshold method. The sequences of the primers are shown in Table 1 [31].
Table 1.

Specific primers used for quantitative qRT-PCR

Gene nameForward primer sequence (5ʹ-3ʹ)Reverse primer sequence (5ʹ-3ʹ)
chr15:26,003,835–26,004,050-CAGGTGGTCGGAATGAGGCCACCTGCTCCACCCTTA
GAPDHGGCCTCCAAGGAGTAAGACCAGGGGAGATTCAGTGTGGTG
Specific primers used for quantitative qRT-PCR

Construction of the competing endogenous RNA (ceRNA) network

The circRNA–miRNA–mRNA regulatory network of one of the most upregulated circRNAs (chr15:26,003,835–26,004,050) was constructed by Cytoscape (3.8.2). MiRanda was used to predict the top five miRNAs with the strongest ability to bind circRNA, and then, TargetScan was used to predict the top 6000 mRNAs with the strongest ability to bind these miRNAs. To make the ceRNA network more concise and meaningful, we used the DAVID website to conduct a KEGG analysis of these mRNAs, selected the pathway with the largest number of enriched genes, and selected mRNAs in this pathway for the network mapping.

Immunohistochemistry

Immunohistochemistry was conducted using bone marrow tissue sections following previously described methods [32]. Bone marrow biopsy sections were fixed with formalin, embedded in paraffin, and cut into 4-μm-thick sections. Then, the sections were incubated with 3% H2O2 formaldehyde solvent at room temperature for 10 minutes, microwave antigen repair, cooled at room temperature, and incubated with 10% sheep serum for 10 minutes. Subsequently, the sections were incubated overnight at 4°C with a primary CD34 monoclonal antibody (Abcam) or VEGFB monoclonal antibody (Abcam). Biotinylated secondary antibodies were labeled with streptavidin-peroxidase solution (Abcam), added to the slides and incubated for 30 minutes. Finally, the specimens were stained with a Simple DAB Stain Kit (Abcam) and counterstained with hematoxylin according to the manufacturer’s instructions.

Evaluation of VEGFB expression and microvessel density (MVD)

The expression of VEGFB in plasma cells (both qualitative and quantitative) was assessed using VEGFB immunostaining slides. We detected the positive rate of plasma cell staining. The following formula was used to calculate the H score: H score = intensity of staining×% positivity. Megakaryocytes exhibit strong expression of VEGF and, therefore, were used as a positive internal control [33]. CD34-labeled microvessels were used to estimate the degree of angiogenesis. The slides were scanned under 100× magnification to locate the areas with the maximum number of microvessels (hotspots). The microvessel numbers in each field were measured at 400× magnification, and the average value was obtained as the MVD in each field.

Protein-protein interaction (PPI) network construction and module analysis

Based on the selected mRNAs, a PPI network was constructed using the Search Tool for the Retrieval of Interacting Genes (STRING) database. Visualization was performed using Cytoscape 3.8.2. The Molecular Complex Detection (MCODE) application was used to screen the hub gene modules in the PPI network. PaGenBase and TRRUST analyses were performed using Metascape.

Statistical analysis

Each experiment was performed in triplicate, and the data are presented as the mean ± standard deviation. We statistically analyzed the data with Student’s t-test using SPSS STATISTICS 26.0. Pearson correlation analyses and linear regression analyses were used to explore the correlations among circ-ATP10A, VEGFB and MVD. Receiver operating characteristic (ROC) curves and the area under the ROC curve (AUC) were used to evaluate the prognostic performance of circ-ATP10A in MM. A Kaplan-Meier survival curve analysis was performed to analyze the differences in OS associated with different expression levels of circ-ATP10A. Differences with P < 0.05 were considered statistically significant.

Results

We hypothesized that exosomal circRNAs might play a role in MM angiogenesis and may serve as novel diagnostic or prognostic biomarkers. Thus, this study investigated the functional role of exosomal circ-ATP10A in angiogenesis and its prognostic value in MM patients and explored the underlying molecular mechanism. High-throughput sequencing, qRT-PCR, WB, immunohistochemistry, ROC curve, AUC, Kaplan-Meier survival curve and bioinformatics analyses were performed.

Characterization of exosomes and circRNA expression profiles

Exosomes were isolated from the serum of both MM patients and healthy controls as described. TEM revealed that the diameter of the exosomes was less than 100 nm, and each vesicle presented a typical cup-shaped appearance with common exosomal markers (CD63 and TSG101) (Figure 1a-b). Furthermore, the particle size of the exosomes was visualized by NTA (Figure 1c). The above results indicate that the vesicles isolated by the aforementioned method are real exosomes.
Figure 1.

Characterization of serum exosomes and circRNA expression profiles. (a) Transmission electron micrograph of exosomes derived from MM patients’ serum samples. The scale bar represents 200 nm. (b) Western blot analysis of two representative exosome-specific markers, CD63 and TSG101, and a nonexosomal marker calnexin. (c) The size range of the serum exosomes was determined by an NTA analysis. (d) A volcano map of circRNAs with differential expression between the MM group and the control group. (e) Among 2,052 exo-circRNAs, 1,265 were upregulated, 787 were downregulated, 1,448 were novel and 604 were reported in circBase. (f) The length of most circRNAs was less than 250 nucleotides. (g) The composition of the circRNAs in terms of the gene distribution was analyzed. (h) The chromosomal origin of these identified circRNAs. (i) A cluster heatmap was generated to show the expression variations of 100 selected circRNAs with significant differential expression in serum between MM patients and healthy controls.

Characterization of serum exosomes and circRNA expression profiles. (a) Transmission electron micrograph of exosomes derived from MM patients’ serum samples. The scale bar represents 200 nm. (b) Western blot analysis of two representative exosome-specific markers, CD63 and TSG101, and a nonexosomal marker calnexin. (c) The size range of the serum exosomes was determined by an NTA analysis. (d) A volcano map of circRNAs with differential expression between the MM group and the control group. (e) Among 2,052 exo-circRNAs, 1,265 were upregulated, 787 were downregulated, 1,448 were novel and 604 were reported in circBase. (f) The length of most circRNAs was less than 250 nucleotides. (g) The composition of the circRNAs in terms of the gene distribution was analyzed. (h) The chromosomal origin of these identified circRNAs. (i) A cluster heatmap was generated to show the expression variations of 100 selected circRNAs with significant differential expression in serum between MM patients and healthy controls. We performed high-throughput RNA sequencing of ribosomal RNA-depleted total RNA obtained from 6 serum samples from MM patients and 5 samples from the healthy controls and constructed a circRNA profiling database. We screened 2,052 significantly differentially expressed circRNAs (1,265 upregulated and 787 downregulated) between the MM patients and healthy controls according to the criteria of a FC≥2.0 and P ≤ 0.05, and these circRNAs were visualized by a volcano map (Figure 1d). Among them, 604 circRNAs have been reported in circBase (Figure 1e). The length of most circRNAs was less than 250 nucleotides (figure 1f). In addition, we analyzed the composition of the circRNAs from the perspective of gene distribution and found that most upregulated circRNAs were sense overlapping circRNAs, while most downregulated circRNAs were exonic (Figure 1g). Moreover, regarding the chromosomal origin, these circRNAs originated from a wide range of sources, including 22 pairs of autosomes, sex chromosomes, and mitochondria (Figure 1h). A cluster heatmap was generated to show the variations in the expression of 100 upregulated and downregulated circRNAs, which were selected according to the correlation between the circRNAs and MM and the FC (Figure 1i).

Functional analyses of the differentially expressed circRNAs

Considering that the number of upregulated circRNAs was much greater than that of downregulated circRNAs, we performed GO and KEGG pathway analyses to interpret the potential functions of the differentially expressed upregulated circRNAs on their parental genes. Using the threshold P ≤ 0.05, the significantly altered GO terms and pathways were identified. Regarding the GO annotation, we found that many items are related to the malignant features of tumor cells. The enriched biological processes (BP), including ‘cell-cell signaling’, ‘cell adhesion’, ‘biological adhesion’, ‘cell migration’, ‘regulation of vasculogenesis’, ‘endothelium development’, ‘blood vessel development’, and ‘vasculature development’ (Figure 2a), are closely related to the ability of tumor cells to interact with other cells and extracellular matrix proteins [34] and tumor angiogenesis ability; thus, these BPs are key mediators in the progression of cancer and promote the characteristics of cancer, including metastatic dissemination and immune evasion [35]. In addition, ample evidence suggests that glutamine plays an essential role in tumors by affecting multiple factors, including the tumor microenvironment, immune evasion, underlying cancer genetics and other variables [36,37]. The biochemical pathways in cancer cells are reprogrammed, altering metabolism and causing the generation of lactic acid from glucose/glutamine. Lactate serves as an agonist of the G-protein-coupled receptor GPR81, whose activation ultimately promotes angiogenesis, immune evasion, and chemoresistance [38]. Interestingly, the ‘glutamate receptor signaling pathway’ and ‘glutamate receptor activity’ terms were the most significantly altered BP and molecular function terms (Figure 2b), respectively.
Figure 2.

GO and KEGG analyses of the differentially expressed circRNAs. Using P ≤ 0.05 as the threshold, 10 biological process (a) and molecular function (b) items showed significant changes. The top 15 enriched signaling pathways in the KEGG analysis (c).

GO and KEGG analyses of the differentially expressed circRNAs. Using P ≤ 0.05 as the threshold, 10 biological process (a) and molecular function (b) items showed significant changes. The top 15 enriched signaling pathways in the KEGG analysis (c). Moreover, the KEGG pathway analysis proved that the most significantly altered pathways included the ‘Hippo signaling pathway’, ‘PI3K-Akt signaling pathway’, ‘pathways in cancer’, and ‘ECM-receptor interaction’, which have been defined to play essential roles in angiogenesis or the tumor microenvironment (Figure 2c). The Hippo pathway-YAP/TAZ regulates vascular sprouting, vascular barrier formation, and vascular remodeling by regulating endothelial cell proliferation, migration, and survival [39,40]. The PI3K/AKT/mTOR pathway is activated in most human cancers, increasing the secretion of VEGF through HIF-1-dependent or HIF-1-independent mechanisms and modulating angiogenesis by regulating the expression of NO and angiopoietins [41]. The extracellular matrix (ECM) plays a crucial role in regulating the components of the tumor microenvironment, leading to tumor progression [42]. Based on the above analyses, we speculate that the upregulated circRNAs may be involved in tumor angiogenesis, invasion, migration, changes in the microenvironment, and other aspects, which can promote tumor progression.

qRT-PCR validation

We focused on a novel upregulated circRNA, circ-ATP10A, which is an intron-derived circRNA from the ATP10A gene located on chromosome 15 (26,003,835–26,004,050) and has a length of 216 nucleotides. High-throughput sequencing revealed a significant difference in the expression of circ-ATP10A between the MM patients and healthy individuals, and differential expression was observed in four of the six patients. To verify this result, a qRT-PCR analysis of serum exosome samples from 20 MM patients and 5 healthy controls was performed. As shown in Figure 3, the circ-ATP10A level in the MM group was 2.50 ± 0.62. It was confirmed that the expression of circ-ATP10A in the MM patients was markedly increased compared with that in the healthy controls (P < 0.01), which is consistent with the high-throughput sequencing results.
Figure 3.

qRT-PCR validation. The expression levels of circ-ATP10A in MM patients were significantly higher than those in the controls. Each experiment was repeated in triplicate. ** P < 0.01 between the indicated pairs of groups.

qRT-PCR validation. The expression levels of circ-ATP10A in MM patients were significantly higher than those in the controls. Each experiment was repeated in triplicate. ** P < 0.01 between the indicated pairs of groups.

Construction of a ceRNA network regulated by circ-ATP10A

CircRNAs can regulate mRNAs through various mechanisms, and the ceRNA mechanism is the most common. Specifically, circRNAs can act as miRNA sponges, which can affect the expression of downstream target genes by competitively binding miRNA response elements and can affect gene function at the posttranslational level [43]. To further explore the function of circ-ATP10A, MiRanda software was used to predict the top five miRNAs with the strongest ability to bind circ-ATP10A: hsa-miR-6758-3p, hsa-miR-3977, hsa-miR-6804-3p, hsa-miR-1266-3p, and hsa-miR-3620-3p. Subsequently, TargetScan was used to predict the mRNAs targeted by these five miRNAs. According to the total context++ score, the top 6000 mRNAs were selected, and a KEGG analysis was conducted with DAVID (Figure 4a). Of the 23 enriched pathways, ‘pathways in cancer’ had the most enriched genes, i.e., 111; thus, these genes were selected to construct a circRNA–miRNA–mRNA network using Cytoscape (3.8.2) (Figure 4b). We found that approximately half of these 111 genes were involved in sustained angiogenesis, and 33 genes were up-regulated in MM, according to high-throughput sequencing (Figure 4c). Among these genes, some vital molecules were related to angiogenesis, such as VEGFB, hypoxia-inducible factor-1alpha (HIF1A), platelet-derived growth factor subunit A (PDGFA), and fibroblast growth factor (FGF). The binding sites between these mRNAs and hsa-miR-6758-3p/hsa-miR-3977/hsa-miR-6804-3p/hsa-miR-1266-3p/hsa-miR-3620-3p are shown in Table 2. The ability of VEGF to induce physiological and pathological angiogenesis has been extensively studied since it was identified as an endothelial cell-specific mitogen [44]. In MM, the VEGF pathway is involved in tumor angiogenesis and growth. Sezer O et al demonstrated that the level of serum VEGF was significantly decreased in MM patients after successful treatment, while the decrease in VEGF in nonresponders was small or nonexistent, suggesting that VEGF may be related to prognosis [45]. VEGFA also acts as a downstream target gene of HIF1A, and HIF1A can promote its expression [46]. In addition to the VEGF-mediated pathway, several VEGF-independent pathways, including the FGF/ FGF receptor (FGFR) and PDGF/ PDGF receptor (PDGFR) signaling pathways, have been well described as alternative inducers of tumor growth that modulate tumor angiogenesis [47,48]. These results collectively suggest that circ-ATP10A may serve as a miRNA sponge, regulate the expression of downstream target mRNAs, and play a pivotal role in angiogenesis in MM.
Figure 4.

KEGG analysis and a ceRNA network regulated by circ-ATP10A. (a) The top 10 enriched signaling pathways in the KEGG analysis of the selected 6000 mRNAs. (b) A circRNA–miRNA–mRNA network was constructed by Cytoscape (3.8.2). The map shows the top 5 miRNAs (green) regulated by circ-ATP10A (blue) and 111 mRNAs (red) involved in ‘pathways in cancer’. (c) The pathway information of ‘pathways in cancer’ was drawn by pathview. Red indicates up regulation and green indicates down regulation.

Table 2.

The binding sites between VEGFB, HIF1A, PDGF, FGF and the top five miRNAs predicted by TargetScan

 Predicted consequential pairing of target region(top) and miRNA (bottom)Site typeContext++ ScoreContext++ ScorepercentileWeighted Context++ScoreConserved branchlengthPCT
Position 643–649 of FGF16 3ʹ UTRhsa-miR-6758-3p5ʹ..AAUAAUUUUAUUUUUAAUGAGAG … | | | | | |3ʹ GACCUGUCUCCUCUUACUCA7mer-A1−0.0678−0.060N/A
Position 295–301 of FGF18 3ʹ UTRhsa-miR-6758-3p5ʹ … CCCAGAGGAGGACUUGAAUGAGG … | | | | | | | | | | | | | |3ʹ GACCUGUCUCCU – – – –––CUUACUCA7mer-m8−0.1995−0.190N/A
Position 1092–1098 of FGF5 3ʹ UTRhsa-miR-39775ʹ … GGAUAUGAUGGGUUAGAAGCAAG … | | | | | |3ʹ AUUCCAAUUAAUGCUACUUCGUG7mer-A1−0.1287−0.030N/A
Position 1284–1290 of FGF5 3ʹ UTRhsa-miR-39775ʹ … AUUUUAUUCUGUCCAUGAAGCAU … | | | | | | |3ʹ AUUCCAAUUAAUGCUACUUCGUG7mer-m8−0.1389−0.030N/A
Position 2971–2977 of FGF5 3ʹ UTRhsa-miR-39775ʹ … AUAAUUAAUGCUUAGUGAAGCAU … | | | | | | | | | | | |3ʹ AUUCCAAUUAAUGCU--ACUUCGUG7mer-m8−0.1287−0.030N/A
Position 2709–2715 of FGF10 3ʹ UTRhsa-miR-39775ʹ … AAGGAAGGAAGGAAGGAAGCAAG … | | | | | |3ʹ AUUCCAAUUAAUGCUACUUCGUG7mer-A1−0.08800.000N/A
Position 3833–3839 of FGF10 3ʹ UTRhsa-miR-39775ʹ … UUCUUGUUUAUUUCA-UGAAGCAG … | | | | | | | | | |3ʹ AUUCCAAUUAAUGCUACUUCGUG7mer-m8−0.08800.000N/A
Position 1223–1230 of FGF1 3ʹ UTRhsa-miR-6804-3p5ʹ … CCAUCAGGUCCCCCCCAGGUGCA … | | | | | | |3ʹ GACACCCACUCUCCGUCCACGC8mer−0.3295−0.120N/A
Position 1229–1235 of FGF1 3ʹ UTRhsa-miR-6804-3p5ʹ … GGUCCCCCCCAGGUGCAGGUGCU … | | | | | | |3ʹ GACACCCACUCUCCGUCCACGC7mer-m8−0.1574−0.050N/A
Position 3395–3402 of FGF5 3ʹ UTRhsa-miR-6804-3p5ʹ … ACUAAUUUGAGAGUACAGGUGCA … | | | | | | | | | | | | |3ʹ GACACCCACUCUCC--GUCCACGC8mer−0.5899−0.040N/A
Position 4290–4297 of FGF10 3ʹ UTRhsa-miR-6804-3p5ʹ … GAGACAGCAGUGCUG– CAGGUGCA … | | | | | | | | | |3ʹ GACACCCACUCUCCGUCCACGC8mer−0.24900.000N/A
Position 236–242 of FGF18 3ʹ UTRhsa-miR-6804-3p5ʹ … ACUGUAGUCAACCCACAGGUGCU … | | | | | | |3ʹ GACACCCACUCUCCGUCCACGC7mer-m8−0.2793−0.270N/A
Position 406–412 of PDGFA 3ʹ UTRhsa-miR-6804-3p5ʹ … CUGUCCGGGUGGUCA-CAGGUGCU … | | | | | | | | | | | |3ʹ GACACCCACUCUCCGUCCACGC7mer-m8−0.3295−0.250N/A
Position 1005–1011 of FGF12 3ʹ UTRhsa-miR-1266-3p5ʹ … GUGGCAGGAAAGAAAGAACAGGG … | | | | | | | | | | |3ʹ AGGGAGUCCCGUAU–––CUUGUCCC7mer-m8−0.2292−0.030N/A
Position 695–701 of FGF16 3ʹ UTRhsa-miR-1266-3p5ʹ … AUAAGGUCCUACUGAAACAGGAU … | | | | | |3ʹ AGGGAGUCCCGUAUCUUGUCCC7mer-A1−0.1889−0.180N/A
Position 416–422 of FGF19 3ʹ UTRhsa-miR-1266-3p5ʹ … UAGUUUUAAUUUCAGGAACAGGU … | | | | | | |3ʹ AGGGAGUCCCGUAUCUUGUCCC7mer-m8−0.2293−0.090N/A
Position 66–73 of VEGFB 3ʹ UTRhsa-miR-3620-3p5ʹ … GCUUUUCAGACUCAGCAGGGUGA … | | | | | | |3ʹ GACCCACGCCCUACGUCCCACU8mer−0.4399−0.430N/A
Position 105–112 of HIF1A 3ʹ UTRhsa-miR-3620-3p5ʹ … AGCAGAAACCUACUGCAGGGUGA … | | | | | | | | |3ʹ GACCCACGCCCUACGUCCCACU8mer−0.3097−0.300.437N/A
Position 686–693 of FGF23 3ʹ UTRhsa-miR-3620-3p5ʹ … AACUCAGCCUCCCUACAGGGUGA … | | | | | | |3ʹ GACCCACGCCCUACGUCCCACU8mer−0.1992−0.190N/A
The binding sites between VEGFB, HIF1A, PDGF, FGF and the top five miRNAs predicted by TargetScan KEGG analysis and a ceRNA network regulated by circ-ATP10A. (a) The top 10 enriched signaling pathways in the KEGG analysis of the selected 6000 mRNAs. (b) A circRNA–miRNA–mRNA network was constructed by Cytoscape (3.8.2). The map shows the top 5 miRNAs (green) regulated by circ-ATP10A (blue) and 111 mRNAs (red) involved in ‘pathways in cancer’. (c) The pathway information of ‘pathways in cancer’ was drawn by pathview. Red indicates up regulation and green indicates down regulation.

Circ-ATP10A levels were positively correlated with the VEGFB protein levels and MVD in MM patients

To further verify the relationship among circ-ATP10A, VEGFB and MVD, immunohistochemistry was used to analyze bone marrow samples from 20 MM patients. Pearson correlation analyses and linear regression analyses were performed (Figure 5a); these analyses revealed that circ-ATP10A can significantly positively regulate the VEGFB protein levels (R2 = 0.928, P < 0.05) and MVD (R2 = 0.848, P < 0.05).
Figure 5.

Representative immunohistochemical images and clinical data analyses. (a) A scatter plot and the corresponding regression line and regression equation of the relationship between the independent variable circ-ATP10A level, the dependent variable VEGFB H score, and the dependent variable MVD level. (b) The accuracy of circ-ATP10A in predicting the death outcome caused by MM. The AUC and optimal critical value of circ-ATP10A were 0.854 and 2.415, respectively. (c) The Kaplan-Meier survival curve was analyzed to compare OS between the circ-ATP10A high-risk group and low-risk group. (P = 0.001). Differences in VEGFB H score (d) and MVD level (e) between the low-risk group and the high-risk group. (f) Representative images of staining with VEGFB or CD34 antibodies in MM patients’ bone marrow tissues (scale bar, 50 µm). ** P < 0.01 between the indicated pairs of groups.

Representative immunohistochemical images and clinical data analyses. (a) A scatter plot and the corresponding regression line and regression equation of the relationship between the independent variable circ-ATP10A level, the dependent variable VEGFB H score, and the dependent variable MVD level. (b) The accuracy of circ-ATP10A in predicting the death outcome caused by MM. The AUC and optimal critical value of circ-ATP10A were 0.854 and 2.415, respectively. (c) The Kaplan-Meier survival curve was analyzed to compare OS between the circ-ATP10A high-risk group and low-risk group. (P = 0.001). Differences in VEGFB H score (d) and MVD level (e) between the low-risk group and the high-risk group. (f) Representative images of staining with VEGFB or CD34 antibodies in MM patients’ bone marrow tissues (scale bar, 50 µm). ** P < 0.01 between the indicated pairs of groups. To identify the prognostic potential of circ-ATP10A, patients were grouped according to their survival status (alive or dead) three years after diagnosis to draw the ROC curve. As shown in Figure 5b, the AUC for predicting the outcome of death caused by MM was 0.854 (P < 0.05, 95% CI: 0.665–1.000), and the optimal critical value of circ-ATP10A was 2.415 (sensitivity = 87.5% and specificity = 75%), which was determined according to Youden Index, indicating that circ-ATP10A has higher prognostic potential in MM patients. The Kaplan-Meier survival curve analysis showed a significant difference in OS between the circ-ATP10A high-risk (≥2.415) and low-risk (<2.415) patients (Figure 5c). Moreover, there were significant differences in the VEGFB and MVD levels between the low-risk circ-ATP10A group and the high-risk circ-ATP10A group (Figure 5d-f). The above results all suggest that circ-ATP10A had an adverse effect on the prognosis of the MM patients, which may be related to the role of circ-ATP10A in promoting angiogenesis by promoting the expression of VEGFB.

PPI network construction and module analysis

In total, 111 nodes and 983 edges were mapped in the PPI network (Figure 6a). The hub genes in the PPI network were identified by the MCODE approach in Cytoscape. With k-core = 2, four significant modules were screened and are shown in Figure 6b. The seed genes were LPAR4, GNAS, FGF23, and LAMA4. FGF23 can activate the Egr1-VEGFA signaling axis to induce phenotypic changes in osteocytes in hypoxic and MM microenvironments, encouraging their transformation to proangiogenic cells [49]. The PaGenBase enrichment results showed that some of these 111 genes were human umbilical vein endothelial cell (HUVEC)-specific (Figure 6c), suggesting that these genes play a potential role in angiogenesis. Additionally, the TRRUST enrichment analysis indicated the presence of some gene clusters regulated by TP53, ING4, WT1, HIF1A, and STAT3 (Figure 6d). These five genes have important positions in MM or angiogenesis [50-53]. Taken together, these findings indicate that circ-ATP10A has a regulatory effect on MM and angiogenesis.
Figure 6.

PPI network construction and module analysis. (a) The PPI network of 111 genes. Using Cytoscape for the analysis, the white nodes represent low degrees, and the blue nodes represent high degrees. The white edges represent low combined scores, and the blue edges represent high combined scores. (b) The 4 hub gene clusters among 111 target genes were screened by the MCODE method. PaGenBase enrichment (c) and TRRUST analysis (d) of the 111 genes were performed by Metascape.

PPI network construction and module analysis. (a) The PPI network of 111 genes. Using Cytoscape for the analysis, the white nodes represent low degrees, and the blue nodes represent high degrees. The white edges represent low combined scores, and the blue edges represent high combined scores. (b) The 4 hub gene clusters among 111 target genes were screened by the MCODE method. PaGenBase enrichment (c) and TRRUST analysis (d) of the 111 genes were performed by Metascape.

Discussion

MM is the second most common hematological malignancy and remains incurable [54,55]. Angiogenesis is a feature of MM progression through the transition from MGUS to MM. Numerous clinical studies have shown that MVD is significantly associated with PFS and OS in MM patients, paving the way for the development of antiangiogenic therapy [3-5]. In our research, we first characterized circ-ATP10A as a novel circRNA that was upregulated in exosomes from MM patients. In addition, circ-ATP10A may serve as a miRNA sponge to regulate the expression of downstream target mRNAs and stimulate both VEGF-dependent and VEGF-independent angiogenesis. Moreover, clinical analyses indicate that circ-ATP10A can significantly positively regulate the protein levels of VEGFB and MVD and has an adverse effect on the prognosis of MM patients. Therefore, exosomal circ-ATP10A is a promising biomarker for the detection of MM angiogenesis levels and the prognosis of MM patients. Exosomal circ-ATP10A protects VEGFB and promotes MM angiogenesis by sponging miR-6758-3p/miR-3977/miR-6804-3p/miR-1266-3p/miR-3620-3p. The size and shape of serum-derived exosomes were detected by TEM. The exosomal biomarkers TSG101 and CD63 were also used to verify the exosomes. The purity of the exosomes was determined by the ratio of the particle number to the protein concentration detected by NTA and BCA protein assay kits. Then, the expression of circRNAs was detected in serum-derived exosomes. Interestingly, many significantly differentially expressed exosomal circRNAs were observed in the MM patients. These circRNAs were widely derived from 22 pairs of autosomes, sex chromosomes, and mitochondria; most upregulated circRNAs were sense overlapping, while the downregulated circRNAs were exonic; most circRNAs were less than 250 nucleotides. To further explore the function of these circRNAs, considering that the number of upregulated circRNAs was almost twice as large as that of downregulated circRNAs, we performed GO and KEGG enrichment analyses of the upregulated circRNAs. We found that many terms were related to the malignant characteristics of tumor cells in the GO analysis, and the most significantly altered pathways in the KEGG analysis, such as the ‘Hippo signaling pathway’, ‘PI3K-Akt signaling pathway’, ‘pathways in cancer’, and ‘ECM-receptor interaction’, were related to tumor angiogenesis, invasion, migration, changes in the microenvironment, etc [42,56,57]., suggesting that the upregulated circRNAs may be involved in the pathogenesis and progression of MM. CircRNAs have been proven to be potential biomarkers in cancer due to their tissue-specific and cell-specific patterns [21]. qRT-PCR further detected circ-ATP10A and confirmed that there was a more than a 2-fold increase in its expression in the MM patients compared to the healthy controls. Circ-ATP10A is derived from the intron of the ATP10A gene, which is located on chromosome 15 (26,003,835–26,004,050). As predicted by the bioinformatics analyses, it has binding sites with miR-6758-3p/miR-3977/miR-6804-3p/miR-1266-3p/miR-3620-3p. Therefore, we predicted that circ-ATP10A could function as a ceRNA and play a role in the tumorigenesis of MM. Angiogenic cytokines in BM plasma and peripheral blood are strictly related to MVD and plasma cell infiltration. VEGFB, HIF1A, FGF, and PDGFA, as downstream target mRNAs, play a pivotal role in VEGF-dependent or VEGF-independent angiogenesis. Interfering with VEGF signaling is a useful antiangiogenic therapy for MM. Previous studies have demonstrated that the application of VEGF/VEGFR monoclonal antibodies and small molecule tyrosine kinase inhibitors is essential in antiangiogenic therapy. Our results suggest that the levels of angiogenic cytokines are regulated by exosomal circ-ATP10A through competition for miR-6758-3p/miR-3977/miR-6804-3p/miR-1266-3p/miR-3620-3p. Importantly, the immunohistochemical results further demonstrated that the circ-ATP10A levels were positively correlated with the VEGFB protein levels and MVD in the MM patients. The ROC curve analysis and the AUC indicated that circ-ATP10A had high sensitivity and specificity in predicting the outcome of death caused by MM. According to Youden’s index, the optimal critical value of circ-ATP10A was 2.415. The Kaplan-Meier survival curve analysis revealed that there was a significant difference in OS between the circ-ATP10A high-risk (≥2.415) and low-risk (<2.415) patients. In addition, we screened the 4 hub gene clusters among 111 selected target genes of circ-ATP10A using the MCODE method. One seed gene, i.e., FGF23, was demonstrated to promote angiogenesis by activating the Egr1-VEGFA signaling axis [49]. The bioinformatics analyses, including the PaGenBase and TRRUST analyses, showed that some hub genes were HUVEC-specific and closely related to MM or angiogenesis. Lastly, we found that circ-ATP10A had multiple binding sites for miR-6758-3p/miR-3977/miR-6804-3p/miR-1266-3p/miR-3620-3p, which may modify the expression of downstream angiogenic cytokines. Consistently, immunohistochemistry showed that circ-ATP10A was correlated with VEGFB and MVD. The Pearson correlation, linear regression, ROC curve, AUC and Kaplan-Meier survival curve analyses revealed the prognostic value of circ-ATP10A. Compared with prior studies [58,59], we not only verified the biomarker value of circ-ATP10A in peripheral blood but also initially demonstrated the mechanism by which circ-ATP10A regulates angiogenesis in bone marrow tissue, providing research directions for the further exploration of its mechanism of action. However, this study has certain limitations. In future research, we aim to explore the biological role of circ-ATP10A in vivo and in vitro to obtain more conclusive evidence.

Conclusions

Through high-throughput sequencing, we identified multiple circRNAs with significant differences in expression in peripheral blood exosomes from MM patients versus those from healthy individuals, providing a platform for the further exploration of their roles. In addition, we found that a novel significantly upregulated circRNA called circ-ATP10A may serve as a promising marker for the prognosis evaluation of patients with MM, and the bioinformatics analyses implied that it may promote MM angiogenesis by sponging hsa-miR-6758-3p/hsa-miR-3977/hsa-miR-6804-3p/hsa-miR-1266-3p/hsa-miR-3620-3p to regulate the expression of VEGFB, HIF1A, PDGFA, and the FGF family.
  59 in total

1.  Next-generation epigenetic inhibitors.

Authors:  Panagis Filippakopoulos; Stefan Knapp
Journal:  Science       Date:  2020-04-24       Impact factor: 47.728

Review 2.  Antiangiogenic therapy in oncology: current status and future directions.

Authors:  Gordon C Jayson; Robert Kerbel; Lee M Ellis; Adrian L Harris
Journal:  Lancet       Date:  2016-02-05       Impact factor: 79.321

3.  Exosomal miR-135b shed from hypoxic multiple myeloma cells enhances angiogenesis by targeting factor-inhibiting HIF-1.

Authors:  Tomohiro Umezu; Hiroko Tadokoro; Kenko Azuma; Seiichiro Yoshizawa; Kazuma Ohyashiki; Junko H Ohyashiki
Journal:  Blood       Date:  2014-10-15       Impact factor: 22.113

Review 4.  Glutamine Metabolism in Cancer: Understanding the Heterogeneity.

Authors:  Ahmad A Cluntun; Michael J Lukey; Richard A Cerione; Jason W Locasale
Journal:  Trends Cancer       Date:  2017-03

5.  YAP/TAZ Orchestrate VEGF Signaling during Developmental Angiogenesis.

Authors:  Xiaohong Wang; Aida Freire Valls; Géza Schermann; Ying Shen; Ivan M Moya; Laura Castro; Severino Urban; Gergely M Solecki; Frank Winkler; Lars Riedemann; Rakesh K Jain; Massimilano Mazzone; Thomas Schmidt; Tamás Fischer; Georg Halder; Carmen Ruiz de Almodóvar
Journal:  Dev Cell       Date:  2017-08-31       Impact factor: 12.270

6.  Thalidomide is an inhibitor of angiogenesis.

Authors:  R J D'Amato; M S Loughnan; E Flynn; J Folkman
Journal:  Proc Natl Acad Sci U S A       Date:  1994-04-26       Impact factor: 11.205

7.  PI3K/AKT/mTOR Pathway in Angiogenesis.

Authors:  Jayashree Karar; Amit Maity
Journal:  Front Mol Neurosci       Date:  2011-12-02       Impact factor: 5.639

8.  CPAP promotes angiogenesis and metastasis by enhancing STAT3 activity.

Authors:  Ruo-Yu Chen; Chia-Jui Yen; Yao-Wen Liu; Chun-Guo Guo; Chieh-Yu Weng; Chien-Hsien Lai; Ju-Ming Wang; Yih-Jyh Lin; Liang-Yi Hung
Journal:  Cell Death Differ       Date:  2019-09-11       Impact factor: 15.828

9.  Extracellular vesicle measurements with nanoparticle tracking analysis - An accuracy and repeatability comparison between NanoSight NS300 and ZetaView.

Authors:  Daniel Bachurski; Maximiliane Schuldner; Phuong-Hien Nguyen; Alexandra Malz; Katrin S Reiners; Patricia C Grenzi; Felix Babatz; Astrid C Schauss; Hinrich P Hansen; Michael Hallek; Elke Pogge von Strandmann
Journal:  J Extracell Vesicles       Date:  2019-04-01
View more
  10 in total

Review 1.  Insights Into the Role of Platelet-Derived Growth Factors: Implications for Parkinson's Disease Pathogenesis and Treatment.

Authors:  Dan Li; Le-Tian Huang; Cheng-Pu Zhang; Qiang Li; Jia-He Wang
Journal:  Front Aging Neurosci       Date:  2022-07-01       Impact factor: 5.702

2.  Downregulation of autophagy-related circular RNA (ACR) is correlated with poor survival of patients with chronic heart failure.

Authors:  Haihui Yan; Dan Du; Chen Wang; Miao Tian
Journal:  Bioengineered       Date:  2022-05       Impact factor: 6.832

Review 3.  The Emerging Role of MicroRNAs in Bone Diseases and Their Therapeutic Potential.

Authors:  Luis Alberto Bravo Vázquez; Mariana Yunuen Moreno Becerril; Erick Octavio Mora Hernández; Gabriela García de León Carmona; María Emilia Aguirre Padilla; Samik Chakraborty; Anindya Bandyopadhyay; Sujay Paul
Journal:  Molecules       Date:  2021-12-30       Impact factor: 4.411

Review 4.  Exosomal RNAs: Novel Potential Biomarkers for Diseases-A Review.

Authors:  Jian Wang; Bing-Lin Yue; Yong-Zhen Huang; Xian-Yong Lan; Wu-Jun Liu; Hong Chen
Journal:  Int J Mol Sci       Date:  2022-02-23       Impact factor: 5.923

Review 5.  Circular RNA as a Novel Biomarker for Diagnosis and Prognosis and Potential Therapeutic Targets in Multiple Myeloma.

Authors:  Alessandro Allegra; Nicola Cicero; Alessandro Tonacci; Caterina Musolino; Sebastiano Gangemi
Journal:  Cancers (Basel)       Date:  2022-03-27       Impact factor: 6.639

6.  Circular RNA-microRNA-mRNA network identified circ_0007618 and circ_0029426 as new valuable biomarkers for lung adenocarcinoma.

Authors:  Qiang Zhang; Yungang Sun; Chao Wang; Feng Shao
Journal:  Bioengineered       Date:  2022-03       Impact factor: 3.269

Review 7.  Review of the Role of Mesenchymal Stem Cells and Exosomes Derived from Mesenchymal Stem Cells in the Treatment of Orthopedic Disease.

Authors:  Sihang Ren; Chenchao Wang; Shu Guo
Journal:  Med Sci Monit       Date:  2022-04-28

8.  Circular RNA_0001187 participates in the regulation of ulcerative colitis development via upregulating myeloid differentiation factor 88.

Authors:  Wei Ouyang; Min Wu; Anshan Wu; Heng Xiao
Journal:  Bioengineered       Date:  2022-05       Impact factor: 6.832

Review 9.  Advances in the Study of circRNAs in Hematological Malignancies.

Authors:  Jingyi Du; Feiyu Jia; Lijuan Wang
Journal:  Front Oncol       Date:  2022-06-20       Impact factor: 5.738

Review 10.  Comprehensive elaboration of circular RNA in multiple myeloma.

Authors:  Chunsheng Zhu; Aoxiang Guo; Bao Sun; Zheng Zhou
Journal:  Front Pharmacol       Date:  2022-08-29       Impact factor: 5.988

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.