Literature DB >> 34843606

Genetic variability and population structure of Ethiopian chickpea (Cicer arietinum L.) germplasm.

Sintayehu Admas1,2, Kassahun Tesfaye2,3, Teklehaimanot Haileselassie2, Eleni Shiferaw1, K Colton Flynn4.   

Abstract

Evaluation of the genetic diversity and an understanding of the genetic structure and relationships of chickpea genotypes are valuable to design efficient germplasm conservation strategies and crop breeding programs. Information is limited, in these regards, for Ethiopian chickpea germplasms. Therefore, the present study was carried out to estimate the genetic diversity, population structure, and relationships of 152 chickpea genotypes using simple sequence repeats (SSR) markers. Twenty three SSR markers exhibited polymorphism producing a total of 133 alleles, with a mean of 5.8 alleles per locus. Analyses utilizing various genetic-based statistics included pairwise population Nei's genetic distance, heterozygosity, Shannon's information index, polymorphic information content, and percent polymorphism. These analyses exemplified the existence of high genetic variation within and among chickpea genotypes. The 152 genotypes were divided into two major clusters based on Nei's genetic distances. The exotic genotypes were grouped in one cluster exclusively showing that these genotypes are distinct to Ethiopian genotypes, while the patterns of clustering of Ethiopian chickpea genotypes based on their geographic region were not consistent because of the seed exchange across regions. Model-based population structure clustering identified two discrete populations. These finding provides useful insight for chickpea collections and ex-situ conservation and national breeding programs for widening the genetic base of chickpea.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34843606      PMCID: PMC8629288          DOI: 10.1371/journal.pone.0260651

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Chickpea (Cicer arietinum L.) belongs to the family Fabaceae (formerly Leguminosae) and subfamily Faboideae. It is a diploid self-pollinated crop species having chromosome number of 2n = 2x = 16 [1, 2] with a comparatively small genome size of 740 Mbp [3]. There are two main types of chickpeas, namely desi and kabuli, however, rarely pea-shaped chickpea types are available. Kabuli seed types (Macrosperma) are large, round or ram head, and cream-colored. It has medium to tall plant height, large leaflets and white flowers, and it contains no anthocyanin. The desi chickpea types (Microsperma) are characterized by pink, purple or blue flower color, darker seeds with a rough seed coat. It has small and angular seed shape. The plants are anthocyanin-rich and have tiny leaves and purplish blooms. Pea-shaped chickpea type is characterized by medium to small seed size and creamy color [4]. It may be a result of a cross between desi and kabuli types that has resulted in a sort of intermediate types [5]. Chickpea is believed to have originated from the South Eastern Turkey and the adjoining areas of Syria [2], where chickpea was domesticated and later spread to the secondary centers of diversity: north-east Africa, Mediterranean Europe and the Indian sub-continent and more recently to Mexico and Chile [6, 7]. India and Ethiopia have been proposed as secondary centers of diversity for cultivated chickpea [8]. Based on the presence of wild relative (Cicer Cuneatum) found in Northern Ethiopia [9] and the Archaeological evidence from Lalibela caves in Ethiopia with seed samples with seed sample dated at over 2500 years [10], Fikre et al. [11] suggested for reconsideration of Ethiopia as the origin of chickpea. However, with the current consensus, Ethiopia is considered as the secondary center of diversity for chickpea [8]. Chickpea is one of the first domesticated, cool season autogamous grain legume cultivated in more than 50 countries in subtropical and temperate regions throughout the world [12]. Chickpea is also one of the main crops in sub-Saharan Africa. Since 1961, its production area and productivity trend have been steadily increasing. Because, it serves as a cash crop, break crop for crop diseases managements, a rotational crop for soil fertility restoration, food for human beings, and feed for animals. It is also suitable for sustainable agriculture production system with little or no climatic shocks [11]. In Ethiopia, chickpea is the third largest food legume crop in sowing area and production and the second major export commodity next to white pea beans generating nearly 25% of the total legumes export earnings [13]. Knowledge of genetic diversity, structure and relationship among germplasm collections are vital to design appropriate germplasm conservation strategies and potential breeding programs [14]. These activities aid in the maintenance of highly diversified germplasm which provides ample opportunity to breeders to look for desirable traits for developing new and superior varieties. Comprehensive information on genetic diversity and structure can be generated from morphological, biochemical and molecular data. Ethiopian chickpea germplasm have been characterized extensively for phenotypic characteristics [15-20]. Although morphological markers allow the identification of genetic variation, it is masked by environmental factors and is minimized due to the lack of distinguishable morphological markers [21]. This deficiency in phenotypic characterization must be complemented with molecular methods that use molecular markers, which can generate reliable and reproducible information for the evaluation of diversity. In chickpea, various markers have been used for diversity analysis which includes microsatellite or simple sequence repeats (SSRs), sequence tagged microsatellite markers (STMS), expressed sequence tags (ESTs), single nucleotide polymorphism (SNP), cleaved amplified polymorphic sequences (CAPS), conserved intron spanning primers (CISP) and diversity arrays technology (DArT) markers [12]. Simple sequence repeats (SSRs) are short tandem repetitive DNA sequences with a repeat length of few (1–6) base pairs which are abundant, dispersed through the genome and are highly polymorphic in comparison with other molecular markers [22, 23]. SSRs have been the most widely used markers for genotyping chickpea because they are highly informative, co-dominant, high reproducible and transferable among related species, multi-allelic, and have high degree of polymorphism and extensive genome coverage [14, 24–26]. Moreover, SSR markers are three times as efficient as dominant markers for intraspecific analysis and are as efficient as other dominant markers in detecting interspecific variability [27]. In chickpea, large numbers of SSR markers have been characterized, identified and utilized extensively to study genetic diversity and relationships to identify genetically diverse germplasm with beneficial traits for use in chickpea genome analysis, germplasm characterization, phylogenetic analysis and genetic diagnostics [14, 22, 25, 26]. The use of SSR markers for characterizing Ethiopian Chickpea has been implemented, however, the number of genotypes characterized so far [25, 28] were small in number as compared to the total number of genotypes conserved in the Ethiopian Biodiversity Institute (EBI) gene bank. The aim of this study was, therefore, to assess the patterns of genetic structure and the level of genetic diversity and relationships within and between Ethiopian Chickpea genotypes, improved chickpea varieties and breeding lines by using SSR markers.

Materials and methods

Plant materials

One-hundred fifty-two chickpea genotypes were considered for this study (Table 1). One-hundred thirty-eight are Ethiopian genotypes (landraces), eight are nationally released varieties from Ethiopian agricultural research centers and six were breeding lines accessed from the International Center for Agricultural Research in the Dry Areas (ICARDA). The geographical origin of the Ethiopian chickpea germplasm used in the study is indicated in Fig 1. Fig 1 was done using the software DIVA-GIS software [29] using the GPS coordinates of the collection sites (S1 Text). The genotypes were grown at Bakelo Research Station of Debre Brehan Agricultural Research Center in the 2018/2019 cropping seasons. Two weeks after planting, approximately equal amounts of bulk leaf samples were collected from five plants of each genotypes as suggested by Gilbert et al. [30] and then the leaves were stored in plastic Ziplock bags containing Silica gel.
Table 1

List of chickpea genotypes used for this study.

RegionZoneDistrictNo # of genotypesName of genotypes
Amhara East Gojjam1*Awabel, Dejen, Enarj enawga, Enemay, Goncha siso enese, Guzamn22228290, 240050, 207728-A, 207736-B, 30287-C, 30288-A, 30289-A, 30289-B, 30290-A, 30300-A, 41021-A, 41029-B, 41080-B, 41086-A, 41222-B, 41222-B, 41228-A, 41230-A, 41231-B, 41234-C, 41247-A and 41247-B
East Gojjam2*Debay telatgen, Hulet ej enese, Mota, Shebel berenta, Gonji, Yilmana densa, D/dare zuria, Dega damot, Adet23207638, 212685-B, 212685-B, 215289-A, 30307-D, 30307-D, 30308-B, 30309-A, 30311-A, 30313-C, 30314-A, 30314-B, 30316-A, 41020-A, 41075-C, 41078-B, 41090-A, 41245-A, 41257-A, 41258-A, 41265-B, 41270-B and 41320-A
North GondarAlefa, Belesa, Chilga, Dabat, Debark, Este, and Wegera16207136-A, 207136-A, 207167-A, 207173-B, 207175-A, 207609-B, 207617-A, 225884-A, 227152-A, 227160-B, 227161-B, 24159-C, 241800-A, 241801-A, 41301-A and 9646-A
Central GondarGondar zuria, Kemkem, Mirab belesa, Mirab dendia, Misrak belesa1430333, 207753-B, 236475-A, 30317-A, 30318-B, 30319-B, 30326-A, 30326-C, 30334-B, 30335-B, 30335-B, 30336-B, 30337-A and 41043-B
North ShewaAnkober, Debre Brehan, Efratana gidim, Mezezo Mojana, Mama lalo midir, Minjarna Shenkora, Siadebr and Tegulet22207652, 215067-B, 215067-C, 235036-B, 235036-C, 237055-B, 30348-C, 41093-C, 41094-B, Dbarc-black 1, Dbarc-black 2, Dbarc-black 3, Dbarc-red 4, enewari1, enewari2, enewari3, enewari4, enewari5, enewari6, enewari7, tegulet1 and tegulet 2
North WolloBugna, Dessie zuria, Guba lafto, Habru, Kelala, Kutaber, Sayint and Wereilu11213050-B, 214732-A, 214734-C, 235032-A, 235032-B, 235034-C, 236194-A, 241804-C, 241804-D, 30347-B and 41116-A
Tigray ** Rayaazebo, Medebay zana, Axum, Maychew and Wukro516586-A, 234050-B, 235391-A, 236459-B and 236467-A
Oromia West ShewaAmbo, Alem gena, Becho, Ejerie (addis alem), Jeldu and Kersana kondaltiiti12207684, 207712, 207714, 207691-B, 207765-B, 207769-A, 209026-A, 228197-E, 41169-C, 41200-B, 41200-C and 41206-B
Arsi BaleBekoji, Chole, Jeju, Goro, Robe, Robe market, and Girawa12207670, 207664-A, 207679-B, 230796-C, 231331-A, 28741-A, 41035-C, 216854-C, 41136-A, 41030, 41034, and 41153-A
SNNP ** Konso special1225741-C
Exotic Genotypes ICARDA Genotypes6125231***, 128699***, 140294***, 69757***, 70788*** and 9003***
Improved Varieties8Dalota, Dhara***, Dubie, Ejere***, Mastewal, Minjar, Shahso*** and Teji***

*East Gojjam was grouped in two;

**Due to small number of genotypes, Tigray collections was grouped with North Wollo collections, Konso with Arsi Bale collections,

*** Kabuli types chickpea, while the rest are desi type chickpea

Fig 1

Map showing the geographical distribution of Ethiopian chickpea germplasm.

*East Gojjam was grouped in two; **Due to small number of genotypes, Tigray collections was grouped with North Wollo collections, Konso with Arsi Bale collections, *** Kabuli types chickpea, while the rest are desi type chickpea

DNA extraction and quantification

Genomic DNA was extracted using the cetyltriethylammonium bromide (CTAB) technique [31] with slight adjustments. The leaf samples were ground into fine powder using pestle and mortar using 250 μl DNA extraction buffers (0.35M sorbitol, 0.1M Tris–HCl (pH 7.6), 0.005M EDTA, and 0.2M Tris-HCl, 0.05M EDTA, 2M NaCl and 2% CTAB, mixed in equal amounts). About 100 mg of ground leaf sample was transferred to 2 ml microcentrifuge tubes and 750 μl of extraction buffer was added. Tubes were maintained at 65 °C for one hour followed by chloroform-isoamyl alchohol (24:1) extraction. The DNA pellet was air dried and dissolved in 100 μl of 1× TE buffer. The quality and quantity of all DNA samples were checked using Nano Drop Spectrometer (ND-2000). In addition, agarose gel (0.8%) was used for checking the quality of the DNA by taking 30 genotypes selected systematically based on the result from the NanoDrop. The working DNA sample was diluted to obtain a final DNA concentration of 30–50 ng μL-1.

Polymerase chain reaction (PCR) and gel electrophoresis

Twenty-five SSR markers were used to carry out amplifications (Table 2). The SSR markers were purchased from Invitrogen Thermo Fisher from Scientific Life Technologies Europe BV, Nederlaenderna filial Sverige, Lindhagensgatan, Stockholm in 2020. The markers were selected based on polymorphic information content (PIC), allelic richness and herozygosity reports from various scientists [14, 24–26, 32, 33]. These SSR markers were developed from sequence information obtained by various authors [4, 24, 33–40]. The description of the primers is indicated in Table 2.
Table 2

List and description of SSR primers used for finger printing 152 chickpea genotypes.

SSR LocusPrimer Sequence (5’ to 3’)Repeat motifSize (bp)Linkage GroupReferences
ForwardReverse
CaSTMS 11 GTATCTACTTGTAATATTCTCTTCTCT ATATCATAAACCCCCCAC (GA)202324[25]
CESSR 42 TGGTTGAAGAAAAGAAGGTAGTG CGGTTCACTAATGCAAAAACCT (ACC)5298[24]
CESSR 62 ACCAGCTGCTAGACCTGATGTT GCAATAAAACAAAATCCTCACACC (TGA)5, (TAT)3245[24]
CESSR 71 TTGTAGTTCTCCTCTCTCTCTCTC CATCAAAACCAAACCTATGGAG (CT)C(CT)8, (CT)6, (CT)11295[24]
CESSRDB 45 AGATGGTTTGAATGTTGAGG CACTTGACCCTTTGATTGTT (AT)7(AG)5295[24]
CESSRDB 54 AGTGTTGTGGGTTTCATTTC TTGATTTGCCAAAGTACACA (TTA)5221[24]
GA 11 GTTGAGCAACAAAGCCACAA TTCTTGTCTGGTTGTGTGAGC (CT)211593, 1, 2, 6[25, 40]
GA 24 TTGCCAAAACCAATAACTCTG TCCCTTTTACACAAGGCCAG (GA)192031,2,4[25, 40]
GA-20 TATGCACCACACCTCGTACC TGACGGAATTCGTGATGTGT (CT)231742,6[38, 42]
NCPGR 100 CCATTTTCTACAATCTCATGTCT GTAGAAAGAGCCAAGAGGCA CT)15N42(CT)2CC(CT)5TT(CT)6AT(CT) 72631[25]
NCPGR 45 TGTTTTCAAATCAAACAGGC GATACACACCAAGGCACAGT (CT)2GTCAT(CT)5CC(CT)2CC(CT)172232[25]
NCPGR 53 CCCTCCTTCTTGCTTACAAA TAATGGTGAACGAATCATGG (CT)5CA(CT)CA(CT)10CA(CT)4CA(CT)TA(CT)4GTCA(CT)121941[25]
NCPGR 94 GGTTTGATGTGTTCTTGGCT CCCTCAATTCCCTCGATTTA (CT)251765[25]
SSR 1 TGAATTTTGTTTACCACCCCTC TTTGGCTTATTCTGTTCTTCCC (AG)20157[33]
SSR 22 GCTTTCCCTTTACTTCTTGGGT TGCTATTCAAGTCTCCCTCCTC (AATG)5275[33]
SSR 31 TAACGACAACGACAACAACAGC GCCATTCCAGAGAGCCTTG (AAC)14161[33]
SSR 4 GACAAAACAACCTCCCAAGAAA AACAACGACAACAACAACAACG (TTG)6279[33]
SSR 5 GAGCCCTGAAATGAAGAAAGAA CACCTTTGAGCCCTAGTCTGTT (AAAT)5387[33]
SSR 60 GGTCATGTTGATTTCTCACCAA GAACTTTCCGCACACGTTATG (AAAT)6337[33]
TA 144 ATTTTAATCCGGTGAATATTACCTTT GTGGAGTCACTATCAACAATCATACAT (TAA)272415,6,8[25, 40]
TA 18 AAATAATCTCCACTTCACAAATTTTC ATAAGTGCGTTATTAGTTTGGTCTTGT (TAA)241477,5,6[25, 40, 42]
TA 76s TCCTCTTCTTCGATATCATCA CCATTCTATCTTTGGTGCTT (AAT)7(AAT)4[ACT(AAT)11]2ACT(AAT)3TAT(AAT)2(ATT)52063,4[25, 40]
TR 1 CGTATGATTTTGCCGTCTAT ACCTCAAGTTCTCCGAAAGT (TAA)312245,6[25, 40]
TR 2 GGCTTAGAGTTCAAAGAGAGAA AACCAAGATTGGAAGTTGTG (TAA)362103[25, 40]
TR 29 GCCCACTGAAAAATAAAAAG ATTTGAACCTCAAGTTCTCG (TAA)8TAGTAATAG(TAA)32197–2517,5,1,3[25, 40, 42]
PCR reaction was performed with a Hybaid PCR express thermal cycler (Hybaid, UK) after optimizing the amplification conditions for each primer pair in a total volume of 10μl containing 50 ng of DNA,1.5mM MgCl2, 0.2mM dNTPs, 0.4 mM each of the forward and reverse primers and 0.05U/μlt Taq polymerase. The PCR was programmed at an initial denaturation step of 3 min at 94 °C followed by 35 cycles of 20 s denaturation at 94 °C, annealing at 55 to 60°C (depending on the primer) for 50 s, initial extension at 72°C for 50 s, and final extension at 72°C for seven mins. Before determining polyacrylamide gel staining, the amplified products were checked for the reproducibility of PCR products using a 2% agarose gel stained with ethidium bromide in a TBE buffer and were visualized on a UVITEC gel doc (UVITEC, UK). The resolution of PCR products was done on 6% polyacrylamide gel in 0.5x TBE buffer with a 6x DNA loading dye. Electrophoresis was carried out on a vertical electrophoresis set up using a standard DNA ladder (100 bp, Solis Biodyne, Estonia). The vertical electrophoresis was run with 100V for two hrs and 30mins, and stained using silver staining developed by Huang et al. [41]. Then gel pictures were taken using digital camera. The band sizes were determined using UVITEC (UVITEC, Cambridge, UK) software. Primer bands that were unclear or absent were sorted and repeated. Non-polymorphic, missing, faint and distorted gels were disregarded at scoring and only records of 23 primers with clear polymorphic bands were considered for statistical analysis.

Scoring SSR data and statistical analysis

Allelic data were recorded for each of the microsatellites markers for each genotype with the help of UVITEC software as well as visually. The allelic data scores locus-based diversity indices including the number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), Shannon’s information index (I), number of privet alleles (NPA), fixation index, percent polymorphism and unique alleles were recorded using GenAlEx v.6.502 [43]. Estimates of genetic differentiation were computed by analysis of molecular variance (AMOVA) to partition total genetic variation into within and among population subgroups using GenAlEx 6.502 [43]. PowerMarker 3.25 [44] was used to estimate major allele frequency (MAF), Gene Diversity (GD), and polymorphic information content (PIC). The allelic data scored was used to analyze principal coordinate analysis (PCoA) using GenAlEx v.6.502 [43]. Dendrogram tree was constructed based on Nei’s genetic distance using PowerMarker 3.25 and the tree was visualized using Molecular Evolutionary Genetic Analysis (MEGA 6) [45]. Dendrogram was constructed by the unweighted pair-group method with arithmetic averages (UPGMA) [46]. The structure of the population was analyzed based on the Bayesian model-based clustering method using Structure 2.3.4 software as suggested by Pritchard et al., [47]. This software assumes a model in which there are K populations, which contribute to the genotype of each individual. Burning period of 50,000 and 100,000 Markov Chain Monte Carlo (MCMC) iterations were used with independent replications of 10 times for each K value (K = 1 to 10) assuming an admixture model and uncorrelated allele frequencies. A web-based Structure Harvester program [48] was employed to determine the most likely value of K for each test [49].

Results

Microsatellite repeats locus diversity

The polyacrylamide gel electrophoresis pictures and the estimated genetic diversity parameters of the SSR locus diversity are indicated in Fig 2 and Table 3, respectively. The Visual observations on the gels of the amplification products of the respective markers revealed the existence of low (Fig 2C and 2D) to high (Fig 2A and 2B) level of polymorphism in the Ethiopian genotypes and exotic genotypes depending on the types of primer used. Among 152 chickpea genotypes a total of 133 alleles with an average value of 5.8 alleles per SSR were recorded. The allelic richness (Na) per locus varied widely among markers, ranging from two (CESSRDB 45, SSR22, and SSR 5) to 16 (TR 1). The number of effective alleles (Ne) ranged between 1.3 (CESSRDB 45) and 7.6 (TR 29), with an overall mean of 3.2. Shannon’s information index (I) was ranged from 0.4 (CESSRDB 45) to 2.1 (TR 1 and TR 29) with mean of 1.2. The average observed heterozygosity (0.4) was lower than the expected heterozygosity (0.6) and unbiased expected heterozygosity (0.6). The inbreeding coefficient (Fis) and fixation index (Fit) values ranged from -1.1 to 1.0 and -1.0 to 1.0, respectively. The major allele frequency varied from 0.11 (TR 29) to 0.88 (CESSRDB 45) with an average of 0.49. Polymorphic information content (PIC) values ranged from 0.19 (CESSRDB 45) to 0.9 (TR 1 and TR 29) with an average of 0.58. Seventeen markers (73.1%) had a PIC score of 0.5 and above. Gene diversity values ranged from 0.22 (CESSRDB 45) to 0.91 (TR 29) with an average of 0.67. Out of the total number of alleles only five alleles (0.07% of the total alleles detected) were private alleles observed in locus NCPGR 100 in genotypes 30307-A from East Gojjam2, TR 1 in genotypes Enewari1 from North Shewa, SSR 1 in genotypes enewari1 from North Shewa, SSR1 in genotypes 30347-B from North Wollo and NCPGR 94 in genotypes 41030 from Arsi Bale.
Fig 2

Polyacrylamide gel electrophoresis pictures obtained with TR 29 (A), TR 1 (B), SSR 22 (C) and CESSR 42 (D) primers detected in chickpea genotypes.

The lane numbers identify serial no of genotypes and M stands for 100 bp DNA ladder.

Table 3

Estimated genetic diversity parameters of 23 SSR markers in 152 chickpea genotypes.

LocusNaNeIHoHeuHeFHtFisFitFstNmMAFPICNPAGD
CaSTMS 11 52.00.80.00.40.51.00.71.01.00.40.50.490.5800.63
CESSR 42 52.71.10.00.60.61.00.81.01.00.21.10.320.7100.75
CESSR 62 31.90.70.50.40.4-0.10.5-0.20.10.20.90.590.4700.55
CESSR 71 52.81.20.40.60.70.40.70.40.40.11.70.440.6700.71
CESSRDB 45 21.30.40.50.20.2-1.40.2-1.1-1.00.06.00.880.1900.22
CESSRDB 54 41.80.70.20.40.40.60.60.60.70.30.70.530.4800.56
GA 11 62.81.20.30.60.60.60.70.50.60.12.00.420.6600.70
GA 24 62.61.20.30.60.60.60.70.60.70.21.30.390.6700.71
GA-20 63.11.30.50.70.70.30.80.30.40.11.50.380.7300.76
NCPGR 100 31.90.70.50.50.50.00.50.00.10.13.10.560.3810.49
NCPGR 45 42.61.10.70.60.6-0.20.7-0.2-0.10.12.60.450.6200.67
NCPGR 53 42.20.90.40.50.50.30.70.30.40.20.90.410.5900.65
NCPGR 94 103.91.50.60.70.80.20.80.20.30.11.90.260.8010.82
SSR 1 63.21.20.50.70.70.20.70.20.30.13.30.440.6610.70
SSR 22 21.30.40.30.20.2-0.20.2-0.2-0.20.07.40.850.2200.25
SSR 4 64.01.50.60.70.80.20.80.20.20.12.90.290.7800.80
SSR 5 21.80.60.00.40.41.00.51.01.00.21.40.550.3700.49
SSR 60 63.11.30.40.70.70.40.80.50.50.11.80.330.7200.75
TA 144 32.40.90.00.60.61.00.71.01.00.21.40.350.5900.66
TA 18 85.21.80.60.80.80.30.90.30.30.13.60.200.8400.85
TR 1 167.32.11.00.80.9-0.20.9-0.2-0.10.13.70.140.9020.90
TR 2 96.01.91.00.80.9-0.20.9-0.2-0.20.14.70.220.8600.87
TR 29 127.62.11.00.90.9-0.20.9-0.2-0.10.14.50.110.9000.91
Total 13373.3------------5-
Mean 5.83.21.20.40.60.60.20.70.30.30.12.60.420.63-0.67
SE 0.20.10.00.00.00.00.00.20.10.10.00.4----

Key: Na = number of alleles detected per locus; Ne = number of effective alleles; I = Shannon’s Information Index; Ho = Observed Heterozygosity; He = Expected Heterozygosity; uHe = Unbiased Expected Heterozygosity; F = fixation Index; Ht = Total Expected Heterozygosity; Fis = inbreeding coefficient; Fit = fixation index; Fst = genetic differentiation; Nm = Gene flow; MAF = major allele frequency; PIC = Polymorphic Information Center; NPA = number of privet alleles; GD = Gene Diversity; and SE is standard error.

Polyacrylamide gel electrophoresis pictures obtained with TR 29 (A), TR 1 (B), SSR 22 (C) and CESSR 42 (D) primers detected in chickpea genotypes.

The lane numbers identify serial no of genotypes and M stands for 100 bp DNA ladder. Key: Na = number of alleles detected per locus; Ne = number of effective alleles; I = Shannon’s Information Index; Ho = Observed Heterozygosity; He = Expected Heterozygosity; uHe = Unbiased Expected Heterozygosity; F = fixation Index; Ht = Total Expected Heterozygosity; Fis = inbreeding coefficient; Fit = fixation index; Fst = genetic differentiation; Nm = Gene flow; MAF = major allele frequency; PIC = Polymorphic Information Center; NPA = number of privet alleles; GD = Gene Diversity; and SE is standard error.

Genetic diversity in chickpea genotypes and population

The genetic diversity indices for chickpea genotypes based on geographic origins is summarized in Table 4. The observed numbers of alleles (Na) were in the range of 3.7 (Exotic Genotypes) to 5.3 (East Gojjam2). The number of effective alleles (Ne) ranged from 2.7 (Exotic Genotypes) to 3.6 (East Gojjam2 and North Shewa). Shannon’s information index (I) ranged from 1.0 (Exotic Genotypes) to 1.3 (East Gojjam 2). The mean of the observed heterozygosity (0.4) is less than expected heterozygosity (0.6) and unbiased expected heterozygosity (0.6). The inbreeding coefficient (F) estimate ranged from 0.0 (Exotic Genotypes) to 0.3 (North Gondar, Central Gondar, North Shewa, North Wollo and West Shewa) with the average of 0.2. The mean percentage of polymorphic locus (% P) across population was 99.5% varying from 95.7 to 100%. Higher values of number of private alleles (NPA) were observed in populations of East Gojjam 2 (0.04), North Shewa (0.09), North Wollo (0.04) and Arsi-Bale (0.04).
Table 4

Summary of parameters for genetic diversity in chickpea population from different geographic origins.

PopulationsPopulation diversity parameters
NaNeIHoHeUHeF% PNPAMAFPIC
East Gojjam1 4.73.31.20.50.60.60.295.70.000.500.55
East Gojjam2 5.33.61.30.50.60.60.2100.00.040.490.58
North Gondar 4.73.21.20.40.60.60.3100.00.000.520.54
Central Gondar 4.63.01.10.40.60.60.3100.00.000.550.51
North Shewa 5.13.61.20.40.60.60.3100.00.090.490.57
North Wollo 4.93.21.20.40.60.60.3100.00.040.520.55
West Shewa 4.43.11.10.40.60.60.3100.00.000.520.54
Arsi Bale 4.62.91.10.50.60.60.2100.00.040.560.52
Exotic Genotypes 3.72.71.00.50.50.60.0100.00.000.540.49
Mean 4.73.21.10.40.60.60.299.50.22--
SE 0.20.10.00.00.00.00.00.5---

Key: Na = number of alleles detected per locus; Ne = number of effective alleles; I = Shannon’s Information Index; Ho = Observed Heterozygosity; He = Expected Heterozygosity; uHe = Unbiased Expected Heterozygosity; F = fixation Index; % P = percent polymorphism; NPA = number of private Alleles; MAF = major allele frequency; PIC = Polymorphic Information Center and SE = standard error.

Key: Na = number of alleles detected per locus; Ne = number of effective alleles; I = Shannon’s Information Index; Ho = Observed Heterozygosity; He = Expected Heterozygosity; uHe = Unbiased Expected Heterozygosity; F = fixation Index; % P = percent polymorphism; NPA = number of private Alleles; MAF = major allele frequency; PIC = Polymorphic Information Center and SE = standard error.

Analysis of molecular variance (AMOVA) and partitioning genetic diversity

The AMOVA showed that 88% of the allelic variation was attributed to individual genotypes within populations, while only 12% was distributed among populations (Table 5). The local population contributed 7% (West Shewa) to 14% (East Gojjam2), while the exotic genotypes contributed 7.6% of the total variation. The value of pairwise comparisons of population differentiation (Fst) and Gene flow (Nm) among geographical regions of chickpea populations are indicated in Table 6. Highest Fst value was observed between exotic genotypes and chickpea populations from central Gondar (0.18) and Arsi-Bale (0.18), while the lowest was recorded between chickpea population of North Shewa and Central Gondar (0.05), North Wollo (0.05) versus North Shewa, and Arsi-Bale and West Shewa (0.05). Generally the exotic genotypes showed high Fst value compared to chickpea genotypes of Ethiopian origin than pairwise comparison between chickpea population within Ethiopian origin. Gene flow (Nm) between and within geographical regions was recorded from 1.16 (Arsi-Bale versus Exotic Genotypes) to 3.96 (East Gojjam2 versus North Gondar).
Table 5

Analysis of Molecular Variance (AMOVA) showing the distribution of genetic diversity within and among populations of chickpea genotypes from different sources of origins.

Source of variationsDegree of freedomSum squareMean squareVariance Estimated variancesProportion of explained variance in %StatisticsValue P value
Among Pops 8288.99335.8740.85612
Within Pops 2952114.2247.1677.16788PhiPT0.1070.001
East Gojjam1 306.50012.8
East Gojjam2 336.413 14
North Gondar 221.6889.2
Central Gondar 186.6077.8
North Shewa 317.68213.2
North Wollo 219.3139.1
West Shewa 167.5007.0
Arsi Bale 177.3087.4
Exotic Genotypes 181.2147.6
Total 3032402.2178.023100
Table 6

Pairwise population differentiation (Fst) values above diagonal and gene flow (Nm) below diagonal among chickpea populations from different growing geographic areas based on the probability level based on 999 permutations.

Population East Gojjam1 East Gojjam2 North Gondar Central Gondar North Shewa North Wollo West Shewa Arsi Bale Exotic Genotypes
East Gojjam1 00.07*0.08*0.13**0.10**0.14**0.13**0.11**0.16**
East Gojjam2 3.1400.06*0.09*0.07**0.14**0.10**0.09**0.14**
North Gondar 2.903.9600.13**0.07**0.12**0.11**0.13**0.12**
Central Gondar 1.692.571.7400.05**0.10**0.09**0.13**0.18**
North Shewa 2.253.243.114.8700.05**0.08**0.10**0.16**
North Wollo 1.571.581.802.194.6700.08**0.11**0.16**
West Shewa 1.662.372.122.632.962.7900.05**0.15**
Arsi/Bale 2.052.591.731.752.262.034.3500.18**
Exotic Genotypes 1.291.591.751.121.321.331.471.160

Principal coordinates analysis (PCoA)

The multivariate principal coordinate analysis (PCA) of the molecular data showed that the first 3 coordinates were important and accounted for 26.6% of the variation; PCs 1 (14.0%), 2 (6.9%), and 3 (5.7%). The PCA plots of PC 1 versus PC 2 using factorial analysis of GenAlEx showed the exotic genotypes were clustered in quadrant I entirely, while a wide dispersion of Ethiopian genotypes across the four quadrants (Fig 3) were observed without considering their geographic origin. Genotypes collected from East Gojjam1 clustered in quadrant III (eight genotypes), and IV (13 genotypes) forming small sub-clusters in both quadrants. A single genotype from this zone falls in quadrant I. East Gojjam2 collections clustered in quadrant I (8 genotypes), III (3 genotypes), and IV (12 genotypes) sowing a tendency of forming sub-clusters in each quadrant. Genotypes of North Gondar clustered in quadrant I (5 genotypes) and IV (9 genotypes). The remaining two genotypes were grouped in cluster II and III. The majority of the genotypes collected from Central Gondar were clustered in quadrant III (8 genotypes). The remaining five genotypes and one genotype fall in quadrant II and I, respectively. Genotypes of North Shewa collection were clustered in quadrant I (3 genotypes), II (7 genotypes), III (10 genotypes), and IV (1 genotype). Genotypes from North Wollo formed two sub clusters in quadrant II (12 genotypes). The remaining one and four genotypes clustered in quadrant I and III, respectively. Genotypes from West Shewa were clustered in quadrant I (4 genotypes) and II (8 genotypes). Genotypes of Arsi Bale appeared be widely distributed in all quadrants, I (4 genotypes), II (3 genotypes), III (2 genotypes), and IV (4 genotypes).
Fig 3

Two-dimensional plot obtained from principal coordinate analysis (PCoA) of 152 chickpea accessions using 23 SSR markers.

Genetic distance

The pairwise Nei’s unbiased genetic distances (above diagonal) and unbiased genetic identity values (below diagonal) for all the chickpea populations representing the growing regions are shown in Table 7. The matrix of pairwise Nei’s unbiased genetic distances between populations showed a close genetic distance between North Shewa and Central Gondar populations (0.09), North Wollo and North Shewa (0.09), and West Shewa and Arsi-Bale (0.09). On the other hand, the largest genetic distance (0.37) was obtained between population of Arsi-Bale and exotic genotypes. Generally, genetic distances between Ethiopian chickpea population and exotic genotypes were greater than any other combinations of paired populations within Ethiopia. The highest genetic identity value (0.92) was recorded between North Shewa population and Central Gondar population and the lowest genetic identity value (0.68) was recorded between Arsi-Bale and exotic genotypes. The genetic identity pairwise comparisons within genotypes of Ethiopian origins were more than the comparison between exotic with genotypes of Ethiopian origins.
Table 7

Pairwise Population Matrix of Nei’s unbiased genetic distance (DA) above diagonal and Pairwise Population Matrix of Nei unbiased genetic identity below diagonal among chickpea populations from different origins.

Populations East Gojjam1 East Gojjam2 North Gondar Central Gondar North Shewa North Wollo West Shewa Arsi-Bale Exotic Genotypes
East Gojjam1 *0.150.150.230.210.250.250.210.34
East Gojjam2 0.86*0.110.170.150.310.200.170.29
North Gondar 0.860.89*0.220.140.250.210.250.26
Central Gondar 0.770.840.78*0.090.190.150.240.38
North Shewa 0.810.860.870.92*0.090.160.200.35
North Wollo 0.760.760.780.830.91*0.160.200.33
West Shewa 0.760.820.810.860.850.86*0.090.29
Arsi-Bale 0.810.840.780.790.820.820.91*0.37
Exotic Genotypes 0.710.750.750.690.710.720.750.68*

Cluster analysis

A dendrogram tree based on Nei’s genetic distances was constructed using PowerMarker V3.25 software. The result from UPGMA based dendrogram shows that nine chickpea populations from different geographic origins were grouped into two major clusters (Fig 4). The first cluster contained the exotic genotype population, while cluster II consisted of the Ethiopian populations. Cluster II was divided into three sub-clusters showing the tendencies of grouping the neighboring regions together. The 152 genotypes were divided into two major clusters (Fig 5). Cluster I had 14 genotypes which were exclusively from the exotic genotypes. Cluster II was further sub divided into six distinct sub-clusters with variable number of genotypes in each sub-cluster. Sub-cluster 1 consisted of 27 genotypes with the following proportions, 22 (81.5%) from East Gojjam 1, two (7.4%) from East Gojjam 2, and three (11.1%) from Arsi-Bale. Sub-cluster 2 was composed of 25 genotypes of which 19 (76%) genotypes were from East Gojjam 2 and six (24%) genotypes from North Gondar. Sub-cluster 3 was composed of 14 genotypes of which 9 (64.3%) genotypes were from North Gondar, four (28.6%) from North Shewa and one (7.1%) from Arsi-Bale. Sub-cluster 4 contained 25 genotypes of which two genotypes (8%) were from East Gojjam 2, one genotype (4%) from North Gondar, 12 genotypes (48%) from Central Gondar, and 10 genotypes (40%) from North Shewa. Sub-cluster 5 included 9 (64.3%) genotypes from North Wollo, three (21.4%) genotypes from West Shewa, and two genotypes (14.3%) from Arsi-Bale. Sub-cluster 6 represented a heterogeneous group which constituted 33 genotypes of which two (6.1%) genotypes were from Central Gondar, 8 (24.2%) genotypes from North Shewa, seven genotypes (21.2%) from North Wollo, nine (9%) genotype from West Shewa and seven genotypes (21.2%) from Arsi-Bale.
Fig 4

UPGMA dendrogram showing the genetic relationships of nine chickpea populations collection areas.

Fig 5

UPGMA based dendrogram of 152 chickpea genotypes obtained using 23 SSR markers and Niel 1983 frequency based distance (*** Kabuli types chickpea, while the rest are desi type chickpea).

Population structure

The population structure of the 152 chickpea genotypes was analyzed and the results showed that the highest peak was observed at K = 2 indicating the presence of two major clusters (Fig 6 and Table 8). The result from STRUCTURE analysis further confirmed results of the UPGMA tree clustering. Based on the probable likelihood of each genotype to be grouped into any of the two distinct groups, a total of 85 genotypes (55.9%) were grouped into one of the two populations. The first cluster which was of 43 (28.3% of total genotypes) genotypes were grouped into population 1, the next 42 (27.6%) into population 2. The remaining 67 genotypes (44.1%) were placed in the admixture group (Table 8). Cluster I was composed of 32.6%, 23.3%, 14% and 30.2% East Gojjam1, East Gojjam2, North Gondar and the exotic genotypes, respectively. Cluster II was made from 4.8%, 7.1%, 19.0 5, 19.0%, 26.2%, 14.3%, 9.5% from East Gojjam2, North Gondar, Central Gondar, North Shewa, North Wollo, West Shewa, Arsi-Bale, respectively. All population contributed to admixed group with variable proportion ranging from 1.5% (Exotic Genotypes) to 19.4% (East Gojjam2).
Fig 6

Structure bar plot assigning 152 chickpea genotypes in two groups (K = 2) based on 23 SSR markers analyzed by the structure program, showing proportion of the two groups in each zones, where 1 = East Gojjam1, 2 = East Gojjam2, 3 = North Gondar, 4 = Central Gondar, 5 = North Shewa, 6 is North Wollo, 7 is West Shewa, 8 = Arsi-Bale and 9 = Exotic Genotypes, q = membership coefficient.

Table 8

Proportion of membership of each predefined nine population in each of the clusters obtained at the best K (k = 2).

Predefined PopulationsTotal Number of genotypesAdmixedCluster 1Cluster 2
Number of genotypesProportion in %Number of genotypesProportion in %Number of genotypesProportion in %
East Gojjam1 22811.91432.600.0
East Gojjam2 231319.41023.324.8
North Gondar 16710.4614.037.1
Central Gondar 1469.000.0819.0
North Shewa 221217.900.0819.0
North Wollo 1657.500.01126.2
West Shewa 1269.000.0614.3
Arsi-Bale 13913.400.049.5
Exotic Genotypes 1411.51330.200.0
Total 1526744.14328.34227.6
Average Distance ---0.65650.6408
Mean value of Fst ---0.03960.0904

Fst is genetic differentiation

Fst is genetic differentiation

Discussion

Efficient germplasm conservation and sustainable utilization requires a clear understanding of the genetic structure, diversity, and relationships among chickpea genotypes. This information is also helpful for breeders to identify new sources of germplasm harboring valuable alleles for improving yield, grain quality, and enhancing the level of resistance in cultivated varieties to various biotic and abiotic stresses [14, 50]. Molecular diversity and population structure studies using SSR markers for Ethiopian chickpea are limited. Therefore, this work was initiated with the main objective of analyzing the genetic structure, diversity, and relatedness of Ethiopian chickpeas genotypes, improved varieties, and exotic chickpea genotypes received from ICARDA using 23 SSR markers. Result from SSR analysis indicated the presence of considerable allelic richness per locus, relatively moderate to high PIC, Ho and He values, and the presence of private alleles. High level of genetic diversity indicates the existence of molecular variation among the analyzed chickpea genotypes. High PIC values were also reported by Sefera et al [26], Getahun et al. [28] and Ghaffari et al. [51] which is in agreement with the present study, however a lower number of effective alleles per locus was recorded in the present study in contrast to that of Sefera et al [26] and Getahun et al [28]. This happened because of the different number of accessions, different number of loci examined, and the nature of markers used in each study. However, comparable results were reported from Keneni et al. [25]. The high level of PIC values were an indicator of the efficiency of the markers for diversity studies in chickpea genotypes because a locus, with an estimated PIC value greater than 0.50, is considered to be highly diverse [52]. Nineteen markers had a score of 0.5 and above which indicates that these markers are highly informative SSR markers that could be employed in genetic diversity studies in chickpea. The ability of SSRs to detect intraspecific as well as interspecific variation in chickpea has been demonstrated by many authors [14, 28, 39, 53]. In this study, loci CaSTMS 11, CESSR 42, CESSRDB 54, GA 11, GA 24, SSR 22, and SSR 5 exhibited low-level of observed heterozygosity compared to the expected heterozygosity. Moreover, the high associated fixation index, implies that high levels of inbreeding among the assessed chickpea genotypes, which is expected because chickpea is a self-pollinated crop, previously only 0 to 1.58% of outcrossing was reported [51]. Simultaneously, loci CESSR 62 CESSR 71, NCPGR 45, NCPGR 53, NCPGR 94, SSR 1, SSR 4, TA 18, TR 1, TR 2, and TR 29 had a high-level of observed heterozygosity and low associated fixation index. This indicates that these loci could be associated with the occurrence of higher mutation rates or inbreeding depression [14]. The low level of heterozyogosity observed for the majority of the SSR markers are in accordance with other studies [14, 25]. However, higher level of heterozygosity was also reported for some SSR markers [24, 28, 54, 55]. According to Ghaffari et al. [51], allelic frequency <0.03 is considered as low, 0.03–0.20 considered as common, and > 0.20 considered as most frequent. Based on this delineation, rare alleles comprised 7.5% (10 alleles) of all the detected alleles while intermediate alleles accounted for 63.9% (85 alleles). The remaining alleles accounted for 28.6% of the allelic frequency (38 alleles) (data are not included). All of the nine chickpea populations had a high percentage of polymorphism among the populations with the range of 95.7% to 100% and average of 99.5%. Comparable values of Shannon’s Information Index were recorded for all populations. A relatively high number of alleles, effective alleles, and Shannon’s information index were recorded in East Gojjam 2, which implies that chickpea genotypes from East Gojjam 2 are more diverse than the remaining chickpea collections of other geographic regions. The low-levels of private alleles were recorded in East Gojjam 2, North Shewa, North Wollo and Arsi Bale. Matus and Hayes [56] suggested that the occurrence of unique alleles could be an indication of the relatively high rate of mutation and diversity at SSR loci. The occurrence of unique or rare alleles has the potential to serve as a source of novel alleles for plant breeding and also provides an immense opportunity for generation of comprehensive fingerprint database for establishing genotype identity [57]. The percentage of polymorphism among Ethiopian chickpea populations discovered by Keneni et al. [25] and Getahun et al. [28] were lower than the present finding. The differences in values for estimated genetic diversity parameters between studies may be explained by different types and numbers of genotypes, different numbers and types of loci examined and perhaps the nature of markers used in each study. AMOVA results indicate much of the variation was accounted for by the variation within population rather than among populations, suggesting that individual variation was more important for chickpea breeding programs. The low-level of molecular variation among population indicates that the presence of a high number of shared alleles among populations collected from different origins [58]. The exotic genotypes contributed 7.6% to the total molecular variation which provided an opportunity to expand the chickpea gene pool of Ethiopian origin, if there is no complete replacement of local germplasm with the improved ones. A low-level of molecular variation among chickpea populations were also reported from Keneni et al. [25] and Getahun et al. [28] for Ethiopian genotypes and Valadez-Moctezuma et al. [50] for Mexican chickpea. According to Wright [59] the combination of Fst rating, Fst value of 0.00 to 0.05 indicates low, 0.05–0.15 indicates moderate, 0.15–0.25 indicates high, and 0.25 indicates a very high-level of differentiation. Based on this delineation, the Fst score for the present study could be rated as low to moderate level of differentiation among populations with an increased level of admixtures which is the possible reason for the existence of the low-level of molecular variation among populations. Similar observation was made in cowpea [60]. The lower level of variation among populations might be attributed to germplasm exchange among regions and this is further confirmed from the result of pairwise gene flow (Nm) values among populations which were scored within the range of 1.12 to 4.87 exhibiting gene exchange among populations. A Nm value greater than 1 is considered an indicator of adequate gene flow among populations [61]. The genetic distance results showed that the genetic distance between each of the Ethiopian populations (eight populations) and the exotic population was higher than any pair of combinations within Ethiopian populations. This indicates that the genetic similarity between the exotic genotype and the Ethiopian populations is low, implying that Ethiopian populations are distantly related to exotic genotypes. However, close distance was estimated among Ethiopian populations collected from different regions, indicating that the highest genetic similarity was existed among Ethiopian chickpea genotypes. These results are in agreement with findings from Keneni et al. [25] and Getahun et al. [28]. In addition, UPGMA dendrogram tree of nine chickpea populations based on origins showed tendencies to be grouped together which indicates that the patterns of genetic relationships are among proximity areas of collections. PCoA result indicates that the Ethiopian genotypes were uniformly distributed in the four quadrants regardless of their geographic origins, while the exotic genotypes were grouped in quadrant I forming sub-clusters which are distinct from the local genotypes. Genotypes from East Gojjam 2, North Shewa, and Arsi-Bale were highly diverse because they were evenly distributed in the three quadrants regardless of their geographic origins. However, some Ethiopian genotypes and the exotic genotypes appeared to follow geographic origins from which the genotypes were obtained. This result is supported by earlier studies using SSR markers [14, 25, 42]. The distinct identity of the exotic genotypes could be a consequence of deliberate selection criteria followed by the breeders in the development of these varieties [14]. The dendrogram tree constructed using the UPGMA clustering algorithm, clearly delineated the genotypes into two major clusters, Cluster I and Cluster II. Cluster II sub-divided into six sub-clusters, each consisted of variable number of genotypes. The exotic genotypes grouped in a single cluster. Results generated from dendrogram were also in agreement with those of the PCoA result. The patterns of genotypes clustering based on their geographic region were not consistent because some genotypes were grouped together according to their geographical proximity. This situation implies genetic distance doesn’t follow geographical distance. Similar trends were reported by earlier works in chickpea [24, 28, 50]. The most probable reason could be seed exchange, and/or trade between farmers, leading to gene flow across boundaries within those areas. The dendrogram did not indicate any clear divisions between desi and kabuli type chickpea in the exotic genotypes. This may be due to the markers used for this experiment were not directly related with the characteristics that differentiate kabuli from desi type chickpea [50]. However, various authors have reported that the clustering of chickpea genotypes appears to follow geographic distribution from where these germplasm lines were obtained [41, 51, 53, 55] and Sefera et al. [26] and Getahun et al. [28] showed SSR markers in discriminating kabuli genotypes with that of desi genotype. Applications of model-based clustering methods in the STRUCTURE software is helpful to demonstrate the presence of population structure, identify distinct genetic populations, assign individuals to populations, and identifies admixed individuals [47]. In the present study, a structured population in chickpea was revealed, and was divided into two groups. The analysis of population structure revealed similarity with the results obtained from UPGMA clustering. The chickpea genotypes used for this study evolved from two population types showing varying degrees of introgression of the two types into respective genotypes. Structure is considered to be uniform when more than 80% of the accessions in one group have more than 80% membership of the group [14, 47]. There were no genotypes showing uniform structure with 100% membership in their cluster, indicating that the existence of gene flow or introgression was apparent. According to Gemechu et al. [25] result Ethiopian chickpea germplasm of different collection of this study were grouped into five clusters of distinct genetic populations. They proposed that the genotypes resulted from independent evolutionary mechanisms (genetic drift, mutation, migration, selection, and in flux/out flux of genes in the form of germplasm exchange) that split them into discrete gene pools. Gene introgression is critical for breeders for variety development programs because it provides essential trait combinations such as improved agronomic features, high resilience to environmental challenges, diseases, and insects, as well as other benefits such as improved nutritional quality [14]. It is also applicable to broaden the genetic base of chickpea genotypes through crossing programs.

Conclusions

The magnitude and pattern of genetic variation was estimated, which indicated that a considerable genetic diversity existed in Ethiopia chickpea genotypes. The results also further confirmed the efficiency and effectiveness of SSR markers to study genetic diversity in chickpea. This result will have a direct applicability for efficient and systematic conservation and sustainable utilization of germplasm. This result can assist chickpea breeders in selecting diverse parental materials for crossing activities to take the advantage of heterosis value. The results are also helpful for genebank managers because there are large numbers of genotypes clustering in one group collected from the same locality and it seems that these genotypes are duplicated genotypes which are the major problems in germplasm conservations. To reduce the high amount of redundancy in germplasm collections, techniques including deliberate bulking and the establishment of core collections must be implemented. Though this work provided preliminary information regarding the existences of genetic diversity, studies related to marker traits association are required. Therefore, a comprehensive study to map the associations of the markers with agronomic traits of economic importance is required.

Passport data for 152 chickpea genotypes used for the study.

(XLSX) Click here for additional data file. 19 Aug 2021 PONE-D-21-21598 Genetic variability and Population Structure of Ethiopian chickpea (Cicer arietinum L.) germplasm PLOS ONE Dear Dr. Admas, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Oct 03 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Roberto Papa, PhD Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: “The study is part of the first author PhD thesis funded by Ethiopia Biodiversity Institute and Addis Ababa University.” We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: “The author(s) received no specific funding for this work.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. 4. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In general I've found that the article is well written, however I did not find that results are particularly interesting, simply there are no great differences between accessions based on geographical origin. Despite could have been an interesting point to understand wheter the geography of Ethiopia shaped the genetic background of chickpea ethiopian population, i would suggest to include not only released variaties and breeding lines but eventually to concentrate also on landraces, in order to understand if the gene flow and introgression happend also within local varieties, which could be an interesting point. Moreover I would like to see more clearly the geograohical distribution of accessions considering it is what is defining your groups, indeed I can't take an ethiopian map and control the place of each district you cite, I would add a map, eventually to the supplementary. Moreover, majority of studies on genetic resources in ethiopia take into account the aspect of altitude, which is an interesting point in ethiopian landscape, you could try to group districts by altitude and see wheter this clusterize better your accessions but as curiosity. However the statistical analysis you have done are completed and well executed and everything is well explained. I would absolutely reccomend you to redo the image of gel electophoresis from zero as it is not suited for publication. I also want to see images in a better resolution for publication, here and there is impossible to distinguish the names of accessions. I do believe that your conclusions could however be useful for future breeding program, however I still have doubts on the choice of the vegetal material for this kind of study. Finally, without any doubt the population structure result is the more interesting, partly confirmed by other analysis, thus I would discuss it deeper in discussion and eventually hypothesize the reasons of such a structuring. I would also being interested in a more precise characterization of the genetic resources you used, for example the habitus, the group (desi or kabuli), something easy that could help the reader understanding with which type of material we are dealing with. However the work is well done, I appreciate the writing which is clear and well summarized. English is good and in general it is ok for publication (apart from images resolution that you have to correct). Reviewer #2: overall the work seems well done, I have no reservations regarding the analyzes carried out, and the manuscript is written in correct English. however, I have some suggestions to present. minor issues I suggest some adjustments in the form: - from lines 65 to 69: the sentence is long and not very fluent. - from lines 79 to 83: shorter and more fluently. - from lines 448 to 451: the sentence is long and not very fluent. major issues - in the materials and methods, it is not specified if the 138 genotypes are landraces, explain better - in the discussions the author writes: "The dendrogram did not indicate any clear divisions between desi and kabuli type chickpea ", but the material distinction in desi and kabuli has not been addressed in materials and methods. therefore overall I suggest a better description of the material used, moreover, to insert a figure of the geographical distribution of the material used. -I suggest a better quality of results of the images used, in particular Fig1 and Fig3. -Finally, I suggest the author to spend a few lines to comment on a possible reason in the population structure for the presence of two groups. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 27 Aug 2021 I have included in the revised manuscript all comments and suggestions given by reviewers. Except the following points 1. Clustering genotypes based on altitude: The result did not show altitudinal clustering patterns indicating that there were no great differences between accessions based on altitudinal gradients. Because of the study was targeted at the major chickpea growing areas of Ethiopia. The altitudinal variations among the collection sites were narrow, which makes difficulty to see altitudinal effects to the genotypes. In addition, the informal seed exchange systems have been practiced for centuries among traditional farmers in Ethiopia. So, we got similar results that of geographical origin and we did not present the result to limit the size of the paper. (For Reviewer 1) 2. Fig 1 (now Fig 2): is not addressed because silver stained gel picture have most of the time less resolution power. (Both Reviewers) Submitted filename: Response to Reviewers.doc Click here for additional data file. 15 Nov 2021 Genetic variability and population structure of Ethiopian chickpea (Cicer arietinum L.) germplasm PONE-D-21-21598R1 Dear Dr. Admas, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Roberto Papa, PhD Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: I have really appreciated that authors added a description of the vegetal material used in the research and also the map showing the geographical points of collection is interesting and I'm glad they haved decided to include it. In my opinion the written parts added to the text and the corrections made by the author lead to a clearer and more fluent reading of the article. Reviewer #2: I believe that the revisions and changes are sufficient, making the paper complete and more fluent in content and written form. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No 16 Nov 2021 PONE-D-21-21598R1 Genetic variability and population structure of Ethiopian chickpea (Cicer arietinum L.) germplasm Dear Dr. Admas: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Prof. Roberto Papa Academic Editor PLOS ONE
  26 in total

1.  Comparison of different nuclear DNA markers for estimating intraspecific genetic diversity in plants.

Authors:  Hilde Nybom
Journal:  Mol Ecol       Date:  2004-05       Impact factor: 6.185

2.  A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel.

Authors:  Ling Huang; Xiaohui Deng; Ronghua Li; Yanshi Xia; Guihua Bai; Kadambot H M Siddique; Peiguo Guo
Journal:  J Vis Exp       Date:  2018-04-20       Impact factor: 1.355

3.  Genetic diversity and geographical differentiation of Iranian landrace, cultivars, and exotic chickpea lines as revealed by morphological and microsatellite markers.

Authors:  Parvin Ghaffari; Reza Talebi; Fatemeh Keshavarzi
Journal:  Physiol Mol Biol Plants       Date:  2014-03-06

4.  Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome.

Authors:  P Winter; T Pfaff; S M Udupa; B Hüttel; P C Sharma; S Sahi; R Arreguin-Espinoza; F Weigand; F J Muehlbauer; G Kahl
Journal:  Mol Gen Genet       Date:  1999-08

5.  Accuracy of estimated phylogenetic trees from molecular data. II. Gene frequency data.

Authors:  M Nei; F Tajima; Y Tateno
Journal:  J Mol Evol       Date:  1983       Impact factor: 2.395

6.  Genetic structure and diversity analysis of the primary gene pool of chickpea using SSR markers.

Authors:  P Choudhary; S M Khanna; P K Jain; C Bharadwaj; J Kumar; P C Lakhera; R Srinivasan
Journal:  Genet Mol Res       Date:  2012-04-10

7.  Genetic structure, diversity, and allelic richness in composite collection and reference set in chickpea (Cicer arietinum L.).

Authors:  Hari D Upadhyaya; Sangam L Dwivedi; Michael Baum; Rajeev K Varshney; Sripada M Udupa; Cholenahalli L L Gowda; David Hoisington; Sube Singh
Journal:  BMC Plant Biol       Date:  2008-10-16       Impact factor: 4.215

8.  Molecular genetic diversity and population structure of Ethiopian white lupin landraces: Implications for breeding and conservation.

Authors:  Mulugeta Atnaf; Nasser Yao; Kyalo Martina; Kifle Dagne; Dagne Wegary; Kassahun Tesfaye
Journal:  PLoS One       Date:  2017-11-30       Impact factor: 3.240

Review 9.  Simple sequence repeat polymorphisms (SSRPs) for evaluation of molecular diversity and germplasm classification of minor crops.

Authors:  Yong-Jin Park; Ju Kyong Lee; Nam-Soo Kim
Journal:  Molecules       Date:  2009-11-10       Impact factor: 4.411

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.