Huyi Liu1, Xiangdao Cai2, Jia Liu3, Fengxiang Zhang4, Andong He5, Ruiman Li6. 1. Department of Obstetrics and Gynecology, The First Affiliated Hospital of Jinan University, Guangzhou. 289628479@qq.com. 2. Department of Orthodontics, Stomatological Clinic, Zhongshan People's Hospital of Sun Yat-sen University, Zhongshan. 540166570@qq.com. 3. Department of Obstetrics and Gynecology, The First Affiliated Hospital of Jinan University, Guangzhou. tdliujia@jnu.edu.cn. 4. Department of Obstetrics and Gynecology, The First Affiliated Hospital of Jinan University, Guangzhou. zhangfengxiangjnu@163.com. 5. Department of Obstetrics and Gynecology, The First Affiliated Hospital of Jinan University, Guangzhou. jnandonghe@163.com. 6. Department of Obstetrics and Gynecology, The First Affiliated Hospital of Jinan University, Guangzhou. hqyyck@126.com.
Abstract
Preeclampsia (PE) is one of the leading causes of maternal morbidity and mortality in pregnant women. This study aimed to investigate the potential impact and regulatory mechanisms of bone morphogenetic protein receptor 2 (BMPR2) on the progression of PE. We obtained placental tissues from pregnant women with PE and normal pregnant women, and the results showed that BMPR2 was expressed at low levels in the tissue from PE women. Genetic knockdown of BMPR2 increased the proliferation and invasion of cultured trophoblast cells, whereas its overexpression reduced these characteristics. Bioinformatics analysis and luciferase reporter gene assays confirmed that BMPR2 is a direct target of miR-21. Overexpression of a miR-21 inhibitor promoted the growth and invasiveness of trophoblast cells, whereas the opposite results were observed for the miR-21 mimic. Furthermore, miR-21 was sponged by the lncRNA MEG3, and shRNA inhibition of MEG3 reduced trophoblast cell growth and invasiveness. miR-21 was upregulated in the tissues from PE women, whereas MEG3 was downregulated, and the two were negatively correlated. Collectively, this study demonstrates that the lncRNA MEG3 acts as a sponge for miR-21, which regulates BMPR2 expression and promotes trophoblast cell proliferation and invasiveness, thereby preventing the development of PE. These findings provide novel insight into a targeted therapy that could be used to treat or prevent the development of PE.
Preeclampsia (PE) is one of the leading causes of maternal morbidity and mortality in pregnant women. This study aimed to investigate the potential impact and regulatory mechanisms of bone morphogenetic protein receptor 2 (BMPR2) on the progression of PE. We obtained placental tissues from pregnant women with PE and normal pregnant women, and the results showed that BMPR2 was expressed at low levels in the tissue from PE women. Genetic knockdown of BMPR2 increased the proliferation and invasion of cultured trophoblast cells, whereas its overexpression reduced these characteristics. Bioinformatics analysis and luciferase reporter gene assays confirmed that BMPR2 is a direct target of miR-21. Overexpression of a miR-21 inhibitor promoted the growth and invasiveness of trophoblast cells, whereas the opposite results were observed for the miR-21 mimic. Furthermore, miR-21 was sponged by the lncRNA MEG3, and shRNA inhibition of MEG3 reduced trophoblast cell growth and invasiveness. miR-21 was upregulated in the tissues from PE women, whereas MEG3 was downregulated, and the two were negatively correlated. Collectively, this study demonstrates that the lncRNA MEG3 acts as a sponge for miR-21, which regulates BMPR2 expression and promotes trophoblast cell proliferation and invasiveness, thereby preventing the development of PE. These findings provide novel insight into a targeted therapy that could be used to treat or prevent the development of PE.
Hypertensive disorders complicating pregnancy (HDCP), pregnancy-specific diseases, include pregnancy-induced hypertension, preeclampsia (PE), and eclampsia.[1,2] The global incidence of HDCP is about 10%, and HDCP is a leading cause of long-term disability and death in mothers and babies, greatly threatening the life and health of the mother and fetus.[3] PE is the most commonly presented form of HDCP, its incidence has increased in recent years, and it often produces serious adverse complications in the mothers and fetuses.[4-6] To date, the etiology and pathogenesis of PE are unclear, which directly affects the effectiveness of early diagnosis, prevention, and treatment of PE.Transforming growth factor- (TGF-β) family members include TGF-β, bone morphogenetic protein (BMP), nodal, and activin, which are widely expressed in different tissues and play roles in cell growth, migration, and apoptosis in various tissues.[7] BMP receptor 1 (BMPR1) and BMPR2 are downstream receptors for BMPs. BMP, BMPR1, and BMPR2 form a tetrameric complex triggering signal transduction.[8] In addition, BMPs transmit extracellular signals into cells through BMPRs to stimulate cells to induce a series of physiological changes, thereby regulating cell proliferation, apoptosis, and differentiation.[9]BMPR2 plays important roles in embryonic development, angiogenesis, and osteogenesis.[9,10] BMPR2 is composed of 1038 amino acids, with a molecular weight of 115 kDa, and is widely expressed in the endothelial and smooth muscle cells of different tissues and organs.[11] To date, the function of BMPR2 in HDCP has not been investigated. There is a close correlation between BMPR2 and hypertension. BMPR2 mutations are associated with the development of pulmonary hypertension (PAH),[9] chronic obstructive pulmonary disease (COPD),[12] hemorrhagic telangiectasia (HHT), tumors, and obesity.[13] In pulmonary hypertension, BMPR2 deficiency inhibits the proliferation and differentiation of vascular smooth muscle cells and endothelial cells, and modulation of BMPR2 expression changes the processes of proliferation and apoptosis.[9]In recent years, noncoding RNAs (ncRNAs) have become of interest in various fields. ncRNAs are divided into long ncRNAs (lncRNAs), microRNAs (miRNAs), and circular RNAs (circRNAs). They control gene transcription and translation through RNA/protein sponging and epigenetic modification, thereby regulating various cellular processes.[14-18] miRNAs are endogenous single-stranded ncRNAs with a length of 20-22 nucleotides, and they bind to the 3’-untranslated region (3’-UTR) of the target gene to regulate the translation process.[19] The significance of miRNA involvement in PE development is frequently reported. Studying the role miRNAs play in the placenta may help to identify the pathogenesis and pathological manifestations of placentalrelated diseases, and provide a new scientific basis for prevention and treatment.[20] Detection of relevant miRNAs in peripheral blood circulation may become an important diagnostic for early screening and diagnosis of PE. miR-21 is highly expressed in PE placental samples, but little is known about its downstream target genes and regulatory mechanisms of action.[21] lncRNAs are crucial components of transcription and post-transcriptional regulation of gene expression, serving as key nodes for the regulation of transcription activity and mRNA expression of target genes. Some lncRNAs have been implicated in the development of PE, such as the lncRNAs MEG3, TUG1, and MALAT1.[22-24]
MEG3 is transcribed at low levels in PE samples, and overtranscription of MEG3 promotes trophoblast invasion and metastasis, indicating that MEG3 may prevent the development of PE and play a critical role in the regulation of PE.[22] However, its downstream regulatory targets and mechanisms of action are still elusive.Therefore, the purpose of this study was to explore the relationship between BMPR2 and PE in order to understand the role BMPR2 plays in the development of HDCP. Specifically, we set out to explore the function of BMPR2 in PE, to identify the upstream regulators of BMPR2, and to provide novel insight into the pathogenesis of PE.
Materials and Methods
Tissue sample collection
A total of 12 placenta samples were collected from pregnant women with PE who had not had a cesarean section operation (PE group) at the Obstetrics and Gynecology Department of Jinan University Hospital between May 2020 and Feb 2021. An additional 12 placental tissues were obtained from normal pregnant women who delivered by cesarean section without giving birth at full term (control group). Specimens were obtained from the placenta center near the umbilical cord to avoid infarction and thrombosis after the placenta is removed from the uterus. The sample was then washed with sterile phosphate buffered saline and stored in liquid nitrogen. Written consent was obtained from all patients, and the study was approved by the ethics committee from the First Affiliated Hospital of Jinan University.
Cell culture and transfection
JEG-3 trophoblast cells purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) were cultured in DMEM (Gibco, Thermo Scientific, Waltham, MA, USA) medium with 10% FBS (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in 5% CO2, and the medium was replaced with fresh medium every 2 days. When the cell density reached 60-70%, the cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufactory’s instruction.
siRNAs and plasmids
Extracted cDNA for BMPR2 and the MEG3 lncRNA were each cloned into the pcDNA 3.1 vector (Guangzhou Aiji Biotechnology Co., Ltd). Mimic miR-21, mimic NC, a miR-21 inhibitor, and a NC inhibitor were all purchased from the RuiBo Biotechnology Limited Company (Guangzhou, China). The BMPR2 or MEG3 lncRNA 3’-UTR fragment containing the predicted binding site for miR-21 or the corresponding mutant sequences were cloned into the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Cat. # E1330, Promega, Madison, WI, USA). siRNA fragments against BMPR2 (5’- GAGACUUAAGUGUUCAUUGAGAGGC - 3’), MEG3 (5’-GGGCUUCUGGAAUGAGCAU-3’), or the scrambled control sequence (siNC, 5’-UUCUCCGAACGUGUCACGUTT- 3’), which was designed to target no genes, were transfected into cells using Lipofectamine 2000 to knock down BMPR2 or MEG3.
Immunohistochemistry (IHC)
The paraffin-embedded sections were heated in citrate buffer (pH 6.0) at 95°C for 15 min for antigen retrieval. The sections were then incubated in 3% H2O2 for 20 min and were blocked using 10% goat serum (Sigma-Aldrich, Saint-Louis, USA) for 1 h to quench the endogenous peroxidase activity. They were then incubated with a primary antibody against BMPR2 (#ab130206, 1:200, Abcam, Cambridge, MA, USA) for 1.5 h and with HRP-conjugated IgG (#ab64264, 1:500, Abcam) for another 1 h. The primary antibody was diluted in a QuickBlock buffer (#P0262, Beyotime, Shanghai, China), and buffer without antibody was used as a negative control. The immunorections were developed using DAB reagent (Beyotime Institute of Biotechnology, Jiangsu, China) and were counterstained with hematoxylin (Beyotime). The tissue sections were analyzed and photographed with a microscope (BX60; Olympus, Tokyo, Japan).
Quantitative reverse transcription PCR (RT-qPCR)
Total RNA was extracted from tissues and cells using Trizol (Invitrogen, Carlsbad, CA, USA) and was reverse transcribed into cDNA using a reverse transcription kit (#4368814, Invitrogen). The cDNA was amplified using the One-Step RT-PCR System Kit (Invitrogen) and SYBR Premix Ex Taq TM II (RR820A, TaKaRa Biotechnology, Japan). With U6 and GAPDH as controls, the relative transcription levels from each gene were calculated using the 2-ΔΔCt method. The primers targeting human BMPR2, MEG3, actin, and miR-21-5p were as follows: BMPR2-forward 5’-ACAGATAGGTGAGTCAACACAAGA- 3’ and BMPR2-reverse 5’- TTGACTTCACAGTCCAGCGA-3’; MEG3-forward 5’-GGCCTCCCCTTGAGTAGAGA- 3’ and MEG3-reverse 5’-ACTGAAGGCTCAACAGCTCC- 3’; actin-forward 5’-CATGTACGTTGCTATCCAGGC- 3’ and actin-reverse 5’-CTCCTTAATGTCACGCACGAT- 3’; miR-21-5p-forward 5’- ACGGGTAGCTTATCAGACTGA-3’ and miR-21-5p-reverse 5’- CAGTGCGTGTCGTGGAGT-3’; miR-21-5p-RT, GTCGTATCCAGTGCGTGTC GTGGAGTCGGCAATTGCACTGGATACGACTCAACAT; and U6-forward 5’-CTCGCTTCGGCAGCACA- 3’ and U6-reverse 5’-AACGCTTCACGAATTTGCGT- 3’.
Western blotting
Cells in the logarithmic growth phase were lysed with RIPA lysis buffer (#P0013, Beyotime) containing protease and phosphatase inhibitors to extract proteins, and the BCA method was used to determine protein concentration. An equal amount of total protein (50 μg) for each sample was loaded onto the 12% SDSPAGE gels used for electrophoresis, and the proteins were then transferred to a PVDF membrane (#IPVH00010, Millipore, Burlington, MA, USA). The membrane was probed with primary antibodies against BMPR2 (#ab130206, Abcam) and GAPDH (#ab8245, Abcam) overnight at 4°C followed by incubation with HRP-labeled secondary antibodies (Beyotime) at room temperature for 2 h.
CCK-8 assay
Briefly, approximately 1×103 cells were inoculated onto a 96- well plate in 100 μL of fresh medium and were cultured at 37°C with 5% CO2 for 0, 24, 48, or 72 h. Ten microliters of CCK-8 reagent (CA1210-100T, Solarbio, Beijing, China) was added to each well and incubated with the cells for 1 h. The optical density at 450 nm was then assessed using a 96-well plate reader.The expression level of BMPR2 was significantly downregulated in the PE placental tissues. A) Immunohistochemical staining for BMPR2 expression in the placental tissues for the normal pregnancy group and PE patients; 200x magnification; scale bar: 20 μm. B) BMPR2 mRNA was detected in the normal pregnancy group and PE patients using RT-qPCR. C,D) Western blotting assays show the BMPR2 protein levels for the normal pregnancy group and PE patients; *p<0.05 and **p<0.01 relative to the normal pregnancy group. Data are presented as the means ±SEM, n = 3.
Wound-healing assay
Cells were plated on a 6-well plate at a density of 5×105 cells/well and were cultured overnight until the cells adhered to the plate. A 200 mL pipette tip was used to scrape the cell layer along the bottom of the 6-well plate, and the cells were photographed 0 and 24 h after scraping. For evaluation of wound closure, three randomly selected points along each wound were marked. The healing rate was expressed as percentage of scratch closure and was calculated as follows: % of scratch closure= (a-b)/a, where (a) is a distance between edges of the wound, and (b) is the distance which remained cell-free during cell migration to close the wound.
Transwell invasion assay
Transwell invasion assays were performed using transwell chambers (#3422, Corning, NY, USA) to evaluate cell invasiveness. For the invasion assays, Transwell chambers were coated with 100 μl Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) and maintained at 37°C in a cell incubator with 5% CO[2]. The JEG- 3 cells were resuspended in 200 μL serum-free medium (5×105 cells/mL) and seeded in the upper chamber, and 600 μL of medium containing 10% FBS was added to the lower chamber. After 24 h of incubation, the cells on the upper surface were removed with cotton swabs, and the lower layer was fixed with 4% paraformaldehyde and stained with 0.1% crystal violet (Beyotime). The number of invaded cells was measured using an inverted microscope (200x magnification), from at least seven fields of each of three separate membranes.BMPR2 promotes JEG-3 cell proliferation and invasion. A,B) Western blotting analysis verifies the RNA interference efficiency for BMPR2 knockdown; **p<0.01 relative to the siNC group. C) CCK-8 assay for JEG-3 cell proliferation after treatment with siBMPR2, oe-BMPR2, or controls. D) Cell migration was measured using a wound-healing assay. E) Quantification of cell migration for JEG-3 cells treated with siBMPR2, oe-BMPR2, or controls. F) Invasiveness was analyzed using a transwell invasion assay. () Quantification of cell invasion; *p<0.05 and ***p<0.01 relative to the siNC or GFP group, respectively. Data are presented as the means± SEM, n = 3.
Dual-luciferase reporter gene assays
JEG-3 cells were seeded onto a 24-well plate at a density of 5×104 cells/well and were incubated for 24 h. The wild-type or mutant reporter genes were co-transfected with miR-21 or miRNC plasmids. Luciferase activity was determined using the Dual- Luciferase Reporter Assay System (Promega Corporation, Madison, WI, USA) 48 h after transfection.
Statistical analysis
Data were analyzed using the SPSS 19.0 software and are presented as the mean ± SEM. All experiments were repeated at least three times. The statistical difference between two groups was determined using an independent t-test, and the Pearson correlation coefficient was used to analyze their correlation. P<0.05 indicates a statistically significant difference.
Results
BMPR2 is downregulated in the placenta tissues from PE patients
To identify the BMPR2 expression level changes in PE, we collected placental tissues from PE and control pregnant women, and used IHC to detect protein levels. The results demonstrate that the expression level of BMPR2 was significantly reduced in the placenta tissue from PE patients (Figure 1A). RT-qPCR and western blotting analyses confirmed that the BMPR2 mRNA and protein levels, respectively, are reduced in the PE placenta tissues (Figure 1 B-D).
Figure 1.
The expression level of BMPR2 was significantly downregulated in the PE placental tissues. A) Immunohistochemical staining for BMPR2 expression in the placental tissues for the normal pregnancy group and PE patients; 200x magnification; scale bar: 20 μm. B) BMPR2 mRNA was detected in the normal pregnancy group and PE patients using RT-qPCR. C,D) Western blotting assays show the BMPR2 protein levels for the normal pregnancy group and PE patients; *p<0.05 and **p<0.01 relative to the normal pregnancy group. Data are presented as the means ±SEM, n = 3.
BMPR2 increases the growth rate and invasiveness of JEG-3 cells
To further explore the function of BMPR2, we performed in vitro experiments in the trophoblast cell line JEG-3, and transfected the cells with a plasmid encoding BMPR2 or siRNA fragments targeting BMPR2. The genetic knockdown efficiency was first confirmed using western blotting (Figure 1 A,B). Cell growth was determined using a CCK-8 assay. Overexpression of GFP-BMPR2 promoted JEG-3 cell growth, whereas siBMPR2 suppressed their growth (Figure 2C). As revealed by wound-healing and transwell assays, the levels of JEG-3 cell proliferation and invasion increased when BMPR2 was overexpressed in JEG-3 cells; knockdown of BMPR2 produced the opposite results (Figure 2 D-G). Collectively, these results indicate that BMPR2 promotes JEG-3 cell growth and invasiveness.
Figure 2.
BMPR2 promotes JEG-3 cell proliferation and invasion. A,B) Western blotting analysis verifies the RNA interference efficiency for BMPR2 knockdown; **p<0.01 relative to the siNC group. C) CCK-8 assay for JEG-3 cell proliferation after treatment with siBMPR2, oe-BMPR2, or controls. D) Cell migration was measured using a wound-healing assay. E) Quantification of cell migration for JEG-3 cells treated with siBMPR2, oe-BMPR2, or controls. F) Invasiveness was analyzed using a transwell invasion assay. () Quantification of cell invasion; *p<0.05 and ***p<0.01 relative to the siNC or GFP group, respectively. Data are presented as the means± SEM, n = 3.
The targeting relationship between miR-21 and BMPR2. A) Bioinformatics analysis of the binding between BMPR2 and miR- 21. B) Dual-luciferase reporter gene assays confirmed that miR-21 targets the BMPR2 gene. C) RT-qPCR analysis of BMPR2 mRNA transcription after treatment with a miR-21 inhibitor or a miR-21 mimic. D,E) Western blotting analysis of BMPR2 protein expression after treatment with a miR-21 inhibitor or a miR-21 mimic; **p<0.01 and ***p<0.001 relative to the mimic NC or inhibitor NC group, respectively. Data are presented as the means ±SEM, n = 3.
miR-21 inhibits JEG-3 cell growth and invasiveness by targeting BMPR2
To further identify the underlying mechanism of action of BMPR2 in PE, we performed bioinformatics analysis using the Targetscan[25] and starBase[26] databases to screen for miRNAs that may bind to the 3’UTR of BMPR2 and found that miR-21-5p was most likely to regulate BMPR2. To confirm this interaction, plasmids for wild-type (BMPR2-WT) and mutant BMPR2 (BMPR2- MUT) with fluorescent signals were constructed (Figure 3A). For the dual-luciferase reporter gene assay, the miR-21 mimic and BMPR2-WT– or BMPR2-MUT–encoding plasmids were co-transfected into JEG-3 cells, and the resultant luciferase activity was detected. The results show that co-transfection with the miR-21 mimic significantly decreased the observed luciferase activity with the BMPR2-WT plasmid, but no significant change was observed for BMPR2-MUT, indicating that miR-21 can bind to BMPR2 (Fig. 3B). In addition, transfection of the miR-21 mimic in JEG-3 cells decreased the mRNA transcription and protein expression levels of BMPR2, whereas transfection with the miR-21 inhibitor resulted in an increase in these levels (Figure 3 C-E). Furthermore, transfection with the miR-21 mimic decreased the proliferation of JEG- 3 cells and suppressed cell invasion; however, transfection with the miR-21 inhibitor produced the opposite effects and promoted cell growth and invasion (Figure 4 A-E). These results indicate that miR-21 targets BMPR2 and inhibits the expression of BMPR2, thereby suppressing JEG-3 cell growth and invasiveness.
Figure 3.
The targeting relationship between miR-21 and BMPR2. A) Bioinformatics analysis of the binding between BMPR2 and miR- 21. B) Dual-luciferase reporter gene assays confirmed that miR-21 targets the BMPR2 gene. C) RT-qPCR analysis of BMPR2 mRNA transcription after treatment with a miR-21 inhibitor or a miR-21 mimic. D,E) Western blotting analysis of BMPR2 protein expression after treatment with a miR-21 inhibitor or a miR-21 mimic; **p<0.01 and ***p<0.001 relative to the mimic NC or inhibitor NC group, respectively. Data are presented as the means ±SEM, n = 3.
Figure 4.
The inhibitory effect of miR-21 on JEG-3 cell proliferation and invasiveness. (A) A CCK-8 assay to measure JEG-3 cell proliferation after treatment with siBMPR2, oe-BMPR2, or controls. (B) Cell migration was measured using a wound-healing assay after treatment with a miR-21 inhibitor, a miR-21 mimic, or controls. (C) Quantification of JEG-3 cell migration. (D) Invasiveness was analyzed using a transwell invasion assay with cells treated with a miR-21 inhibitor, a miR-21 mimic, or controls. (E) Quantification of cell invasion. *P<0.05 and **P<0.01 relative to the mimic NC or inhibitor NC group, respectively. Data are presented as the means±SEM, n = 4.
The inhibitory effect of miR-21 on JEG-3 cell proliferation and invasiveness. (A) A CCK-8 assay to measure JEG-3 cell proliferation after treatment with siBMPR2, oe-BMPR2, or controls. (B) Cell migration was measured using a wound-healing assay after treatment with a miR-21 inhibitor, a miR-21 mimic, or controls. (C) Quantification of JEG-3 cell migration. (D) Invasiveness was analyzed using a transwell invasion assay with cells treated with a miR-21 inhibitor, a miR-21 mimic, or controls. (E) Quantification of cell invasion. *P<0.05 and **P<0.01 relative to the mimic NC or inhibitor NC group, respectively. Data are presented as the means±SEM, n = 4.
MEG3 promotes the growth and invasiveness of trophoblasts through the miR-21/BMPR2 signaling pathway
lncRNAs can sponge miRNAs and thereby inhibit their function. Through bioinformatics analysis, we found that the lncRNA MEG3 might be the upstream regulator of miR-21 (Figure 5A). The results from RT-qPCR analysis in JEG-3 cells indicated that transfection of cells with the MEG3 decreased the transcription level of miR-21, which was reversed by overexpression of the miR-21 mimic (Figure 5B). Genetic knockdown of MEG3 resulted in upregulation of miR-21, which was reversed by overexpressing the miR-21 inhibitor (Figure 5C). Furthermore, a dual-luciferase reporter gene assay showed that the miR-21 mimic suppressed the luciferase signal observed after transfection with the MEG3-WT plasmid, but this was not observed for the MEG3-MUT plasmid (Figure 5D). These data indicate that MEG3 can sponge miR-21.
Figure 5.
The targeting relationship between miR-21 and the lncRNA MEG3. A) Bioinformatics analysis showed that miR-21 is a potential target of the MEG3 lncRNA. B,C) RT-qPCR experiments verified that MEG3 targets miR-21 and decreases its transcription level. D) A luciferase reporter gene experiment confirmed that MEG3 targets and regulates miR-21 transcription levels; **p<0.01 and ***p<0.001. Data are presented as the means± SEM, n = 3.
To verify the function of MEG3 in JEG-3 cells, siRNA fragments against MEG3 were synthesized. Knockdown efficiency was confirmed using RT-qPCR (Fig. 6A). Cells were then transfected with siMEG3 fragments or a siNC control. CCK-8 and transwell assays were performed to evaluate the impact of these siRNAs on cell growth and invasiveness. Knockdown of the transcription level of MEG3 decreased JEG-3 cell proliferation and invasiveness (Figure 6 B-F). MEG3 may regulate the transcription level and function of miR-21 in cells. Therefore, we hypothesized that regulation of the transcription levels of these RNAs may play a role in PE. Using RT-qPCR, we investigated the levels of transcription in the placental tissues from the normal pregnancy group and PE patients, and found that miR-21 was upregulated (Figure 7A) and MEG3 was downregulated in the PE tissues (Figure 7B). In addition, transcription of miR-21 was linearly negatively correlated with the transcription of MEG3 in PE tissues (Figure 7C).
Figure 6.
Impact of the lncRNA MEG3 on JEG-3 cell growth and invasiveness. A) A RT-qPCR experiment verified the interference efficiency of siMEG3. B) A CCK-8 assay for JEG-3 cell proliferation after treatment with siMEG3. C) Cell migration was measured using a wound-healing assay after treatment with siMEG. D) Quantification of JEG-3 cell migration. E) Invasiveness was analyzed using a transwell invasion assay with cells treated with siMEG3 or controls. F) Representative images from transwell assays for cells treated with siMEG3. Quantification of cell invasiveness is presented; **p<0.01 relative to the siNC group. Data are presented as the means ±SEM, n = 3.
Figure 7.
The lncRNA MEG3 promotes trophoblast cell metastasis and invasiveness through its regulation of the miR-21/BMPR2 signaling pathway. A,B) RT-qPCR analysis of the transcription levels of miR-21-5p and MEG3 in the placenta for the normal pregnancy group and PE patients. C) Correlation analysis between the transcription levels of miR-21-5p and MEG3 in the placental tissues of PE patients; *p<0.05 relative to the normal pregnancy group. Data are presented as the means ±SEM, n = 3.
The targeting relationship between miR-21 and the lncRNA MEG3. A) Bioinformatics analysis showed that miR-21 is a potential target of the MEG3 lncRNA. B,C) RT-qPCR experiments verified that MEG3 targets miR-21 and decreases its transcription level. D) A luciferase reporter gene experiment confirmed that MEG3 targets and regulates miR-21 transcription levels; **p<0.01 and ***p<0.001. Data are presented as the means± SEM, n = 3.Together, the above results indicate that, in vivo and in vitro, the lncRNA MEG3 functions as an inhibitory factor that sponges miR-21, thereby regulating the transcription of BMPR2 and promoting JEG-3 cell growth and invasiveness in PE.
Discussion
Over the past few decades, extensive research from multiple angles has been conducted to explain the pathogenesis of PE and find effective treatment methods. Unfortunately, treatments including a Na+ diet, Ca++ supplementation, and diuretics have proven ineffective.[27] Therefore, it is necessary to develop alternative options based on new understandings about the mechanisms of action underlying the development of PE.TGF-β family members play an important role in placenta formation and are also important pro-angiogenic factors. The level of soluble endoglin (sEng) is elevated in PE patient tissues. sEng is involved in neutralizing TGF-β, inhibiting the binding between TGF-β and its TGF-β receptor, and inducing vasodilation and endothelial nitric oxide synthase (eNOS) activation.[28,29] BMP activates SMAD1/5/8 through BMP type I [activin A receptor type (ALK)1, 2, 3, and 6] and type II receptors.[30] Our research focused on the role BMPR2 plays in PE. Previous studies investigated the function of BMPR2 in other vascular diseases, but little is known about its mechanism of action in PE. We found that BMPR2 is expressed at low levels in PE tissues, and overexpression of BMPR2 increased the growth and invasiveness of JEG-3 cells, indicating that BMPR2 plays an important role in the development of PE.Impact of the lncRNA MEG3 on JEG-3 cell growth and invasiveness. A) A RT-qPCR experiment verified the interference efficiency of siMEG3. B) A CCK-8 assay for JEG-3 cell proliferation after treatment with siMEG3. C) Cell migration was measured using a wound-healing assay after treatment with siMEG. D) Quantification of JEG-3 cell migration. E) Invasiveness was analyzed using a transwell invasion assay with cells treated with siMEG3 or controls. F) Representative images from transwell assays for cells treated with siMEG3. Quantification of cell invasiveness is presented; **p<0.01 relative to the siNC group. Data are presented as the means ±SEM, n = 3.Because miRNAs have shown promise as biomarkers for various diseases, exploring the relationship between miRNAs and PE has become a topic of intense research interest.[31] For example, miR-203a-3p is downregulated in the serum of PE patients, whereas overexpression of miRNA-203a-3p suppresses interleukin 24 (IL24) in THP-1 cells and inhibits inflammation.[32] miR-125a-5p inhibits the migration and proliferation of trophoblast cells by targeting vascular endothelial growth factor A (VEGFA).[33] miRNAs have the potential to become biomarkers for the diagnosis and treatment of PE, but further elucidation of the miRNA signaling network in PE is required.[34-36] The observed levels of miR-21 transcribed in PE tissues are controversial. Relative to a normal pregnancy group, the level of transcription of miR-21 in late onset PE is low, but in early onset PE the level is not significantly different. [37] These results are similar to those presented in an earlier miRNA analysis article.[38] Most results suggest that the transcription of miR-21 increases in PE tissues.[21,35] miR-21 targets FOXM1, thereby regulating the proliferation of placental cells and promoting the development of PE.[39] In addition, the lncRNA Gas5 regulates the PI3K/AKT signaling pathway and its downstream targets affect the biological functions of trophoblast cells, which are related to miR-21.[40] Our results are in agreement with reports that observed high levels of transcription of miR-21 in PE. In addition, our results demonstrate that miR-21 inhibits JEG-3 growth and invasiveness by targeting BMPR2, providing some evidence and insight into understanding the miR-21 signaling network in PE.In addition to miRNAs, lncRNAs are frequently involved in regulating the pathogenesis and development of PE. The lncRNA TCL6 is transcribed at high levels and promotes the development of PE by regulating transcription from CDK2 and PTEN.[41] The lncRNA SNHG14 acts as a molecular sponge for miR-330-5p to regulate trophoblast cell invasion and epithelial–mesenchymal transition (EMT).[42] Knockdown of the transcription level of the lncRNA PVT1 reduces the expression of phosphorylated AKT and its downstream related genes, thereby inhibiting trophoblast cell growth.[43] Herein, we show that MEG3 acts as a molecular sponge of miR-21, which promotes the expression of BMPR2, and consequently, the function of JEG-3 cells. The function of MEG3 in PE was preliminarily verified. MEG3 affects the expression levels of nuclear factor kappa B (NF-κB), Caspase-3, and Bax in trophoblast cells, thereby impacting cell apoptosis.[44] In trophoblast cells, the upregulation of miR-21 inhibits MEG3 transcription, thereby inhibiting EMT.[45]
MEG3 regulates the development of PE by targeting different signaling pathways, such as Ras-MAPK and Notch1.[22,46] However, only one study showed that the MEG3/SMAD7 axis was involved in the development of PE through regulation of the TGF-β signaling pathway and the EMT process in trophoblast cells.[47] Therefore, this study gives us a deeper understanding of the relationship between MEG3 and the TGF- β signaling pathway.The lncRNA MEG3 promotes trophoblast cell metastasis and invasiveness through its regulation of the miR-21/BMPR2 signaling pathway. A,B) RT-qPCR analysis of the transcription levels of miR-21-5p and MEG3 in the placenta for the normal pregnancy group and PE patients. C) Correlation analysis between the transcription levels of miR-21-5p and MEG3 in the placental tissues of PE patients; *p<0.05 relative to the normal pregnancy group. Data are presented as the means ±SEM, n = 3.In summary, this study shows that the lncRNA MEG3 increases trophoblast cell growth and invasiveness through the miR- 21/BMPR2 signaling pathway and inhibits the progress of PE. These results provide new insights into the pathogenesis of PE and will contribute to the development of novel treatments.
Authors: Fanhao Ye; Wenbing Jiang; Wei Lin; Yi Wang; Hao Chen; He Zou; Shiwei Huang; Ning Zhu; Sisi Han Journal: Medicine (Baltimore) Date: 2020-07-31 Impact factor: 1.817