Literature DB >> 34819553

The genome of the diatom Chaetoceros tenuissimus carries an ancient integrated fragment of an extant virus.

Yuki Hongo1, Kei Kimura2, Yoshihiro Takaki3, Yukari Yoshida3, Shuichiro Baba4, Genta Kobayashi2, Keizo Nagasaki5, Takeshi Hano6, Yuji Tomaru7.   

Abstract

Diatoms are one of the most prominent oceanic primary producers and are now recognized to be distributed throughout the world. They maintain their population despite predators, infections, and unfavourable environmental conditions. One of the smallest diatoms, Chaetoceros tenuissimus, can coexist with infectious viruses during blooms. To further understand this relationship, we sequenced the C. tenuissimus strain NIES-3715 genome. A gene fragment of a replication-associated gene from the infectious ssDNA virus (designated endogenous virus-like fragment, EVLF) was found to be integrated into each 41 Mb of haploid assembly. In addition, the EVLF was transcriptionally active and conserved in nine other C. tenuissimus strains from different geographical areas, although the primary structures of their proteins varied. The phylogenetic tree further suggested that the EVLF was acquired by the ancestor of C. tenuissimus. Additionally, retrotransposon genes possessing a reverse transcriptase function were more abundant in C. tenuissimus than in Thalassiosira pseudonana and Phaeodactylum tricornutum. Moreover, a target site duplication, a hallmark for long interspersed nuclear element retrotransposons, flanked the EVLF. Therefore, the EVLF was likely integrated by a retrotransposon during viral infection. The present study provides further insights into the diatom-virus evolutionary relationship.
© 2021. The Author(s).

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34819553      PMCID: PMC8613185          DOI: 10.1038/s41598-021-00565-3

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Diatoms (Bacillariophyta) are an important group of oceanic eukaryotic phytoplankton accounting for approximately 40% of primary marine production[1,2]. The TARA Oceans project, a global plankton sampling campaign, has highlighted the significance of diatoms in global biogeochemical cycles[3,4]. Research on the dynamics of diatoms is, therefore, important to understand global ecosystems. Generally, the growth and photosynthetic activity of diatoms are higher than those of other phytoplankton and are often responsible for the blooms found in coastal and upwelling regions, thus playing a role as a major food resource for zooplankton, larvae, and filter feeders[5,6] among others. Diatom dynamics, in addition to predation, are primarily controlled by environmental factors, such as water temperature, light, and nutrients[5,7]. Other than these abiotic factors, diatom populations are exposed to diverse biological stressors. Over the past three decades, numerous studies have suggested that viral infections are a major determinant of phytoplankton fate in aquatic environments[8]. Indeed, knowledge regarding diatom viruses has accumulated rapidly since their first report in 2004. Two main virus groups infecting diatoms have been identified, namely single-stranded (ss) DNA and ssRNA diatom viruses[9]. Diatom cell death due to viral infections can be readily observed in the laboratory, with infected cultures dying off in a few days[9]. In nature, however, the diatom population does not exhibit a rapid decrease in numbers, even in the presence of these infectious viruses; therefore, they seem to have the ability to coexist in the same region[10,11]. Hence, diatoms are thought to have evolved a mechanism to resist viral infections, as has been observed in other phytoplankton-virus systems. The virus resistance mechanisms of eukaryotic microalgae have been reported by numerous researchers, e.g., variation in susceptibility in the host cell[12-14], blockade of intracellular virus genome replication[15], bacterially mediated virus resistance[16], and host cell physiological barriers[17,18]. In addition, recent genomic and transcriptomic analyses have revealed virus resistance systems at higher resolutions. For example, variabilities in genomic islands containing the viral-attachment genes of the cyanobacteria Prochlorococcus facilitate host-virus coexistence[19]. Moreover, for the smallest eukaryotic phytoplankton, Ostreococcus tauri (Mamiellophyceae), the size of the hypervariable region in chromosome 19 differs greatly among strains, which is assumed to be closely related to its susceptibility to infection by its dsDNA virus, OtV[20,21]. Furthermore, in many hosts organism-virus relationships, whole- or partial- viral genome sequences present in the host DNA can act as a viral resistance factor, e.g., superinfection exclusion and RNA interference related mechanisms[22-25]. To gain a more in-depth understanding of the host-virus systems, recent studies have highlighted the importance of using host genome analyses[26-28]. The marine planktonic diatom, Chaetoceros tenuissimus Meunier (Bacillariophyta, Centrales), is rectangular in the girdle view and is one of the smallest (~ 5 µm) diatoms. This species is widely distributed and is observed in Japanese coastal waters[10], the Narraganset Bay[29], the Mediterranean Sea[30,31], and the San Matıas Gulf[32]. A previous study showed that C. tenuissimus has a high growth rate of at least three divisions per day and blooms during spring and autumn to levels of ~ 107 cells/l[10]. To date, four different viruses capable of infecting C. tenuissimus have been isolated and characterised, two different ssDNA viruses (CtenDNAV type-I and type-II), and two different ssRNA viruses (CtenRNAV type-I and type-II)[9,33]. However, the C. tenuissimus population in natural environments sustains its bloom size even in the presence of these viruses[10,11]. The tolerance to viral infection, along with their high growth rate, suggests that C. tenuissimus is to be a successful and ubiquitous species for maintaining primary productions in coastal environments. Knowledge on the relationship between C. tenuissimus and its viruses has gradually accumulated from the viewpoint of growth-physiology studies based on traditional culture experiments[17,34], however, studies focusing on the aspect of cell biology are lacking. Here, we have explored the utility of genomic sequencing for this diatom species to further the current understanding regarding host-virus interactions at the molecular level. We believe that novel genomic discoveries can provide critical insights into the evolution of the diatom-virus relationship.

Results

Genome assembly and gene prediction

A total of 16.6 Gigabases (Gb) of sequence, providing a 150-fold coverage of the genome sequence, was obtained using the Illumina Miseq and Nanopore MinION platforms and assembled into 41 megabases (Mb) in a total of 85 scaffolds, ranging in size from approximately 1 kb to 4.46 Mb (Supplementary Table 1). In those scaffolds, telomeric sequence repeats (TTAGGG) were detected in 3 scaffolds (accession numbers BLLK01000038, BLLK01000056, and BLLK01000043) although the assembly is not yet at the chromosome level. The haploid genome size and its heterozygosity were estimated at 39.7 Mb and 1.56%, respectively (Supplementary Fig. 1) using the kmer-based statistic, and the size corresponding to the assembly. There is no huge insertion and inversion between haploid sequences (Supplementary Fig. 2). The accuracy of the genome assembly was confirmed by comparing it with the T. pseudonana and T. oceanica genomes using BUSCO software[35]. The 82 complete genes assigned by BUSCO were identified in the C. tenuissimus genome assembly, and the number was larger than that for the Thalassiosira species (Supplementary Table 2). Thus, a successful genome assembly of C. tenuissimus NIES-3715 was achieved. A summary of the genome structure is shown in Table 1. A total of 18,705 protein-coding genes were predicted in the haploid nuclear genome. Of the predicted proteins, 14,860 had significant similarities (e-value < 1e−5) to protein sequences in the non-redundant proteins database (nr), and 9,544 had recognisable InterPro domains. Complete chloroplast and mitochondrial genomes were identified from the assembly, with sizes of 116 kb and 36 kb containing 131 and 33 predicted genes, respectively (Table 1, Supplementary Fig. 3a,b). The chloroplast genome had synteny to a related species, Chaetoceros simplex[36], with an identity of 99.4% (Supplementary Fig. 4a). In contrast, the mitochondrial genome in this study is the first reported in a Chaetoceros species (Supplementary Fig. 3b) and showed similarity to the mitochondrial genome of T. pseudonana (83.3% identity) which is classified with Chaetoceros as being Centrales (Supplementary Fig. 4b). All sequence reads obtained in this study were deposited in the DNA Data Bank of Japan (DDBJ) Sequence Read Archive under accession number DRA009158, and the assembly scaffolds for the nuclear genome, as well as the chloroplast and mitochondrial genomes of C. tenuissimus NIES-3715, were also deposited under accession numbers BLLK01000001-BLLK01000085, LC537471, and LC537470, respectively.
Table 1

Summary of genome assembly.

C. tenuissimus NIES-3715T. pseudonanaP. tricornutum
Nuclear genome
Size (Mbp)41.034.527.4
G+C content (overall %)38.94749
G+C content (coding %)40.34851
Protein-coding genes18,70511,24210,402
Average gene size (bp)15269921527
Chloroplast genome
Size (bp)116,464128,814117,369
G+C content (overall %)32.130.732.6
Protein-coding genes131144130
tRNAs753330
Mitochondrial genome
Size (bp)36,04743,82777,356
G+C content (overall %)30.830.135.0
Protein-coding genes334032
tRNAs482224
Summary of genome assembly.

EVLF in the nuclear genome of C. tenuissimus strains

An EVLF, encoding a predicted protein similar to the viral replication-associated protein in C. tenuissimus DNA virus, was found to be integrated between the predicted proteins in the nuclear genome (Fig. 1a). The 279 amino acids were encoded by 846 bases of the sequence and partially aligned with the sequence of the replication-associated protein in C. tenuissimus DNA virus SS12-43 V (64% identity; Fig. 1b). From this similarity, it was discovered that EVLF translation was frameshifted due to single- and two-base insertions and had two nonsense mutations in the sequence (Fig. 1a, b, and Supplementary Fig. 5). A poly-adenine (A) like sequence was observed downstream of the fragment and common sequence “CATAAAA” flanked the fragment (Fig. 1a).
Figure 1

(a) Location and structure of the EVLF in the host genome. Gene directions are indicated by wide arrowheads at the end of each coding sequence. Blue and hatched blue indicate genes coding hypothetical proteins and hypothetical proteins possessing known domains, respectively. Orange indicates a myosin light chain kinase, and pink indicates a virus-like fragment. The structure of the EVLF sequence encoded on the reverse DNA strand is shown as a close-up. The pink and blue boxes indicate first and third open reading frames, respectively, due to single and double nucleotides were inserted in the positions marking on the boxes as “1” and “2”, and the “S” and “T” on the boxes refer to the start and terminal codons, respectively. A yellow box indicates a poly-(A) like sequence, and green boxes indicate a “CATAAAA” sequence. Black arrowheads indicate the amplification primer sets, ctEVLF-out-v1, ctEVLF-in-v1, ctEVLF-q-v1, and ctEVLF-q-v2, which amplified the 1508 bp, 456 bp, 161 bp, and 142 bp PCR products, respectively. (b) Alignment of amino acid sequences between the EVLF of C. tenuissimus NIES-3715 and a replication-associated protein in its infectious DNA virus. The alignment was constructed by MAFFT[63]. Pink boxes indicate consensus amino acid residues. Hyphens, asterisks, numbers in red boxes indicate gaps, termination codons, and nucleotide insertions, respectively. (c) PCR amplification for four primer sets using C. tenuissimus NIES-3715 and DNA virus. The amplification length of ctEVLF primer series is indicated (a) and that of VP3, which is coded in DNA virus genome, is 212 bp. No PCR bands using ctEVLF primer series were detected in DNA virus. (d) The relative number of gene copy in the C. tenuissimus NIES-3715 genome. The gene copies were relativized by phosphomannomutase (blue bar) or tyrosyl-RNA synthetase (orange bar).

(a) Location and structure of the EVLF in the host genome. Gene directions are indicated by wide arrowheads at the end of each coding sequence. Blue and hatched blue indicate genes coding hypothetical proteins and hypothetical proteins possessing known domains, respectively. Orange indicates a myosin light chain kinase, and pink indicates a virus-like fragment. The structure of the EVLF sequence encoded on the reverse DNA strand is shown as a close-up. The pink and blue boxes indicate first and third open reading frames, respectively, due to single and double nucleotides were inserted in the positions marking on the boxes as “1” and “2”, and the “S” and “T” on the boxes refer to the start and terminal codons, respectively. A yellow box indicates a poly-(A) like sequence, and green boxes indicate a “CATAAAA” sequence. Black arrowheads indicate the amplification primer sets, ctEVLF-out-v1, ctEVLF-in-v1, ctEVLF-q-v1, and ctEVLF-q-v2, which amplified the 1508 bp, 456 bp, 161 bp, and 142 bp PCR products, respectively. (b) Alignment of amino acid sequences between the EVLF of C. tenuissimus NIES-3715 and a replication-associated protein in its infectious DNA virus. The alignment was constructed by MAFFT[63]. Pink boxes indicate consensus amino acid residues. Hyphens, asterisks, numbers in red boxes indicate gaps, termination codons, and nucleotide insertions, respectively. (c) PCR amplification for four primer sets using C. tenuissimus NIES-3715 and DNA virus. The amplification length of ctEVLF primer series is indicated (a) and that of VP3, which is coded in DNA virus genome, is 212 bp. No PCR bands using ctEVLF primer series were detected in DNA virus. (d) The relative number of gene copy in the C. tenuissimus NIES-3715 genome. The gene copies were relativized by phosphomannomutase (blue bar) or tyrosyl-RNA synthetase (orange bar). PCR analysis using ctEVLF-out-v1, ctEVLF-in-v1, ctEVLF-q-v1, and ctEVLF-q-v2 primer sets designed to amplify the EVLF over its 1.5, 0.5, 0.16, and 0.14 kbp length, respectively, revealed that specific bands were amplified in the EVLF region of C. tenuissimus NIES-3715 (Fig. 1c). Using DNA virus as a template for the primer sets of ctEVLF series, no amplification bands were detected (Fig. 1c). From the genome sequence information, EVLF was coded one copy in the haploid genome of C. tenuissimus NIES-3715. The quantity of the EVLF copy by the array-based digital PCR using ctEVLF-q-v1 primer set and the probe was estimated about 1 copy (Fig. 1d). This copy number was relativised against other single-copy genes, phosphomannomutase or tyrosyl-tRNA synthetase (Fig. 1d), estimated by BUSCO, and was half of the copy of elongation factor which was detected two copies in the haploid genome (Fig. 1d). For other strains, PCR analysis using ctEVLF-out-v1 and ctEVLF-in-v1 primer sets revealed that all strains of C. tenuissimus possessed the EVLF in their genomes (Fig. 2). To quantify the EVLF copies in the genomes of other strains, the ctEVLF-q-v2 primer and probe were designed in the consensus region of EVLF in all strains. However, this probe anneals only one side of the haploid region of C. tenuissimus NIES-3715 due to 10 bp of deletion exists in the annealing site of the other side of the haploid region. Therefore, EVLF copy in C. tenuissimus NIES-3715 was estimated at 0.5 copy (Fig. 2), and in other strains except for strain B were estimated about from 0.7 to 1.2 copies (Fig. 2). Although this probe anneals both haploids regions of all strains except for C. tenuissimus NIES-3715, strain B was only estimated at 0.3 copies (Fig. 2). These copy numbers were relativised by EVLF copy in NIES-3715 using ctEVLF-q-v1 primer and probe set.
Figure 2

PCR amplification and copy number of the EVLF from the genomes of C. tenuissimus strains, isolated from the seawater sampling sites shown in Supplementary Fig. 7. The upper and lower PCR bands were amplified using ctEVLF-out-v1 and ctEVLF-in-v1 primer sets, respectively. The bar plot indicated relative numbers of EVLF copies in the genomes of each strain. The EVLF copies were relativised by the EVLF copy of NIES-3715 used ctEVLF-q-v1 primer and probe set. The EVLF copy numbers of all strains were measured using ctEVLF-q-v2 primer and probe set.

PCR amplification and copy number of the EVLF from the genomes of C. tenuissimus strains, isolated from the seawater sampling sites shown in Supplementary Fig. 7. The upper and lower PCR bands were amplified using ctEVLF-out-v1 and ctEVLF-in-v1 primer sets, respectively. The bar plot indicated relative numbers of EVLF copies in the genomes of each strain. The EVLF copies were relativised by the EVLF copy of NIES-3715 used ctEVLF-q-v1 primer and probe set. The EVLF copy numbers of all strains were measured using ctEVLF-q-v2 primer and probe set.

Phylogenetic distribution of EVLFs

From the sequences of the cloned amplified gene fragments, a total of 16 clones with distinct sequences were obtained. These sequences were deposited in the DDBJ under accession number LC650336-LC650351. The translated amino acid sequences were aligned with the virus replication-associated protein, and the ML tree of these protein sequences indicated that all the EVLFs were clustered with ssDNA diatom virus replication-associated proteins (Fig. 3). In particular, the EVLFs were formed by the replication-associated proteins in the C. tenuissimus DNA virus type-V clade as a sister group, with moderate statistical support (BP = 80%; Fig. 3). In the EVLFs, the proteins were formed two clades with high statistical support (BP = 99% in clade I and BP = 100% in clade II; Fig. 3). Although all sequences had termination codons and/or frameshifts (Fig. 3), the evolutionary distances were close to each other within the clades (Fig. 3).
Figure 3

Maximum-likelihood trees of EVLFs with the replication-associated protein from bacilladnavirus. The EVLF fragment structures were shown in EVLF clade. The red, blue, and yellow boxes indicate the 1st, 2nd, and 3rd frames, respectively. The black vertical lines indicate the terminal codons. Bootstrap values greater than 50% are shown.

Maximum-likelihood trees of EVLFs with the replication-associated protein from bacilladnavirus. The EVLF fragment structures were shown in EVLF clade. The red, blue, and yellow boxes indicate the 1st, 2nd, and 3rd frames, respectively. The black vertical lines indicate the terminal codons. Bootstrap values greater than 50% are shown.

Transcription of EVLF in C. tenuissimus NIES-3715

For RT-qPCR analysis, the amplification efficiency of primer sets for EVLF and three reference genes, actin, gapdh, and elongation factor, were 93%, 94%, 95%, and 96%, respectively. Therefore, a relative abundance of transcription level for EVLF was calculated with ddCt method referring above three reference genes and comparing with 2 days cultures. In total 14 days of culture, the cell densities were rapidly increased until day 3, and then maintained >  × 106 cells/ml to the end of the experiment (Fig. 4a). The maximum densities were ~ 2.6 × 106 cells/ml at day 7. The cells for RT-qPCR analysis were sampled at 2- and 3-days cultures as an exponentially growing phase cell and at 7-, 10-, and 11-days cultures as a stationary phase cell. The EVLF was found to be transcribed in three replicate cultures of C. tenuissimus NIES-3715 at those sampling days (Fig. 4b–d). In particular, the relative transcription levels of the stationary phase were higher than those of the growth phase (t-test < 0.05, Fig. 4b–d). However, in the stationary phase of the cultures, the down-regulate of EVLF transcription was observed in group A from 10 to 11 days cultures (gray bars in Fig. 4b–d). As no amplification of the negative control was observed, all potentially contaminating DNA was completely digested in the samples (data not shown).
Figure 4

(a) Cell densities after 14 days of culture and the relative transcribe levels of the EVLF normalized by (b) actin, (c) gapdh, and (d) elongation factor. Cultures were performed in triplicate flasks (group a, b, c), and the line and bar colours in the plot correspond to the respective flasks.

(a) Cell densities after 14 days of culture and the relative transcribe levels of the EVLF normalized by (b) actin, (c) gapdh, and (d) elongation factor. Cultures were performed in triplicate flasks (group a, b, c), and the line and bar colours in the plot correspond to the respective flasks.

Comparative genomics among different algae

The orthologous genes among Chaetoceros tenuissimus NIES-3715, Thalassiosira pseudonana, Phaeodactylum tricornutum, and Cyanidioschyzon merolae were identified from a total of 18,705, 11,673, 10,408, and 4803 protein sequences, respectively. The genes included in the 2102 ortholog groups were common among these organisms (Fig. 5a). In the C. tenuissimus genes, 3265 ortholog groups were common in both T. pseudonana and P. tricornutum, while in the other groups a total of 1011 and 822 were common in T. pseudonana and P. tricornutum, respectively (Fig. 5a). The specific paralog genes in C. tenuissimus also formed 29 groups (Fig. 5a).
Figure 5

(a) Venn diagram of orthologous gene groups. Orthologous gene groups were identified from C. tenuissimus (Cte), T. pseudonana (Tps), P. tricornutum (Ptr), and C. merolae (Cme). The numbers in the Venn diagram indicate the number of orthologous gene groups. Reverse transcriptase domains (Interpro ID, IPR013103 and IPR000477) were included in the ortholog gene groups (G1, OG0004, OG0006, and OG0024; G2, OG0021, OG0121, and OG0065; G3, OG0094). (b) The number of genes in the above ortholog gene groups. The parentheses indicate the number of genes that possessed reverse transcriptase domains (IPR013103 and IPR000477). (c) Top 30 of the Interpro domains detected in the C. tenuissimus genome. The gene numbers are in descending order based on Cte and the numbers in parentheses indicate their ranking. The shade of red becomes lighter as the gene number decreases. Fso, Fistulifera solaris. (d) The percentage of retroelements in the four species genomes predicted by RepeatMasker.

(a) Venn diagram of orthologous gene groups. Orthologous gene groups were identified from C. tenuissimus (Cte), T. pseudonana (Tps), P. tricornutum (Ptr), and C. merolae (Cme). The numbers in the Venn diagram indicate the number of orthologous gene groups. Reverse transcriptase domains (Interpro ID, IPR013103 and IPR000477) were included in the ortholog gene groups (G1, OG0004, OG0006, and OG0024; G2, OG0021, OG0121, and OG0065; G3, OG0094). (b) The number of genes in the above ortholog gene groups. The parentheses indicate the number of genes that possessed reverse transcriptase domains (IPR013103 and IPR000477). (c) Top 30 of the Interpro domains detected in the C. tenuissimus genome. The gene numbers are in descending order based on Cte and the numbers in parentheses indicate their ranking. The shade of red becomes lighter as the gene number decreases. Fso, Fistulifera solaris. (d) The percentage of retroelements in the four species genomes predicted by RepeatMasker. In the ortholog group, OG0000, 385 paralog genes in C. tenuissimus were most abundant among these organisms and its 376 amino acid sequences possessed a leucine rich repeat 5 domain (IPR026906; Supplementary Table 3). Subsequently, seven ortholog groups, OG0004, OG0006, OG0021, OG0024, OG0065, OG0094, and OG0121, noticeably formed groups with genes possessing reverse transcriptase domains (IPR013103 and IPR000477), although the number of genes that contained these domains were not equal to that of the paralog genes (Fig. 5b). In the above ortholog groups, except for OG0006, the genes in C. tenuissimus were more abundant than those of other organisms (Fig. 5b). The number of genes that possessed a functional domain is shown in Fig. 5c. The genes that possessed a protein kinase domain (IPR000719) were found to be abundant in all organisms, while genes that possessed the following four distinct domains, leucine rich repeat 5 (IPR026906), zinc finger, MYND-type (IPR002893), heat shock factor (HSF)-type, DNA-binding (IPR000232), and ankyrin repeat-containing domain (IPR020683; Fig. 5c), were more abundant in C. tenuissimus than in those of the other three diatom species. Moreover, the number of genes that possessed the following eight domains in C. tenuissimus was notably higher than that in other organisms; leucine rich repeat 5 (IPR026906), zinc finger, RING-type (IPR001841), reverse transcriptase, RNA-dependent DNA polymerase (IPR013103), integrase, catalytic core (IPR001584), reverse transcriptase domain (IPR000477), peptidase M11, gametolysin (IPR008752), sulfatase (IPR000917), and notch domain (IPR000800; Fig. 5c).

Transposable elements

Although the total number of retroelements in C. tenuissimus was less than that in P. tricornutum, three retroelements of C. tenuissimus were detected at higher levels than those in other organisms: short interspersed nuclear elements (SINEs, 0.02%), long interspersed nuclear elements (LINEs, 0.64%), and Gypsy/DIRS1 of long terminal repeat elements (1.11%; Fig. 5d).

Discussion

Diatoms and their infectious viruses seem to be able to coexist in natural waters and are closely related to each other[10,11]. To understand the ecological relationships between host diatoms and their viruses, we sequenced the C. tenuissimus genome. Surprisingly, a predicted gene having a similarity to a putative replication-associated protein of its infectious ssDNA virus was found to be integrated between two coding sites (Fig. 1a). The predicted EVLF protein sequence was highly similar to the mid-region of the replication-associated protein in C. tenuissimus ssDNA virus SS12-43V, which infects and lyses C. tenuissimus NIES-3715. Moreover, a frameshift caused by single- and two-base insertions, as well as nonsense mutations, was observed in the sequence (Fig. 1b). Therefore, the integration of the virus replication-associated gene appears to have incomplete and is seemed to be not functional. Like C. tenuissimus, an integrated virus fragment has been shown in the diatom P. tricornutum genome and its transcription has been detected by an EST analysis[37]. However, this fragment is not similar to the replication-associated protein in C. tenuissimus but instead is similar to a viral replication gene identified only from viral metagenomic data (data not shown). Therefore, the integration of an extant closely related infectious virus fragment into its host genome is rare in diatoms. When a virus first infects the host, its replication relies on the host cellular machinery[38]. In particular, the genes of DNA viruses must be transcribed as mRNA[38]. The ssDNA diatom viruses encode three putative proteins in their genomes[33]. During the infection, there are several key molecular processes required for the successful integration of a viral gene into the host genome. A Bornavirus-like nucleoprotein gene is integrated into mammalian genomes, and this integration is thought to be mediated through mRNAs by retrotransposons, which are mobile genetic elements with their reverse transcriptase (RT), such as LINEs[39]. The banana genome also contains an integrated infectious virus gene, and it is thought to have been integrated by the Ty3/gypsy retrotransposon, which is a retroelement with long terminal repeats[40]. In the C. tenuissimus genome, the number of proteins that possessed an RT domain was higher than that in T. pseudonana, P. tricornutum, and Fistulifera solaris (Fig. 5c). Similarly, the percentage of predicted retroelements in C. tenuissimus was higher than that in T. pseudonana and F. solaris (Fig. 5d). Notably, the percentage of LINEs in the C. tenuissimus genome was the highest among the different species (Fig. 5d). In addition, considering that the number of paralog genes possessing or lacking an RT domain in C. tenuissimus was higher than that in other species, it is assumed that the C. tenuissimus genome contains more retrotransposons (Fig. 5b). These results indicated that more retrotransposons have been copied and integrated into the genome, which might be a factor in explaining the large genome size of C. tenuissimus. It is, therefore, possible that the retrotransposons possessing the RT domain converted the mRNA of the virus replication-associated gene into cDNA during the infection process. However, this then leads to the question of how the cDNA of the virus replication-associated gene integrates into C. tenuissimus genome. In general, once retroelements enter the nucleus, an endonuclease encoded by a LINE makes a single-stranded endonucleolytic nick in genomic DNA at a degenerate consensus sequence (5′-TTTT/A-3′, with “/” indicating the scissile phosphate), exposing a poly-(T) tail and a 3′ hydroxyl group that serves as a primer for the reverse transcription of retroelement mRNA, and subsequent integration[41,42]. The integrated retroelements have a structural hallmark in that they are flanked by variable size target site duplications (TSDs) [41,42]. This structural hallmark was observed in the region of the integration of EVLF in the C. tenuissimus strains (Supplementary Fig. 6a,b). A poly-(A) like sequence was observed downstream of the stop codons, which corresponds to the terminus of the virus replication-associated gene (Supplementary Fig. 6b). In addition, the endonuclease cleavage sites “5′-TTTTATG-3′” flanked the EVLF and were characterised as TSDs (Fig. 1a and Supplementary Fig. 6). In addition, a 5′ truncation and point mutations within the integrated retrotransposon are characteristic of integration by LINEs[42]. These structural hallmarks were also observed in the EVLFs of the C. tenuissimus strains but not in the P. tricornutum genome[37]. In the case of C. tenuissimus, this evidence suggested that the virus replication-associated gene was possibly integrated into the C. tenuissimus genome by host LINEs. In general, endogenous viral elements interfere with any step of viral infection, acting as restriction factors[43]. In the culture experiments without a virus inoculation, it was clear that transcription of EVLF in the stationary phase was higher than that in the growth phase. However, down-regulate of the transcription in a part of cell culture was detected (Fig. 4b–d). Because cell concentration in group A was decreased from 7- to 10-days, it was considered that extinct cells may be abundant in the cell culture and made to decrease the transcription. CtenDNAV type-II was inoculated into the host cells at the growth phase, and the cell density decreased after the cells reached the stationary phase[33]. In short, the inoculated cells maintained a high growth rate, suggesting that C. tenuissimus can resist virus infection[44]. However, considering this phenomenon together with the fact that EVLF is transcribed, it seemed that there was no correlation between the expression of EVLF and resistance against the virus. To date, RNA silencing has been shown to act as a defense response against viral infections in plants[45-47] and mosquitos[48], Moreover, this gene silencing mechanism functions in the diatom, P. tricornutum[49]. The C. tenuissimus genome also encoded genes important in RNAi function, such as genes encoding Dicer and Argonaute proteins (accession nos. GFH46084.1 and GFH61989.1, respectively). Although it remains whether EVLF functions to RNA silencing against viral proliferation, the potential function of EVLF for the virus should be clarified in the future. ssDNA viruses infecting C. tenuissimus are classified into two types (type-T and type-V) based on the sequences of replication-associated proteins[50]. The EVLFs were certainly derived from the type-V clade of C. tenuissimus DNA virus (Fig. 3). Although the geographic distribution of these strains is different in Japanese coastal waters (Supplementary Fig. 7), the EVLF was highly conserved among strains, moreover, all strains were found to have EVLF at the same locus (Fig. 2). These results indicate that the ancestor of C. tenuissimus had acquired the replication-associated gene from one type of virus. The number of EVLF copies in C. tenuissimus NIES-3715 was confirmed by comparing with other single-copy and two copies genes. As a result, one copy genes including EVLF were estimated at 1 copy (Fig. 1d). This copy number was doubled using another primer and probe set, ctEVLF-q-v2 (0.5 copy; Fig. 2). Therefore, we considered that one copy of EVLF was integrated into the genome. EVLF copies of other strains except strain B were also about from 0.7 to 1.2 copies (Fig. 2). In this case, because the copy number was not relativised by the number of housekeeping gene copies in each strain but the number of EVLF copies in NIES-3715, a range of copy numbers might have varied. Like NIES-3715, we considered that the other strains were single-copy strains except for strain B. EVLF copy in strain B was estimated at 0.3 copies (Fig. 2). It was similar to the copy number of NIES-3715 using ctEVLF-q-v2 primer and probe set. In addition, the intensity of the PCR band of EVLF in strain B was lower than those in other strains (Fig. 2), and only one type of EVLF cloned sequence was detected (Fig. 3). Therefore, strain B might have an EVLF on one side of the haploid genome. The EVLF integration within the strains was varied. This result shows the fact that the EVLFs remain encoded in their genome as a fossil. Although the enigma of the survival strategy against the infectious viruses used by C. tenuissimus remains to be solved, the populations have survived to date. We consider that the EVLF integration might have provided an advantageous condition for the host in the evolutionary relationship between diatom and virus, and remains to be interested whether the sequence variations of EVLF influence viral infectivity. In this study, we sequenced the C. tenuissimus genome and discovered that a replication-associated gene associated with its infectious virus has been integrated into the genome. This discovery represents the few cases in diatoms and indicated that the virus fragment might have integrated into other diatom genomes, that is, a close evolutionary relatedness between diatom and virus will start to shed light.

Methods

DNA extraction and DNA library construction

The C. tenuissimus strain NIES-3715 was isolated from the Seto Inland Sea, Japan (Supplementary Fig. 7) in Aug 2002. This strain has been subcultured to date and used for genome sequence. To check for bacterial contamination, the cultures were observed using epifluorescence microscopy after staining with SYBR-Gold. Briefly, the lysate was fixed with glutaraldehyde at a final concentration of 1%, and SYBR-Gold (Thermo Fisher Scientific, Waltham, MA, USA) was added to each fixed sample at a final dilution of 1.0 × 10–4 of the commercial stock. The stained samples were filtered onto 0.2-µm polycarbonate membrane filters (Nuclepore membrane; Cytiva, Sheffield, UK), after which the filters were mounted on a glass slide with a drop of low-fluorescence immersion oil, and covered with another drop of immersion oil and a coverslip. The slides were viewed at 1000 × magnification with an Olympus BX50 epifluorescence microscope. The axenic algal cultures were grown in a modified SWM3 medium enriched with 2 nM Na2SeO3[51] under a 12/12-h light–dark cycle at 20 °C. Light irradiance was 850 µmol m−2 s−1 using white LED illumination. The algal strain was cultured for 7 days. Approximately 3 × 106–5 × 106 cells/ml in the stationary phase were used for DNA extraction. The cells in the cultures were harvested by centrifugation at 860×g and 4 °C for 15 min, after which the cell pellets were stored at – 80 °C until analysis. DNA was extracted from the samples using a DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. DNA libraries for paired-end and mate-paired sequencing were constructed in accordance with KAPA Hyper Prep Kit (F. Hoffmann-La Roche Ltd., Basel, Switzerland) and Nextera Mate Pair Sample Prep Kit (Illumina, Inc. San Diego, CA, USA), respectively. These libraries were sequenced into 300 bp paired-end reads using MiSeq (Illumina, Inc.) at the Japan Agency for Marine-Earth Science and Technology, Yokosuka, Japan. For long-read sequencing of genomic DNA using MinION (Oxford Nanopore Technologies, Oxford, UK), total nucleic acid was extracted from the pellet using the DNAs-ici!-F (RIZO Inc., Tsukuba, Japan), according to the manufacturer’s protocol. To extract genomic DNA from the total nucleic acid sample, the sample was treated with RNase A (Nippon Gene, Tokyo, Japan) and subsequently purified with phenol/chloroform before the construction of a DNA sequencing library. The sequencing library was constructed using the ligation sequencing kit (SQK-LSK109, Oxford Nanopore Technologies) and sequenced by MinION, according to the respective manufacturer’s instructions. After sequencing, base-calling was performed with Albacore (v2.3.1, Oxford Nanopore Technologies).

De novo genome assembly

To estimate the genome size and heterozygosity, k-mer counting was performed using the short paired-end reads and the Jellyfish programme[52]. The histogram of 21mer counts was visualised using GenomeScope[53]. Hybrid assembly of all Illumina short reads and MinION reads was performed using MaSuRCA[54] (v3.3.0) with default parameters. The haploid genome sequence was constructed from the assembled genome using HaploMerger2[55] (v20180603) with default parameters. The assembly quality was evaluated by QUAST[56]. To evaluate the assembly accuracy, single-copy ortholog genes were searched using BUSCO[35] with alveolata_stramenophiles_ensembl datasets. Two haploid pairs were aligned using MUMmer[57] with default parameters. To visualise easily, the alignment data were filtered using the delta-filter command in MUMmer with “-q” and “-r” options and under default settings for all other options. The dot plot was drawn using mummerplot with default parameters.

Gene prediction and annotation

To predict the gene regions in the genome sequence, we first obtained the complete open reading frames (ORFs) from RNAseq (Supplementary Note, DDBJ Sequence Read Archive under accession number DRA011082). In RNAseq, the de novo assembly procedure was performed following that described by Hongo et al.[58]. The complete ORFs were extracted from the assembled sequences and translated using TransDecoder[59] with default parameters. Next, the quality-controlled paired-end reads of RNAseq were mapped to the assembled genome using TopHat2[60] with default parameters. Using the mapping data and the protein sequences of complete ORFs, the gene model was predicted using BRAKER2[61] (v2.1.0) with default parameters. Proteins predicted from the gene model were annotated based on their homology to sequences in the nr database from NCBI using the BLASTP program with a threshold e-value of < 1e−5, and protein domains were found using Interproscan with a threshold e-value of < 1e−5. The complete chloroplast and mitochondrial genomes were automatically annotated by GeSeq annotation server[62].

Quantification of gene copy in the nuclear genomes using array-based digital PCR

PCR amplification was conducted in a reaction mixture with 34.8 µl final volume for two array chips, containing 1 ng of the extracted DNA, 1 × QuantStudio 3D Digital PCR Master mix (Thermo Fisher Scientific), 0.86 µM of each primer, and 0.29 µM of TaqMan probe. Each sample was analysed by 4 chips. PCR and data acquisition were conducted in accordance with the manufacturer’s instructions. Data analysis was performed using the QuantStudio 3D Analysis Suite Software. The sequences of both TaqMan probes and specific primers are shown in Table 2.
Table 2

Primer and probe sequences used in this study.

NameDirectionSequence (5′ → 3′)Length (bp)
Primers
ctEVLF-out-v1ForwardGCAAACACGTKTGTTGATATATCGG1508
ReverseCGATCCTCTTGAAGACCCAGT
ctEVLF-in-v1ForwardAAGAAGAAGAGTCGACTGGATCAAC456
ReverseACAATAACGGTCTCATGATTGAGC
ctEVLF-q-v1ForwardAAGTATCACAAGTCACGCTCTGC161
ReverseTCCATATTACGTCTGAAGTAGCGAG
ctEVLF-q-v2ForwardAAGAAGAAGAGTCGACTGGATCA142
ReverseAGCACTTGCAGAGCGTGACT
PhosphomannomutaseForwardGTGGAACCTTTATTGAATTCCGTAG188
ReverseAATCTGTCCTCCAATGGAATATGTC
Tyrosyl-tRNA synthetaseForwardGTAAGAGTGATCCTGACAGTGCTG266
ReverseGATTGGTTCAAATTCGGAGTAGG
ActinForwardCTGGATGTGTTCTTGATTCTGGAG168
ReverseCTGCAGTAGTGGTGAGGGAGTATC
GapdhForwardCATTTTCCTCCAGCTCCTTCTC261
ReverseGGAAGTCTCCATCAATATCTACGGTTC
Elongation factorForwardGAAACTCCGTTGGTATGTCCATC163
ReverseCAGTATCCGGTCTTGAGTACTCCAG
Probes
ctEVLF-q-v1FAM-CTGCAGCCA-ZEN-TAGACTGGGATAGGCAAGAC-lowa Black® FQ
ctEVLF-q-v2FAM-ATGAATCTA-ZEN-AATATTTGTTAGCTGCTTGCTCCTGG-lowa Black® FQ
PhosphomannomutaseFAM-AAGAAATTG-ZEN-CTCTCGTGAGGAACGTAATGACTATG-lowa Black® FQ
Tyrosyl-tRNA synthetaseFAM-TAAGGAAGA-ZEN-AACTGATGCTGGAAAGGAGTCTATGC-lowa Black® FQ
ActinYakima Yellow®-ATCTATGAG-ZEN-GGATATGCTCTTCCACACGCTGTAGT-lowa Black® FQ
GapdhHEX-CACTGGAAT-ZEN-GGGAGTTAACGGATTCGGAC-lowa Black® FQ
Elongation factorFAM-CATCTACAA-ZEN-GGAGTCTGAGGGAGACTGTCTTCCAG-lowa Black® FQ
Primer and probe sequences used in this study. Since the results were expressed by copies per microliter, the number of gene copy was relativised based on the result of the number of single-gene copies.

Confirmation of an EVLF in the nuclear genome

To analyse the EVLF in the C. tenuissimus genome, we used nine other strains of this diatom species other than strain NIES-3715 (Supplementary Fig. 7). One milliliter of a stationary growth phase C. tenuissimus culture was centrifuged at 17,400×g for 3 min at 4 °C. The resulting diatom cell pellets were then preserved at − 80 °C until analysis. DNA was extracted from stored cell pellets using the DNeasy Plant Mini Kit (Qiagen), according to the manufacturer’s instructions. The EVLF was amplified using each primer pair, ctEVLF-out-v1 and ctEVLF-in-v1 (Fig. 1a and Table 2). PCR amplification was conducted in a reaction mixture with a 25 µl final volume, containing 1 µg DNA, 1 × ExTaq buffer (Takara, Shiga, Japan), 200 nM dNTPs, 0.2 µM of each primer, and 0.025 U ExTaq DNA polymerase. PCR was conducted using GeneAmp PCR system 9700 with the following cycle parameters: initial denaturation phase of 98 °C for 2 min, followed by 30 cycles of 98 °C for 10 s, 60 °C for 15 s, and 72 °C for 90 s. The PCR products were then electrophoresed on 1% (w/v) agarose ME gels (Wako Pure Chemical Industries, Osaka, Japan), and the nucleic acids were visualised using SYBR Safe DNA gel stain (Thermo Fisher Scientific). PCR amplicons of approximately 1.5 kb were excised, and their nucleic acids were extracted (NucleoSpin® Gel and PCR Clean-up; Macherey–Nagel GmbH and Co., KG, Düren, Germany). The PCR products were ligated into the pGEM-T Easy vector (Promega, Madison, WI, USA) and transformed into Escherichia coli DH5α-competent cells (Toyobo, Japan). Sequencing was conducted using the dideoxy method with ABI PRISM 3130 Genetic Analyzer (Thermo Fisher Scientific).

Phylogenetic analysis of EVLFs and virus replication-associated genes

The genome sequence of EVLF was obtained for ten strains of C. tenuissimus (Supplementary Fig. 7) using the above genome sequence confirmation. To clarify the evolutionary relationship of the EVLFs, a maximum-likelihood (ML) tree analysis was conducted. The virus protein sequences in the NCBI database were retrieved based on similarity to the EVLF using the BLASTP program. These accession numbers are shown in Supplementary Table 4. All retrieved protein sequences and the EVLF were aligned using MAFFT[63](v7.212) with default parameters, and all stop codons and the frame-shifted amino acids in the alignment were removed by manual editing. Gaps were automatically trimmed using trimAl[64] using the ‘-automated1’ command option and default settings for all the other options. The best-fit evolutionary model for the optimum alignment was calculated using ModelFinder[65] and the Akaike information criterion. The ML tree was inferred from an evolutionary model using RAxML[66] (v8.2.4) with 100 bootstrap replicates.

RT-qPCR analysis

The axenic algal cultures of C. tenuissimus strain NIES-3715 were grown in a modified SWM3 medium under a 12/12 h light–dark cycle of ca. 600 to 700 µM of photons m−2 s−1, using cool white, fluorescent illumination at 25 °C for 3 days. For the RT-qPCR analysis, preconditioned cultures were inoculated into 1-l of fresh SWM3 medium at a final density of 978 cells/ml using a 2-l polycarbonate Erlenmeyer flask (431255; Corning Inc, Glendale, AZ, USA). This experiment was performed in triplicate. The cultures were subsampled at the logarithmic growth phase (day 2, 3, 4, and 7) and at stationary phase (day 10, 11, and 14). On each sampling day, diatom cells in the cultures were retained on 0.4-µm polycarbonate membrane filters (Nuclepore membrane; Cytiva), and then the cells were immersed in RNAlater (Thermo Fisher Scientific) for 5 min. After the incubation, RNAlater was filtered out. The number of diatom cells on the filters ranged from 107 to 108 cells per filter, which were frozen in liquid nitrogen and stored at – 80 °C until analysis. The retained filters containing the diatom cell samples were cut into small pieces in the TRIzol reagent (Thermo Fisher Scientific), and total RNA was extracted using a TRIzol Plus RNA Purification Kit (Thermo Fisher Scientific), with PureLink DNase (Thermo Fisher Scientific) digesting any contaminating DNA, in accordance with the manufacturer’s instructions. Moreover, to completely digest any contaminating DNA, DNase treatment was performed using a TURBO DNase free kit (Thermo Fisher Scientific). The quantity of the total RNA was measured using a Qubit RNA HS assay kit (Thermo Fisher Scientific). cDNA was constructed from 1 µg of total RNA using an oligo(dT)15 primer and SuperScript IV Reverse transcriptase (Thermo Fisher Scientific), in accordance with the manufacturer’s instructions. PCR amplification was conducted in a reaction mixture with a 20 µl final volume, containing 1 µl cDNA, 1 × Probe qPCR mix (Takara), 0.2 µM of each primer, and 0.2 µM of TaqMan probe. qPCR was conducted using QuantStudio 3 (Thermo Fisher Scientific) with the following cycle parameters: initial denaturation phase of 95 °C for 30 s, followed by 45 cycles of 95 °C for 5 s, 60 °C for 30 s. All samples and a no-template control were analysed in triplicate. RNA template as a negative control was conducted with the above same condition. The sequences of both TaqMan probes and specific primers are shown in Table 2.

Identification of orthologous genes

Protein sequences from T. pseudonana, P. tricornutum, and Cyanidioschyzon merolae were retrieved from public databases (accession no. GCF_000149405.2, GCF_000150955.2, and GCF_000091205.1, respectively). Orthologous gene groups in all the protein sequences, including those in C. tenuissimus, were found using OrthoFinder[67] with default parameters. Protein domains in the sequences of reference organisms (T. pseudonana, P. tricornutum, and F. solaris, accession no. GCA_002217885.1) were found using InterProscan using a threshold e-value of < 1e−5.

Prediction of transposable elements

Transposable elements (TEs) in the C. tenuissimus genome were predicted using RepeatModeler2[68] and RepeatMasker[69] programmes with default parameters. To compare the TEs statistically among diatoms, the genomes of T. pseudonana, P. tricornutum, and F. solaris were analysed using the same programmes and parameters and compared to TEs that have already been reported for these three genomes[70,71]. Supplementary Information. Supplementary Figures. Supplementary Tables.
  49 in total

1.  Persistent virus integration into the genome of its algal host, Ectocarpus siliculosus (Phaeophyceae).

Authors:  N Delaroque; I Maier; R Knippers; D G M ºller
Journal:  J Gen Virol       Date:  1999-06       Impact factor: 3.891

2.  The MaSuRCA genome assembler.

Authors:  Aleksey V Zimin; Guillaume Marçais; Daniela Puiu; Michael Roberts; Steven L Salzberg; James A Yorke
Journal:  Bioinformatics       Date:  2013-08-29       Impact factor: 6.937

3.  Primary production of the biosphere: integrating terrestrial and oceanic components

Authors: 
Journal:  Science       Date:  1998-07-10       Impact factor: 47.728

4.  Oil accumulation by the oleaginous diatom Fistulifera solaris as revealed by the genome and transcriptome.

Authors:  Tsuyoshi Tanaka; Yoshiaki Maeda; Alaguraj Veluchamy; Michihiro Tanaka; Heni Abida; Eric Maréchal; Chris Bowler; Masaki Muto; Yoshihiko Sunaga; Masayoshi Tanaka; Tomoko Yoshino; Takeaki Taniguchi; Yorikane Fukuda; Michiko Nemoto; Mitsufumi Matsumoto; Pui Shan Wong; Sachiyo Aburatani; Wataru Fujibuchi
Journal:  Plant Cell       Date:  2015-01-29       Impact factor: 11.277

Review 5.  Co-option of endogenous viral sequences for host cell function.

Authors:  John A Frank; Cédric Feschotte
Journal:  Curr Opin Virol       Date:  2017-08-16       Impact factor: 7.090

6.  Genomic island variability facilitates Prochlorococcus-virus coexistence.

Authors:  Sarit Avrani; Omri Wurtzel; Itai Sharon; Rotem Sorek; Debbie Lindell
Journal:  Nature       Date:  2011-06-29       Impact factor: 49.962

7.  A single Banana streak virus integration event in the banana genome as the origin of infectious endogenous pararetrovirus.

Authors:  Philippe Gayral; Juan-Carlos Noa-Carrazana; Magali Lescot; Fabrice Lheureux; Benham E L Lockhart; Takashi Matsumoto; Pietro Piffanelli; Marie-Line Iskra-Caruana
Journal:  J Virol       Date:  2008-04-16       Impact factor: 5.103

8.  Prophages mediate defense against phage infection through diverse mechanisms.

Authors:  Joseph Bondy-Denomy; Jason Qian; Edze R Westra; Angus Buckling; David S Guttman; Alan R Davidson; Karen L Maxwell
Journal:  ISME J       Date:  2016-06-03       Impact factor: 10.302

9.  GeSeq - versatile and accurate annotation of organelle genomes.

Authors:  Michael Tillich; Pascal Lehwark; Tommaso Pellizzer; Elena S Ulbricht-Jones; Axel Fischer; Ralph Bock; Stephan Greiner
Journal:  Nucleic Acids Res       Date:  2017-07-03       Impact factor: 16.971

10.  HaploMerger2: rebuilding both haploid sub-assemblies from high-heterozygosity diploid genome assembly.

Authors:  Shengfeng Huang; Mingjing Kang; Anlong Xu
Journal:  Bioinformatics       Date:  2017-08-15       Impact factor: 6.937

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.