Literature DB >> 34747697

The role of TAp63γ and P53 point mutations in regulating DNA repair, mutational susceptibility and invasion of bladder cancer cells.

Hsiang-Tsui Wang1, Hyun-Wook Lee1, Mao-Wen Weng1, Yan Liu2, William C Huang2, Herbert Lepor2, Xue-Ru Wu2, Moon-Shong Tang1.   

Abstract

It has long been recognized that non-muscle-invasive bladder cancer (NMIBC) has a low propensity (20%) of becoming muscle-invasive (MIBC), and that MIBC carry many more p53 point mutations (p53m) than NMIBC (50% vs 10%). MIBC also has a higher mutation burden than NMIBC. These results suggest that DNA repair capacities, mutational susceptibility and p53m are crucial for MIBC development. We found MIBC cells are hypermutable, deficient in DNA repair and have markedly downregulated DNA repair genes, XPC, hOGG1/2 and Ref1, and the tumor suppressor, TAp63γ. In contrast, NMIBC cells are hyperactive in DNA repair and exhibit upregulated DNA repair genes and TAp63γ. A parallel exists in human tumors, as MIBC tissues have markedly lower DNA repair activity, and lower expression of DNA repair genes and TAp63γ compared to NMIBC tissues. Forced TAp63γ expression in MIBC significantly mitigates DNA repair deficiencies and reduces mutational susceptibility. Knockdown of TAp63γ in NMIBC greatly reduces DNA repair capacity and enhances mutational susceptibility. Manipulated TAp63γ expression or knockdown of p53m reduce the invasion of MIBC by 40-60%. However, the combination of p53m knockdown with forced TAp63γ expression reduce the invasion ability to nil suggesting that p53m contributes to invasion phenotype independent from TAp63γ. These results indicate that in BC, TAp63γ regulates DNA repair capacities, mutational susceptibility and invasion, and that p53m contribute to the invasion phenotype. We conclude that concurrent TAp63γ suppression and acquisition of p53m are a major cause for MIBC development.
© 2021, Wang et al.

Entities:  

Keywords:  DNA repair; TAp63g; bladder cancer; cancer biology; human; mutation susceptibility; p53m; tumor invasion

Mesh:

Substances:

Year:  2021        PMID: 34747697      PMCID: PMC8575459          DOI: 10.7554/eLife.71184

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.713


Introduction

Bladder cancer (BC) is the fifth most frequently occurring cancer in the US; in 2018, there were 81,400 new BC cases and 17,980 BC deaths (Patel et al., 2014). More than 90 % of BCs are urothelial cell carcinoma and the remaining 10 % are squamous carcinoma, adenocarcinoma, and small cell carcinoma (Lopez-Beltran and Cheng, 2006). There are two major forms of BC: the low-grade papillary types that are well- to moderately-differentiated and do not penetrate the lamina propria of the bladder wall (non-muscle-invasive BC, NMIBC), and the muscle-invasive types (MIBC) that are much more poorly differentiated (Wu, 2005; Van Batavia et al., 2014). While the former is much less malignant and less lethal than the latter, it frequently recurs after surgery. The molecular paths that lead to these two types of BC are unclear (Wu, 2005). It has long been recognized that most, if not all, tumor cells have the propensity of malignant progression (Loeb, 2011). Intriguingly, only 20 % of NMIBC progress into MIBC (Wu, 2005; Knowles and Hurst, 2015; Nassar et al., 2019). Recently, it has been found that high-grade MIBC have a much higher genomic DNA mutation burden than the low-grade NMIBC (Nassar et al., 2019; Pietzak et al., 2017). These results raise the possibilities that the low frequency of malignant progression of NMIBC is due to these BC cells being hyperactive for DNA repair and less mutable, and that MIBC cells are hypermutable and have a low DNA repair capacity. To test these possibilities, we determined the susceptibility for DNA-damage-induced mutagenesis and quantified the DNA repair capacity in three well-established MIBC (T24, HT1197 and J82) and two NMIBC (RT4 and RT112/84) cell lines (Rigby and Franks, 1970; Earl et al., 2015). We found that MIBC cells are more susceptible than NMIBC cells to bulky- and oxidative-DNA-damage-induced mutagenesis, and that although MIBC cells are deficient in nucleotide excision repair (NER) and base excision repair (BER), NMIBC cells are proficient in both repair mechanisms. DNA repair genes such as XPC, Ref1, and hOGG1/2, and TAp63γ, the tumor suppressor isoform of p63, are suppressed in MIBC cells but are highly expressed in NMIBC cells. We found that forced TAp63γ expression up-regulates XPC, Ref1, and hOGG1/2, reduces the mutational susceptibility in MIBC cells, and furthermore reduces the invasion potential of MIBC by about 40–60%. It has been found that more MIBC (50%) carry p53 point mutations (p53m) compared to NMIBC (10%). We found that while knockdown p53m in MIBC reduces invasion potential by 50%, the combination of TAp63γ expression and p53m knockdown converts MIBC to become non-invasive. We also found that T3/T4 late-stage MIBC tissues in humans have lower DNA repair activity and p63 expression than Ta early stage NMIBC tissues. Our results indicate that TAp63γ is a major regulator of DNA excision repair genes that have major effects not only on DNA repair capacities and mutational susceptibility but also on the invasion potential of BC cells. TAp63γ suppression and acquisition of p53m are two major causes for BC becoming invasive.

Results

MIBC cells are mutators, whereas NMIBC cells are not

We determined the mutational susceptibility of MIBC and NMIBC cells to DNA-damage-induced mutagenesis in a well-established supF forward mutation detection system (Wang et al., 2013). First, pSP189 DNA plasmids containing the supF gene were either damaged with UVC to induce bulky photodimers, primarily cyclobutane pyrimidine dimers (CPDs), or were modified with H2O2 to induced oxidative DNA damage (ODD), primarily 8-oxo-deoxyguanosines (8-oxo-dGs) (Wang et al., 2010; Tang, 1996). These damaged plasmid DNAs were transfected into and replicated in NMIBC cells (RT4), MIBC cells (T24 and HT1197) or immortalized normal urothelial cells (UROtsa). DNA-damage-induced mutations in the supF gene in the replicated plasmids were then quantified (Wang et al., 2010). The results in Figure 1A and Supplementary file 1 show that UVC-DNA damage induces two- to eightfold more mutations in MIBC cells than in NMIBC cells or UROtsa cells, and that ODD induces six- to eightfold more mutations in MIBC cells compared to NMIBC cells or UROtsa cells. It is worth noting that the susceptibility to DNA-damage-induced mutagenesis of NMIBC cells and UROtsa cells is similar to that of other cultured human cells such as normal lung fibroblasts and skin fibroblasts (Wang et al., 2010; Wang et al., 2012). These results indicate that compared to NMIBC and normal human cells, MIBC cells are hypermutable.
Figure 1.

MIBC cells are hypermutable and deficient in DNA repair, whereas NMIBC cells are hyperactive in DNA repair.

Mutation susceptibility and DNA repair capacity toward UVC- and H2O2-induced DNA damage were determined in MIBC (T24, HT1197, and J82), NMIBC (RT4), immortalized normal human urothelial (UROtsa) cells and human bladder epithelial progenitor (HBEP) cells, as described (Wang et al., 2012). In (A), UVC (1500 J/m2)- and H2O2 (100 mM, 25 °C, 1 hr)-modified pSP189 plasmid DNA containing the supF were transfected into different cells and the mutations in the supF gene were detected and the mutation frequency (MF) calculated. (B & C) Detection of DNA repair in global genomic DNA of NMIBC and MIBC cells. Cells were irradiated with UVC (20 J/m2) or treated with H2O2 (100 mM, 1 hr, at 37 °C), incubated in growth medium for different times (0, 2, 4, 8, and 24 hr) and the cellular genomic DNAs were isolated. In (B), the levels of CPD in the genomic DNA were detected by T4 endonuclease V (T4 Endo V) incision method (Tang et al., 1994; Hu et al., 2002). In (C), the levels of ODD in the genomic DNA were detected by formamidopyrimidine glycosylase (Fpg) incision method (Wang et al., 2010). The enzyme-incised resultant DNAs were denatured and separated by electrophoresis, as described (Wang et al., 2010). Full length genomic DNA and enzyme-incised DNA are indicated. Symbol: C, Un-irradiated or unmodified control cells. (D, E and F) NER and BER capacities in MIBC and NMIBC cells were measured by the host cell reactivation (HCR) assay (D), and by the in vitro DNA-damage-dependent repair synthesis (DDDRS) assay (E & F) as previously described (Lee et al., 2014). For HCR assay, UVC-irradiated (0–2000 J/m2) or H2O2 (0–100 mM, 25 °C, 1 hr)-modified luciferase reporter (pGL-3-luciferase) and unmodified β-galactosidase (pSV-β-galactosidase) plasmids (internal control) were transfected into cells and luciferase and β-galactosidase activities were measured 72 hr post transfection (Wang et al., 2012; Lee et al., 2014). The HCR activity was calculated based on the ratio of luciferase activity versus β-galactosidase activity. The relative repair capacity was calculated based on the luciferase activity obtained from unmodified pGL-3-luciferase activity versus β-galactosidase activity as 100 %. For DDDRS assay, UVC-irradiated (1500 J/m2) or H2O2-modified (100 mM, 25 °C, 1 hr) pUC18 and unmodified pBR322 plasmids were used as DNA substrates for DNA repair synthesis carried out in cell extracts isolated from different BC cells (Lee et al., 2014). A typical DDDRS assay result is shown in (E), in which, the upper panels are ethidium bromide-stained gels. The lower panels are autoradiographs of the same gels. The repair activity was calculated based on the relative intensity of pUC18 band versus pBR322 band. The relative repair capacity depicted at the bottom was calculated based on assigning the repair activity of RT4 cells as 100. (F) Quantitation of DDDRS assay results from UROtsa, HBEP, NMIBC (RT4), and MIBC (T24, J82, and HT1197) cells.

The NER and BER activities in cell lysates were determined the same as in Figures 1 and 2.

MIBC cells are hypermutable and deficient in DNA repair, whereas NMIBC cells are hyperactive in DNA repair.

Mutation susceptibility and DNA repair capacity toward UVC- and H2O2-induced DNA damage were determined in MIBC (T24, HT1197, and J82), NMIBC (RT4), immortalized normal human urothelial (UROtsa) cells and human bladder epithelial progenitor (HBEP) cells, as described (Wang et al., 2012). In (A), UVC (1500 J/m2)- and H2O2 (100 mM, 25 °C, 1 hr)-modified pSP189 plasmid DNA containing the supF were transfected into different cells and the mutations in the supF gene were detected and the mutation frequency (MF) calculated. (B & C) Detection of DNA repair in global genomic DNA of NMIBC and MIBC cells. Cells were irradiated with UVC (20 J/m2) or treated with H2O2 (100 mM, 1 hr, at 37 °C), incubated in growth medium for different times (0, 2, 4, 8, and 24 hr) and the cellular genomic DNAs were isolated. In (B), the levels of CPD in the genomic DNA were detected by T4 endonuclease V (T4 Endo V) incision method (Tang et al., 1994; Hu et al., 2002). In (C), the levels of ODD in the genomic DNA were detected by formamidopyrimidine glycosylase (Fpg) incision method (Wang et al., 2010). The enzyme-incised resultant DNAs were denatured and separated by electrophoresis, as described (Wang et al., 2010). Full length genomic DNA and enzyme-incised DNA are indicated. Symbol: C, Un-irradiated or unmodified control cells. (D, E and F) NER and BER capacities in MIBC and NMIBC cells were measured by the host cell reactivation (HCR) assay (D), and by the in vitro DNA-damage-dependent repair synthesis (DDDRS) assay (E & F) as previously described (Lee et al., 2014). For HCR assay, UVC-irradiated (0–2000 J/m2) or H2O2 (0–100 mM, 25 °C, 1 hr)-modified luciferase reporter (pGL-3-luciferase) and unmodified β-galactosidase (pSV-β-galactosidase) plasmids (internal control) were transfected into cells and luciferase and β-galactosidase activities were measured 72 hr post transfection (Wang et al., 2012; Lee et al., 2014). The HCR activity was calculated based on the ratio of luciferase activity versus β-galactosidase activity. The relative repair capacity was calculated based on the luciferase activity obtained from unmodified pGL-3-luciferase activity versus β-galactosidase activity as 100 %. For DDDRS assay, UVC-irradiated (1500 J/m2) or H2O2-modified (100 mM, 25 °C, 1 hr) pUC18 and unmodified pBR322 plasmids were used as DNA substrates for DNA repair synthesis carried out in cell extracts isolated from different BC cells (Lee et al., 2014). A typical DDDRS assay result is shown in (E), in which, the upper panels are ethidium bromide-stained gels. The lower panels are autoradiographs of the same gels. The repair activity was calculated based on the relative intensity of pUC18 band versus pBR322 band. The relative repair capacity depicted at the bottom was calculated based on assigning the repair activity of RT4 cells as 100. (F) Quantitation of DDDRS assay results from UROtsa, HBEP, NMIBC (RT4), and MIBC (T24, J82, and HT1197) cells.

NMIBC RT112/84 cells are hyperactive in nucleotide excision repair (NER) and base excision repair (BER).

The NER and BER activities in cell lysates were determined the same as in Figures 1 and 2.
Figure 2.

TAp63γ regulates NER and BER activity and mutational susceptibility of BC cells.

The methods for establishing the stable TAp63α, TAp63β, and TAp63γ in T24 cells (MIBC) and the TAp63γ stable transfectants in HT1197 (MIBC), knockdown TAp63γ by miR-RNAi in RT4 cells (NMIBC), and quantification of NER and BER activity and mutational susceptibility were described in text and in Figure 1. (A) Detection of p63 and p53 protein in MIBC (T24, HT1197, J82), NMIBC (RT4) and HBEP cells. Light exposure of p63 gels of RT4 and HBEP shown in the left demonstrates that p63 expression is much higher in RT4 than in HBEP. (B) Detection of NER and BER activity by DDDRS in MIBC T24 cells with and without stable TAp63α, TAp63β, and TAp63γtransfectants. Detection of mRNA of TAp63α, TAp63β, and TAp63γ in T24 cells with and without stable TAp63α, TAp63β, and TAp63γtransfectants was shown in Figure 3 and Figure 2—figure supplement 2. (C & D) Quantification of NER and BER activity by DDDRS (C) and mutational susceptibility (expressed by MF) (D) in T24 and HT1197 cells with and without stable TAp63γtransfectants. (E & F) Quantification of NER and BER activity by DDDRS (E), and mutational susceptibility (F), in NMIBC cells (RT4) with and without stable TAp63γ knockdown by miR-RNAi. Note: (1) stable TAp63α and TAp63βtransfects do not affect NER and BER activity significantly in MIBC cells (B); (2) stable TAp63γ transfectants enhance NER and BER activity (B) and reduce mutational susceptibility (D) of MIBC cells, which do not express both TAp63 and ΔNp63 isoforms (Figure 2—figure supplement 1); and (3) stable TAp63γ miR-RNAi transfectants reduce NER and BER activity (E) and enhance mutational susceptibility (F) in NMIBC cells.

(A) Expression of TAp63 and ΔNp63 isoforms at protein level. No TAp63 and ΔNp63 isoforms at protein level were detected in MIBC (T24 & J82) cells. No ΔNp63 isoforms were detected in NMIBC (RT4) cells. (B) Expression of ΔNp63α and ΔNp63γ at mRNA level in MIBC (T24, HT1197, and J82), T24 with TAp63γ transfectants, and NMIBC RT4 cells. No ΔNp63α and ΔNp63γwas detected in MIBC cells. Very low level of ΔNp63γwas detected in NMIBC cells.

The constructions of T24 cells carrying stable TAp63α and TAp63β were the same as described in Figure 2. The detection methods are the same as described in 2,3Figures 2 and 3.

MIBC cells are deficient in DNA repair, whereas NMIBC cells are hyperactive in DNA repair

One possible cause that leads to profound differences in susceptibility to UVC- and H2O2-induced-DNA-damage mutagenesis between MIBC and NMIBC cells is that these cells have different repair capacities. To test this possibility, we determined the capacity of NMIBC (RT4) and MIBC (T24 and HT1197) cells to repair UVC-induced bulky CPDs or H2O2-induced 8-oxo-dGs in genomic DNA using the T4 endonuclease V (T4 endo V) and formamidopyrimidine glycosylase (Fpg) incision assays, respectively. It has been well-established that T4 endo V specifically incises UV-induced CPDs, and that Fpg incises ODD, mainly 8-oxo-dG adducts (Latham and Lloyd, 1994; Tchou et al., 1994). Results in Figure 1B and C show that, whereas UV-induced CPDs (T4 endo V sensitive sites) and H2O2-induced ODDs (Fpg sensitive sites) disappear (repaired) within 24 hr incubation in NMIBC cells, these DNA damages remain in MIBC cells. Since it is well established that the major repair pathways for bulky CPDs and ODDs are NER and BER mechanisms, these results indicate that NMIBC cells are proficient in NER and BER, whereas MIBC cells are deficient in NER and BER. Using the well-established host cell reactivation (HCR) assay and the in vitro DNA–damage-dependent-repair synthesis (DDDRS) assay, we quantified the relative repair capacity in MIBC cells versus NMIBC cells (Feng et al., 2006; Wang et al., 2009). The results in Figure 1D show that the HCR capacity for UVC-induced DNA damage in MIBC (T24, J82, and HT1197) cells is much lower than in NMIBC (RT4) cells, and that the HCR for H2O2-induced DNA damage in MIBC cells are also lower than in NMIBC cells although the differences are not as pronounced. The results in Figure 1E and F demonstrate that cell-free lysates isolated from MIBC cells have less than 25 % capacity for repairing UVC- and H2O2-induced DNA-damages compared to lysates isolated from NMIBC cells. The results also show that cell lysates isolated from NMIBC and UROtsa cells have a higher repair capacity for both UVC- and H2O2-induced DNA damage than those isolated from normal human bladder epithelial progenitor (HBEP) cells (100 % vs 29–38%), indicating that NMIBC and UROtsa cells have hyperactive NER and BER functions.

TAp63 is suppressed in MIBC cells and highly expressed in NMIBC cells

It is intriguing that the three MIBC cell lines, T24, HT1197, and J82, which are derived from different patients with T3/T4 MIBC, have similar deficiencies not only in NER but also in BER (Rigby and Franks, 1970; Bubeník et al., 1973; O’Toole et al., 1972). Since multiple repair proteins are involved in NER for UV-induced CPDs, and BER for 8-oxo-dG adducts, and the repair rate-limiting factors such as damage recognition or incision and excision enzymes involved in these two repair pathways do not overlap (Friedberg Errol et al., 2006), it is unlikely that these three lines of MIBC cells share the same mutations in genes directly involved in NER and BER. Rather, it is more likely that the deficiencies in both NER and BER in these three MIBC cell lines are due to downregulation of NER and BER genes which are controlled by a common transcription factor and that this transcription factor is abundant in NMIBC but deficient in MIBC. Thus, we inquired what is this gene? In a genome-wide analysis, Lin et al., 2009 found that p63 controls multiple DNA repair associate genes. Subsequently, Liu et al., 2012 found that TAp63γ regulates the NER gene XPC in human fibroblasts. It had long been recognized that expression of the p63 gene is suppressed in MIBC cells but not in NMIBC cells Urist et al., 2002; these findings led us to determine the role of p63 in DNA repair, mutation susceptibility and invasiveness of BC cells in the current study. The results in Figure 2A and Figure 2—figure supplement 1 show that no p63 proteins, including TAp63 and ΔNp63 isoforms, are non-detectable in the MIBC cells, T24, HT1197 or J82. In contrast, multiple p63 proteins are highly expressed in NMIBC RT4 and HBEP cells. It should be noted that the level of p63 expression in NMIBC cells, is higher than in HBEP and that NMIBC cells have a higher repair activity than HBEP cells (Figure 1E and F vs Figure 2A).
Figure 2—figure supplement 1.

Expression of TAp63 and ΔNp63 isoforms in MIBC (T24 and J82), NMIBC (RT4) and immortalized human bladder urothelial UROtsa cells.

(A) Expression of TAp63 and ΔNp63 isoforms at protein level. No TAp63 and ΔNp63 isoforms at protein level were detected in MIBC (T24 & J82) cells. No ΔNp63 isoforms were detected in NMIBC (RT4) cells. (B) Expression of ΔNp63α and ΔNp63γ at mRNA level in MIBC (T24, HT1197, and J82), T24 with TAp63γ transfectants, and NMIBC RT4 cells. No ΔNp63α and ΔNp63γwas detected in MIBC cells. Very low level of ΔNp63γwas detected in NMIBC cells.

TAp63γ regulates NER and BER activity and mutational susceptibility of BC cells.

The methods for establishing the stable TAp63α, TAp63β, and TAp63γ in T24 cells (MIBC) and the TAp63γ stable transfectants in HT1197 (MIBC), knockdown TAp63γ by miR-RNAi in RT4 cells (NMIBC), and quantification of NER and BER activity and mutational susceptibility were described in text and in Figure 1. (A) Detection of p63 and p53 protein in MIBC (T24, HT1197, J82), NMIBC (RT4) and HBEP cells. Light exposure of p63 gels of RT4 and HBEP shown in the left demonstrates that p63 expression is much higher in RT4 than in HBEP. (B) Detection of NER and BER activity by DDDRS in MIBC T24 cells with and without stable TAp63α, TAp63β, and TAp63γtransfectants. Detection of mRNA of TAp63α, TAp63β, and TAp63γ in T24 cells with and without stable TAp63α, TAp63β, and TAp63γtransfectants was shown in Figure 3 and Figure 2—figure supplement 2. (C & D) Quantification of NER and BER activity by DDDRS (C) and mutational susceptibility (expressed by MF) (D) in T24 and HT1197 cells with and without stable TAp63γtransfectants. (E & F) Quantification of NER and BER activity by DDDRS (E), and mutational susceptibility (F), in NMIBC cells (RT4) with and without stable TAp63γ knockdown by miR-RNAi. Note: (1) stable TAp63α and TAp63βtransfects do not affect NER and BER activity significantly in MIBC cells (B); (2) stable TAp63γ transfectants enhance NER and BER activity (B) and reduce mutational susceptibility (D) of MIBC cells, which do not express both TAp63 and ΔNp63 isoforms (Figure 2—figure supplement 1); and (3) stable TAp63γ miR-RNAi transfectants reduce NER and BER activity (E) and enhance mutational susceptibility (F) in NMIBC cells.
Figure 2—figure supplement 2.

Detection of mRNA of TAp63α and TAp63β in T24 cells with and without stable TAp63α and TAp63β transfectants.

The constructions of T24 cells carrying stable TAp63α and TAp63β were the same as described in Figure 2. The detection methods are the same as described in 2,3Figures 2 and 3.

Expression of TAp63 and ΔNp63 isoforms in MIBC (T24 and J82), NMIBC (RT4) and immortalized human bladder urothelial UROtsa cells.

(A) Expression of TAp63 and ΔNp63 isoforms at protein level. No TAp63 and ΔNp63 isoforms at protein level were detected in MIBC (T24 & J82) cells. No ΔNp63 isoforms were detected in NMIBC (RT4) cells. (B) Expression of ΔNp63α and ΔNp63γ at mRNA level in MIBC (T24, HT1197, and J82), T24 with TAp63γ transfectants, and NMIBC RT4 cells. No ΔNp63α and ΔNp63γwas detected in MIBC cells. Very low level of ΔNp63γwas detected in NMIBC cells.

Detection of mRNA of TAp63α and TAp63β in T24 cells with and without stable TAp63α and TAp63β transfectants.

The constructions of T24 cells carrying stable TAp63α and TAp63β were the same as described in Figure 2. The detection methods are the same as described in 2,3Figures 2 and 3.
Figure 3.

TAp63γ regulates expression of DNA repair genes, XPC, hOGG1/2, and Ref one in BC cells.

The constructs of the MIBC (T24 and HT1197) with stable TAp63γtransfectants and NMIBC (RT4) cells with stable TAp63γmiR-RNAi are the same as in Figure 2. The expression of TAp63γ, XPA, XPC, hOGG1/2, and Ref1 was determined at the mRNA (A & C) and protein (B & D) levels. The methods of detection were the same as described (Wang et al., 2012). Note: (1) XPC, hOGG1/2 and Ref1 are downregulated in MIBC cells, T24 and HT1197, and upregulated in NMIBC RT4 cells; (2) forced TAp63γ expression in MIBC cells upregulates expression of XPC, hOGG1/2, and Ref1 genes; and (3) TAp63γ knockdown by miR-RNAi downregulates these genes in NMIBC cells. Symbols: C and R in (D) represent vector control and vector with random inserts.

Human bladder tumor tissues (BTT, stage Ta, T1 and T3/4, n = 4) and normal human urothelial mucosa (NHUM, n = 9) were obtained as described in text. The DNA repair capacity (A) and the repair proteins XPC, hOGG1/2 and Ref1, and p63 (B) were detected the same as in Figure 5. Note: RT4 cells are derived from NMIBC.

ChIP assays were performed with chromatin extracted from human bladder epithelial progenitor (HBEP) cells, MIBC (T24 and HT1197) cells and NMIBC (RT4) cells. Chromatin-associated DNA was probed by PCR using TAp63-specific primers. ChIP assays were also performed on input chromatin (positive control) and chromatin precipitated with non-specific IgG antibodies (negative control). (A) mRNA level of TAp63 in HBEP, NMIBC RT4 cells and MIBC T24, and HT1197 cells. (B) Results of CHIP assay using either antibody against activation marker H3K4me3 or silencing marker H3H9me2 or H3H27me3 followed by PCR reaction. (C) Quantification of histone methylation.

TAp63γ regulates NER and BER activity and the mutational susceptibility of BC Cells

More than a dozen of p63 isoforms have been identified and among them TAp63γ, TAp63α, and TAp63β are the three major ones with ΔNp63γ, ΔNp63α, and ΔNp63β as minor forms (Ghioni et al., 2002; Murray-Zmijewski et al., 2006). We found that no p63 expression, including all the TAp63 and ΔNp63 isoforms, were detected in the MIBC cells such as T24, HT1197, and J82 cells (Figures 2A and 3 and Figure 2—figure supplement 1). On the other hand, the TAp63 isoforms are highly expressed in NMIBC RT4 cells (Figures 2A and 3 and Figure 2—figure supplement 1). These results raise the possibility that it is TAp63 that contribute to the hyperactive DNA repair function in NMIBC cells and that the lack of TAp63 expression may contribute to the DNA repair deficiency in MIBC cells. Two more factors lead us to determine the role of TAp63 isoforms in DNA repair and invasiveness of BC cells. One, TAp63γ has been shown upregulates NER function and expression of repair genes XPC, DDB2 and GADD45 in human skin fibroblasts (Liu et al., 2012). While TAp63 isoforms have transcription transactivation function ΔNp63 isoforms lack this function (Petitjean et al., 2008). Two, whereas TAp63 isoforms function as tumor suppressors ΔNp63 isoforms have oncogenic function by inhibition of TAp63 function (Flores, 2007). It is well established that individuals deficient in DNA repair are more prone to develop cancers (Friedberg Errol et al., 2006), and that the somatic cells of these individuals are not only deficient in DNA repair but also more mutagenic (Friedberg Errol et al., 2006). These findings lead us to hypothesize the lack of DNA repair and the mutagenic and invasive prone of MIBC is more likely due to lack of TAp63 isoforms rather than lack of the oncogenic ΔNp63 isoforms. Therefore, we next aimed to determine which of these three major isoforms regulates DNA repair and invasion activity in BC cells. To do so, TAp63γ, TAp63α, and TAp63β were each transfected into MIBC T24 cells (Figure 2B and Figure 2—figure supplement 2) which are deficient in both NER and BER activity as shown in Figure 1. The NER and BER capacities in T24 cells with transfected TAp63γ, TAp63α, or TAp63β were determined in comparison to control vector stable transfectants. The results in Figure 2B show that T24 cells with stable TAp63γ transfectants have a much higher level of NER and BER activity than T24 cells with stable control vector transfectants. In contrast, the T24 cells with stable TAp63α and TAp63β transfectants have a similar level of NER and BER activity compared to T24 cells with stable control vector transfectants. These results indicate that TAp63γ alone can regulate both NER and BER activity in these BC cells.

TAp63γ regulates expression of DNA repair genes, XPC, hOGG1/2, and Ref one in BC cells.

The constructs of the MIBC (T24 and HT1197) with stable TAp63γtransfectants and NMIBC (RT4) cells with stable TAp63γmiR-RNAi are the same as in Figure 2. The expression of TAp63γ, XPA, XPC, hOGG1/2, and Ref1 was determined at the mRNA (A & C) and protein (B & D) levels. The methods of detection were the same as described (Wang et al., 2012). Note: (1) XPC, hOGG1/2 and Ref1 are downregulated in MIBC cells, T24 and HT1197, and upregulated in NMIBC RT4 cells; (2) forced TAp63γ expression in MIBC cells upregulates expression of XPC, hOGG1/2, and Ref1 genes; and (3) TAp63γ knockdown by miR-RNAi downregulates these genes in NMIBC cells. Symbols: C and R in (D) represent vector control and vector with random inserts.

Determination of DNA repair capacity and p63 protein levels in normal human urothelial mucosa.

Human bladder tumor tissues (BTT, stage Ta, T1 and T3/4, n = 4) and normal human urothelial mucosa (NHUM, n = 9) were obtained as described in text. The DNA repair capacity (A) and the repair proteins XPC, hOGG1/2 and Ref1, and p63 (B) were detected the same as in Figure 5. Note: RT4 cells are derived from NMIBC.

The TAp63 promoter region in MIBC cells is rich in transcription silencing markers, H3K9me2 and H3K27me3, whereas this region in NMIBC cells is rich in transcription activating marker H3K4me3.

ChIP assays were performed with chromatin extracted from human bladder epithelial progenitor (HBEP) cells, MIBC (T24 and HT1197) cells and NMIBC (RT4) cells. Chromatin-associated DNA was probed by PCR using TAp63-specific primers. ChIP assays were also performed on input chromatin (positive control) and chromatin precipitated with non-specific IgG antibodies (negative control). (A) mRNA level of TAp63 in HBEP, NMIBC RT4 cells and MIBC T24, and HT1197 cells. (B) Results of CHIP assay using either antibody against activation marker H3K4me3 or silencing marker H3H9me2 or H3H27me3 followed by PCR reaction. (C) Quantification of histone methylation. We further tested whether there is a causative relationship between TAp63γ expression and NER and BER capacity and susceptibility to DNA damage-induced mutagenesis in NMIBC cells. To do this, the NER and BER capacities and the mutational susceptibilities in two MIBC cells, T24 and HT1197, with and without stable TAp63γ transfectants, were determined. The results in Figure 2C show that NER and BER capacity are greatly enhanced in both T24 and HT1197 MIBC cells with TAp63γ stable expression compared to each of the untransfected parental cells. Furthermore, the susceptibility toward UVC- and ODD-induced mutagenesis is also significantly reduced in these MIBC cells with stable TAp63γ expression compared to the parental cells (Figure 2D and Supplementary file 2).

Suppression of TAp63γ expression in NMIBC cells reduces DNA repair capacity and enhances mutational susceptibility

To further demonstrate the role of TAp63γ in regulating DNA repair and mutation susceptibility phenotype in BC cells, we determined the DNA repair capacity and susceptibility to DNA damage-induced mutagenesis in NMIBC cells with and without knockdown of TAp63γ. The results in Figure 2E and F and Supplementary file 3 show that knockdown of TAp63γ in the NMIBC cells reduces NER and BER capacities and enhances cell susceptibility to DNA damage induced mutagenesis to the similar level as in MIBC T24 cells. Thus, these results indicate that the upregulation of TAp63γ is a major factor which is responsible for the hyperactive DNA repair function and low susceptibility to DNA-damage-induced mutagenesis in NMIBC cells.

TAp63γ upregulates XPC, hOGG1/2, and Ref1 in BC cells

Although more than a dozen of different forms of p63 have been identified in human cells, none of them are directly involved in the NER or BER DNA damage processing mechanisms (Liu et al., 2012; Yang et al., 1998; Melino et al., 2015; Spivak, 2015; Marteijn et al., 2014; Krokan and Bjørås, 2013; Dianov and Hübscher, 2013). Rather, p63 proteins are transcription factors, which likely regulate NER and BER by affecting the expression of the genes encoding the functional proteins directly involved in NER and BER mechanisms. We tested this possibility, by determining the expression of NER genes, XPA and XPC, as well as BER genes, hOGG1/2, and Ref1 in MIBC (T24 and HT1197) and NMIBC (RT4) cells. XPA is essential for both global genomic and transcription-coupled NER, and XPC is essential for global genomic NER (Hanawalt and Spivak, 2008). Ref1 and hOGG1/2 function as repair enzymes for abasic sites and 8-oxo-dG’s, respectively (Xanthoudakis and Curran, 1992; Bjorâs et al., 1997). The results in Figure 3A-D show that (1) XPC, Ref1, and hOGG1/2 are highly expressed in NMIBC cells but are either not or lowly expressed in MIBC cells; (2) transfection-induced TAp63γ expression elevates levels of XPC, Ref1, and hOGG1/2 in MIBC cells; and (3) knockdown of TAp63γ expression causes a downregulation of XPC, Ref1, and hOGG1/2 in NMIBC cells. Collectively, the results in Figures 2 and 3 indicate that the level of TAp63γ expression determines the NER and BER activity and the mutational susceptibility phenotype of MIBC and NMIBC cells, and that TAp63γ exerts these effects most likely via its regulation on DNA repair genes such as, XPC, hOGG1/2, and Ref1.

TAp63γ expression attenuates invasion potential of MIBC cells

Since p63 has been suggested to control tumor invasion and metastasis via its regulation of epithelial-mesenchymal transition and expression of matrix metalloproteinase genes (Celardo et al., 2014; Tran et al., 2013), we examined the effect of the three p63 isoforms: TAp63α, TAp63β, and TAp63γ, on BC migration and invasion using MIBC T24 cells. The results in Figure 4A show that compared to parental MIBC T24 cells, the migration and invasiveness of MIBC cells with stable expression of TAp63γ transfectants are greatly reduced (60%). In contrast, MIBC cells with the stable transfectants of TAp63α and TAp63β have the same invasiveness potential as the untransfected parental cells. The stable expression of TAp63γ transfectants in MIBC HT1197 cells also reduced invasion potential (40%) (Figure 4). We further tested the effect of TAp63γ on wound healing ability. These results in Figure 4B show that MIBC cells, T24 and HT1197, with stable TAp63γ transfectants lose wound healing ability. These results indicate that TAp63γ plays an important role in determining the invasiveness of MIBC.
Figure 4.

TAp63γ expression and p53m knockdown reduce invasion potential of MIBC cells.

The effect of TAp63γ and p53m on cell mobility and invasion potential were assayed by (A) migration and invasion chambers using Matrigel kits, and (B) wound healing in different cell lines which were constructed as described in the text. These cell lines are: (1) MIBC (T24 and HT1197) cells, (2) MIBC (T24 and HT1197) cells with stable control vector transfectants, (3) MIBC cells with stable TAp63γ,TAp63α, and TAp63β transfectants, (4) MIBC cells with shRNA p53 knockdown, (5) MIBC cells with stable TAp63γ transfectants and shRNA p53 knockdown. The relative migration (RM) and relative invasion (RI) potentials were quantified by the methods described in vendor’s instruction as follow:

Note: Invasion potential of HT1197 cells which over expressed p53m365 (Cooper et al., 1994) as shown in Figure 2, is higher than T24 cells which have a low expression of one wild-type allele and one allele nonsense mutation of p53.

TAp63γ expression and p53m knockdown reduce invasion potential of MIBC cells.

The effect of TAp63γ and p53m on cell mobility and invasion potential were assayed by (A) migration and invasion chambers using Matrigel kits, and (B) wound healing in different cell lines which were constructed as described in the text. These cell lines are: (1) MIBC (T24 and HT1197) cells, (2) MIBC (T24 and HT1197) cells with stable control vector transfectants, (3) MIBC cells with stable TAp63γ,TAp63α, and TAp63β transfectants, (4) MIBC cells with shRNA p53 knockdown, (5) MIBC cells with stable TAp63γ transfectants and shRNA p53 knockdown. The relative migration (RM) and relative invasion (RI) potentials were quantified by the methods described in vendor’s instruction as follow: Note: Invasion potential of HT1197 cells which over expressed p53m365 (Cooper et al., 1994) as shown in Figure 2, is higher than T24 cells which have a low expression of one wild-type allele and one allele nonsense mutation of p53.

TAp63γ expression and P53m knockdown reduce more than 90% of MIBC invasion potential

About 50 % of MIBC have p53 point mutations (p53m) compared to 10 % of NMIBC, and p63 is suppressed in MIBC but is highly expressed in NMIBC (Figure 2; Nassar et al., 2019; Urist et al., 2002; Wolff et al., 2005; Berggren et al., 2001; Robertson et al., 2017; Cordon-Cardo et al., 1994; Spruck et al., 1994; Cancer Genome Atlas Research Network, 2014). We found that HT1197 cells which carry p53m, are 2-fold more invasive than T24 BC cells which carry one wild p53 (p53wt) allele and one p53 allele with a nonsense mutation (Figure 4A and B; Cooper et al., 1994). While T24 cells have a low level of p53wt, the p53m in HT1197 is highly expressed (Figure 2A). These results raise the possibility that p53m may enhance the invasion ability of MIBC independently from TAp63γ. We tested this possibility by determining the effect of knockdown p53m on the invasion ability of MIBC cells. We found that knockdown of p53 expression reduces invasion potential of T24 and HT1197 by more than 50 % (Figure 4A). Furthermore, the combination of p53 knockdown and forced TAp63γ expression almost completely abolish the invasion potential of MIBC T24 and HT1197 cells (Figure 4A). These results indicate that expression of p53m and suppression of TAp63γ are the crucial factors that make these cells invasive.

DNA repair and P63 expression are inversely related to bladder cancer stage

Although the divergent abilities of cultured MIBC and NMIBC to invade are already well established, their distinct DNA repair capacity and mutation phenotypes, and their relationships with TAp63γ expression presented above have not been reported before. It is possible that some of these characteristics are due to mutations accumulated from generations of in vitro culture growth. Therefore, these characteristics may not be necessarily reflecting the inherent traits of human bladder tumors in vivo. The chance of acquiring “extra” genotypic changes in MIBC cells is even higher than in NMIBC cells since MIBC cells are deficient in DNA repair and are hypermutable. Furthermore, defining the relationship of DNA repair capacity and the level of expression of DNA repair genes and p63 for different grades and stages of human BC is useful for understanding the underlying mechanisms of BC pathogenesis. Therefore, we examined DNA repair capacity and the expression of p63, XPC, Ref1 and hOGG1/2 at the protein level in surgical samples acquired from BC (n = 16) and normal human urothelium mucosa (NHUM) (n = 13). The results show: (1) NHUM, which express UPIIIa (Lee et al., 2014), are deficient in NER and BER and in the expression of XPA, XPC, hOGG1/2, Ref1, and p63 genes (Figures 3 and 5 and Figure 2—figure supplement 1). In contrast, cultured human bladder epithelial progenitor (HBEP) cells, which do not express UPIIIa (Lee et al., 2014), are proficient in NER and BER and in expressing these NER and BER genes (Figure 1E); (2) NER and BER capacity in stage Ta NMIBC is higher than stage T1, T2 MIBC, and stage T3, T4 MIBC have the lowest NER and BER capacity (Figure 5A,B); (3) p63 expression is highest in stage Ta NMIBC followed by stage T1 & T2 MIBC, and stage T3 & T4 MIBC have lowest p63 expression (Figure 5C and D); and (4) stage T3 & T4 MIBC have lower XPC, XPA, and Ref1 expression than Stage Ta to T2 MIBC (Figure 5C and D). These results demonstrate that stage Ta NMIBC and stage T3 & T4 MIBC have similar NER and BER capacity to that in cultured NMIBC and MIBC cells, respectively. In contrast, NER and BER capacity in stage T1 & T2 MIBC are lower than Ta NMIBC but higher than T3 & T4 MIBC. These results demonstrate that both cultured MIBC cells and late stage MIBC tissues are deficient in NER and BER and p63 expression, while Ta NMIBC tissues and cultured NMIBC cells have relatively high p63 expression and high NER and BER capacity. In contrast, stage T1 and T2 MIBC tissues have intermediate levels of NER and BER capacity and p63 expression. These results indicate that expression of p63 and DNA repair capacity play a pivotal role in BC pathogenesis.
Figure 5.

NER and BER capacity, expression of repair genes, and p63 in human bladder cancer tissues of different stages.

Cell lysates were prepared from human bladder tumor tissues (BTT) of different stages (Ta to T4, n = 16). (A) NER and BER capacity in these lysates were determined by in vitro DNA-damage-dependent-repair synthesis assay, as described in Figures 1 and 2, and relative repair capacities were calculated and depicted in (B). (C) Repair proteins XPC, hOGG1/2 and Ref1, and p63 proteins in these lysates were detected the same as described in Figure 3. (D) Quantifications of the relative levels of p63, XPC, hOGG1/2, and Ref1 proteins in different stage BC tissues. * and *** represent p value of < 0.05 and < 0.001. The p value for the NER difference of Ta vs T1/T2 in (B) is 0.073.

NER and BER capacity, expression of repair genes, and p63 in human bladder cancer tissues of different stages.

Cell lysates were prepared from human bladder tumor tissues (BTT) of different stages (Ta to T4, n = 16). (A) NER and BER capacity in these lysates were determined by in vitro DNA-damage-dependent-repair synthesis assay, as described in Figures 1 and 2, and relative repair capacities were calculated and depicted in (B). (C) Repair proteins XPC, hOGG1/2 and Ref1, and p63 proteins in these lysates were detected the same as described in Figure 3. (D) Quantifications of the relative levels of p63, XPC, hOGG1/2, and Ref1 proteins in different stage BC tissues. * and *** represent p value of < 0.05 and < 0.001. The p value for the NER difference of Ta vs T1/T2 in (B) is 0.073.

Discussion

We found that the well-established NMIBC cells, RT4, and two MIBC cell lines, T24, and HT1197, have distinct differences in their DNA repair capacity, expression of DNA repair genes, hOGG1/2, Ref1, and XPC, and expression of the tumor suppressor gene TAp63γ, as well as marked differences in their susceptibilities to DNA-damage-induced mutagenesis. The two MIBC lines T24 and HT1197, have similar, if not identical, deficiencies in NER and BER, as well as low expression of hOGG1/2, Ref1, XPC, and p63 genes, and both exhibit a hypermutable phenotype. Since these two cell lines were derived from different patients with T3 and T4 stage MIBC (Rigby and Franks, 1970; O’Toole et al., 1972; Rasheed et al., 1977), it is unlikely these molecular features were obtained during prolonged in vitro culture conditions. Instead, it is more likely that they are the molecular traits of human MIBC. It should be noted that a third MIBC cell line, J82, also exhibits deficient p63 expression, and deficiency in NER and BER as with T24 and HT1197 cells (Figures 1D, E, F ,, 2A), and that a second NMIBC RT112/84 cell line has high DNA repair capacity similar to that found in RT4 cells (Figure 1—figure supplement 1). We found that while stage Ta NMIBC tissues are proficient in NER and BER, stage T3 and T4 MIBC tissues are deficient in both. Based on these results we reached the following six conclusions: (1) MIBC cells are hypermutable, whereas NMIBC cells are not; (2) MIBC cells are deficient in NER and BER, whereas NMIBC cells are hyperactive in NER and BER; (3) the hypermutable phenotype of MIBC cells is the result of a deficiency in DNA repair; (4) TAp63γ is suppressed in MIBC cells and highly expressed in NMIBC cells; (5) TAp63γ upregulates XPC, Ref1, hOGG1/2, and possibly other repair genes, and consequently regulates the NER and BER activity; BC cells with down-regulated TAp63γ are deficient in NER and BER and are hypermutable; and (6) TAp63γ plays a major role in MIBC development via both DNA-repair-activity-dependent and independent mechanisms.
Figure 1—figure supplement 1.

NMIBC RT112/84 cells are hyperactive in nucleotide excision repair (NER) and base excision repair (BER).

The NER and BER activities in cell lysates were determined the same as in Figures 1 and 2.

It is well established that XPC is essential for repair of bulky DNA damage, and that hOGG1/2 and Ref1 are the major enzymes for repair of 8-oxo-dGs and abasic sites in genomic DNA, therefore suppression of these three DNA repair genes is sufficient to enhance both bulky DNA adducts and ODD-induced mutagenesis (David et al., 2007). We found that the expression of TAp63γ in MIBC not only restores the DNA repair capacity but also greatly reduces DNA-damage-induced mutations (Figure 2C and D). Furthermore, suppression of TAp63γ in NMIBC cells not only reduces DNA repair capacity, it also greatly enhances DNA-damage-induced mutations (Figure 2E and F). These results lead us to conclude that the hypermutable phenotype of MIBC cells is the result of a deficiency in DNA repair of these cells, which is due to suppression of TAp63γ, and that the non-mutator phenotype of NMIBC cells is due to the hyperactive DNA repair functions. Our results show that XPA is expressed in both NMIBC (RT4) and MIBC (T24 and HT1197) cells and that neither forced TAp63γ expression in MIBC cells nor knockdown TAp63g expression in NMIBC cells affects the XPA expression in these cells (Figure 2). These results indicate that XPA expression is not regulated by TAp63γ. Similar results were also reported by Liu et al., 2012. However, our results show that the levels of both XPA and TAp63 in bladder tumors isolated from T3/T4 patients are relatively low compared to those in T1/T2 and Ta patients. These results raise the possibility that XPA was downregulated at the late stage of MIBC development, however, the mechanism is unclear. p63 expression is essential for the normal development of bladder tissue (Cheng et al., 2006; Yang et al., 1999; Karni-Schmidt et al., 2011). In mouse models it has been found that p63 knockout is developmentally lethal and that only one layer of bladder tissue is developed in these mice (Yang et al., 1999). In the human bladder, p63 is expressed in three layers of urothelial cells but not in the outer layer of urothelial cells (Ho et al., 2012). Consistent with these results, we found that p63 is not expressed in normal human urothelial mucosa (NHUM) which also is deficient in DNA repair (Figure 3—figure supplement 1). However, we found that most BC tumor tissues we examined show some degree of p63 expression, with T3/T4 BC tissues expressing less than T1/T2 BC tissues and Ta BC tissues expressing higher p63 than T1/T2 BC tissues. The p63 expression in these BC tissues shows a positive relationship with DNA repair activity in that Ta BC tissues have higher repair capacities than T1/T2 BC tissues and T3/T4 BC tissues have lowest DNA repair capacity (Figure 5). These results raise an intriguing question: which layers of urothelial cells give rise to bladder tumors, the outer layer of urothelial cells, which lack p63 expression and DNA repair activity or the basal layer urothelial cells, which have both? We propose that NMIBC is derived from urothelial cells which have TAp63γ expression and are proficient in DNA repair and that MIBC is derived from urothelial cells which have TAp63γ suppressed and a lack of DNA repair (Van Batavia et al., 2014).
Figure 3—figure supplement 1.

Determination of DNA repair capacity and p63 protein levels in normal human urothelial mucosa.

Human bladder tumor tissues (BTT, stage Ta, T1 and T3/4, n = 4) and normal human urothelial mucosa (NHUM, n = 9) were obtained as described in text. The DNA repair capacity (A) and the repair proteins XPC, hOGG1/2 and Ref1, and p63 (B) were detected the same as in Figure 5. Note: RT4 cells are derived from NMIBC.

Our results also raise the additional important questions regarding what mechanisms control TAp63γ expression in BC cells and how do bladder carcinogens affect these mechanisms? We found that expression of TAp63γ in MIBC and NMIBC cells is associated with H3K4me3, H3K9me2, and H3K27me3 markers (Figure 1 and Figure 3—figure supplement 2). It has been found that the p63 gene is rarely mutated in human cancer (Cancer Genome Atlas Research Network, 2014). These results suggest the possibility that TAp63γ expression is regulated epigenetically rather than by mutations, and that suppression of TAp63γ in BC cells is a gradual process rather than an all-or-none process (Figure 5C and D). It also suggests that the level of TAp63γ expression determines the progression of this disease and that the late-stage BC cells are more mutable than the early-stage BC cells.
Figure 3—figure supplement 2.

The TAp63 promoter region in MIBC cells is rich in transcription silencing markers, H3K9me2 and H3K27me3, whereas this region in NMIBC cells is rich in transcription activating marker H3K4me3.

ChIP assays were performed with chromatin extracted from human bladder epithelial progenitor (HBEP) cells, MIBC (T24 and HT1197) cells and NMIBC (RT4) cells. Chromatin-associated DNA was probed by PCR using TAp63-specific primers. ChIP assays were also performed on input chromatin (positive control) and chromatin precipitated with non-specific IgG antibodies (negative control). (A) mRNA level of TAp63 in HBEP, NMIBC RT4 cells and MIBC T24, and HT1197 cells. (B) Results of CHIP assay using either antibody against activation marker H3K4me3 or silencing marker H3H9me2 or H3H27me3 followed by PCR reaction. (C) Quantification of histone methylation.

It has been well established that only 20 % of NMIBC develop into MIBC. While 50 % of the MIBC have p53 point mutations, NMIBC rarely have p53 point mutations (Nassar et al., 2019; Robertson et al., 2017; Cordon-Cardo et al., 1994; Spruck et al., 1994; Cancer Genome Atlas Research Network, 2014). These results indicate that p53 point mutations are crucial for MIBC development. We propose that the over expression of the p63 gene and hyperactive DNA repair in NMIBC cells may prevent the acquisition of p53 point mutations, thereby inhibiting the development of MIBC. We found that TAp63γ expression can restore DNA repair capacity and reduce DNA damage induced mutagenesis to levels equal to the levels in wild-type cells (Figures 2 and 3). However, TAp63γ overexpression or knockdown p53m alone in the MIBC cells cannot fully reduce the cell invasion to the level of NMIBC cells (Figure 4). These results indicate that the invasion phenotypes are controlled by multiple mechanisms and that the p63 pathway is two of them. If this is the case, then MIBC with stable TAp63γ transfectants and NMIBC cells with suppressed TAp63γ and stable p53m transfectants will be able to provide us with well-characterized research platforms to search the additional mechanisms for cell invasion other than those that involve the p63 and p53 pathways. Finally, the results showing that T1/T2 and T3/T4 BC cells are deficient in NER and BER, provide a strong rationale for exploiting DNA damaging agents as potential therapeutic agents for MIBC.

Materials and methods

Materials

XPA, XPC, hOGG1/2, p53, and p63 antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX), α-tubulin from Calbiochem (Billerica, MA), IgG antibodies from Amersham Biosciences (Pittsburgh, PA), T4 kinase, protease K, and RNase A from New England Biolabs (Ipswich, MA), α-32P-dATP from Perkin Elmer (Waltham, MA), and growth medium MEM and EMEM from Sigma and ATCC, respectively. Plasmids were prepared, as described (Wang et al., 2013).

Normal human urothelial mucosa and bladder tumor tissues

Normal human urothelial mucosa was obtained by excisional biopsy (n = 13) as previously described (Bouaoun et al., 2016). Bladder tumors of various grades and stages (n = 16) were obtained by surgical resection, and the tissue samples were immediately frozen at –80 °C.

Cells and cell culture

RT4, T24, J82, and HT1197 cells were purchased from ATCC, UROtsa from Thermo Fisher Scientific, RT112/84 from Sigma-Aldrich, and HBEP from CELLnTEC (Switzerland). All these cells and cell lines were validated to be free of mycoplasma and were authenticated by the vendors by short tandem repeat profiling at the time of purchase. All the cell lines were used within 6 months of purchase. HBEP cells were cultured in the CnT58 medium (CELLnTEC, Switzerland). UROtsa cells were grown as described (Rossi et al., 2001). Human bladder tumor cells, RT4 and T24, were grown in McCoy’s 5 A supplemented with 10 % FBS; HT1197 and J82 were grown in MEM supplemented with 10 % FBS; RT112/84 cells were grown in EMEM supplemented with 2 mM glutamine, 1 % non-essential amino acids and 10 % FBS.

Constructions of BC cells with different stable transfectants

Plasmid DNA constructs with CMV promoter controlled TAp63γ, TAp63α, and TAp63β were used to construct stable transfectants in BC cells (Liu et al., 2012). Stable TAp63γ and p53 knockdown BC cells were constructed using microRNA (for TAp63γ) and short hairpin (sh)RNA (for p53) (Chang, 2004).

DNA repair assays

Germicidal lamp with low pressure mercury which emits 254 nm (95%) as UVC source for irradiation of plasmid DNA and cultured human cells. T4 endonuclease V (T4 endo V) incision assay for UVC-induced CPD in genomic DNA and formamidopyrimidine glycosylase (Fpg) incision assay for 8-oxo-dG are the same as previously described (Wang et al., 2010; Arakawa et al., 2012). Host cell reactivation (HCR) and DNA-damage-dependent-repair synthesis were determined as described (Wang et al., 2013; Tang, 1996; Lee et al., 2014; Lee et al., 2018).

The supF mutation assay

DNA-damage-induced mutations in the supF gene in pSP189 plasmid were detected the same as previously described (Wang et al., 2013; Wang et al., 2012; Wang et al., 2009).

Reverse transcription-polymerase chain reaction and western blot assay

The methods for detection of TAp63γ TAp63β,TAp63α, XPA, XPC, hOGG1/2, and Ref1 at mRNA and protein levels were as previously described (Wang et al., 2012).

Cell motility assay

BC cell migration ability and invasion potential were assessed by using a Matrigel Invasion Chamber with Control Inserts and Matrigel Inserts following the vendor’s instruction (BD BioCoat Matrigel Invasion Chamber, Fisher Scientific). Cell motility activity was also examined by scratch-wound assay (Liang et al., 2007).

Chromatin immunoprecipitation (ChIP)

The ChIP assays were performed using EZ ChIP Chromatin Immunoprecipitation Kit (EMD Millipore, Darmstadt, Germany, 17–371) according to manufacturers’ instructions. Primers (5'–3') were TTTTAGCCTCCCGGCTTTAT and ACGAAACGCTGGATGTAAGG for TAp63.

Study approval

The acquisition of tissue from patients was reviewed and approved by the Institutional Review Board (IRB, #H10181) of the New York University Langone Medical Center and the School of Medicine BioRepository Center. Informed consents were for research and HIPAA authorization were obtained from patients for tissue collections. This study reveals the connection of p63 and DNA repair in bladder cancer, especially in invasive bladder cancer, which is an understudied area. Results of this study provide new insights into the invasive bladder cancer. This manuscript is of broad interest to the readers in the field of p63, DNA repair and bladder cancer. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Decision letter after peer review: Thank you for submitting your article "The role of TAp63g and p53 point mutations in regulating DNA repair, mutational susceptibility and invasion of bladder cancer cells" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Maureen Murphy as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Darel J Hunting (Reviewer #3). The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. Essential revisions: 1) The role and mechanism(s) of selective mutant p53 in migration and invasion in bladder cancer are characterized in this study, but the reviewers feel that the data presented do not fully support the conclusions. More specifically: two invasive bladder cancer cell lines studied here contain p53 mutations outside the DNA binding domain, and it is unclear whether these 2 mutant p53 proteins have GOF activity. It is also unclear whether the observation made from these 2 cell lines accurately reflects the role of mutant p53 in bladder cancer in general. Among the 3 hotspot mutant p53 (175, 248 and 273), only 248 exhibits a promoting effect on migration and invasion of bladder cancer cells, and this was tested only in 1 cell line with ectopic overexpression. The authors should provide additional experimental evidence with true GOF mutant alleles of p53. 2) The authors should examine the regulation of DNA repair by δ-N forms in bladder cancer cells or explain the rationale for examining TA isoforms only in this study. 3) The authors examined the effect of ectopic TAp63γ expression in invasive bladder cancer only (not in non-invasive bladder cancer) and TAp63 knockdown in non-invasive bladder cancer only (not in invasive bladder cancer). It is requested that the authors perform these experiments in both type of cells to compare whether there are difference between invasive and non-invasive bladder cancer cells or provide rationale for the current experiment design. 4) Please provide quantitation for migration, invasion, and wound healing experiments to increase the clarity, and provide error bars for the quantitative results. 5) The statement 'It should be noted that the level of p63 expression in NMIBC cells, is higher than in HBEP and that NMIBC cells have a higher repair activity than HBEP cells.' (line 164-165) is not supported by Figure 2A; please clarify. 6) Figure 3 shows that TAp63γ does not change XPA expression in bladder cancers. Therefore, the association of XPA and TAp63γ in bladder patient samples (Figure S3) may not be due to the direct regulation of XPA by TAp63. This should be addressed in the Discussion. 7) Please discuss and clarify the virtual absence of both NER and BER in the NMIBC cells. Is it because these cells are sickly and difficult to culture? These tumors should be extremely sensitive to DNA damaging agent, such as ionizing radiation. 8) The high levels of unmutated (WT) p53 expression in NMIBC cells should lead to cell cycle arrest and possibly apoptosis unless a downstream protein is mutated or altered in expression. It is requested that the authors test whether the p53 damage response pathway is functional in these cells. 9) Please discuss the potential role of low levels p63 in MIBC in double strand break repair. 10) The authors state that the NMIBC cells are hyperactive for DNA repair but they seem to be normal. Please tone down this conclusion or clarify it with data or examples from the literature. 11) Please explain why the two wavelengths of UV are used in the two assay in Figure 1. Reviewer #1: Figure 2A shows that all types of p63 isoforms are largely disappeared in invasive bladder cancer lines, indicating the down regulation of both TA and δ-N forms. It is suggested to examine the regulation of DNA repair by δ-N forms in these cells. Authors examined the effect of ectopic TAp63γ expression in invasive bladder cancer only (not in non-invasive bladder cancer) and TAp63 knockdown in non-invasive bladder cancer only (not in invasive bladder cancer). It is suggested to perform these experiments in both type of cells to compare whether there are difference between invasive and non-invasive bladder cancer cells. Figure 5 shows that in bladder cancer cell lines tested, only selective mutant p53 proteins exhibit the promoting effects on migration and invasion. The role of mutant p53 in migration and invasion in bladder cancer needs to be further characterized. Since the main topic of this study is the repair capacity in bladder cancer cell lines and the connection between p63 and DNA repair in bladder cancer cells, authors may consider remove this part of the study. Please provide quantitation for migration, invasion, and wound healing experiments to increase the clarity, and provide error bars for the quantitative results. Reviewer #2: In Figure 2A, the weak exposure of p63 (4A4) blot should be presented, in order to observe the expression difference of p63 between HBEP and RT4 cells. In Figure 3A, 3B and 3D, the authors should remove the XPA blots, otherwise, the authors would like to discuss in the main text. I suggest to remove the Figure 4A and Figure 5A. This study lacks mechanical analyses (DNA repair, gene expression etc.) to support the idea that mutant p53 plays a role here. In addition, the data from cell lines used in this study cannot support the main statement for these two figures. Reviewer #3: There are however three points which should be addressed in the Discussion: the virtual absence of both NER and BER in the NMIBC cells bothers me. I would expect these cells to be sickly and difficult to culture. In addition, these tumors should be extremely sensitive to DNA damaging agent, such as ionizing radiation. Secondly, the high levels of unmutated p53 expression in NMIBC cells should lead to cell cycle arrest and possibly apoptosis unless a downstream protein is mutated or underexpressed. It would have been good to know if the p53 damage response pathway was functional in these cells. However, this information is not essential to support the conclusions of this study. Finally, many cancer cell types have defects in double strand break repair. The low levels of p53 in MIBC cells should affect DSB repair. The authors could discuss this. Essential revisions: 1) The role and mechanism(s) of selective mutant p53 in migration and invasion in bladder cancer are characterized in this study, but the reviewers feel that the data presented do not fully support the conclusions. More specifically: two invasive bladder cancer cell lines studied here contain p53 mutations outside the DNA binding domain, and it is unclear whether these 2 mutant p53 proteins have GOF activity. It is also unclear whether the observation made from these 2 cell lines accurately reflects the role of mutant p53 in bladder cancer in general. Among the 3 hotspot mutant p53 (175, 248 and 273), only 248 exhibits a promoting effect on migration and invasion of bladder cancer cells, and this was tested only in 1 cell line with ectopic overexpression. The authors should provide additional experimental evidence with true GOF mutant alleles of p53. We agreed with reviewer’s critique that results presented in Figure 5 are lacking an assessment of the mechanistic role of p53 point mutation in BC invasion development, and that we do not have a convincing explanation of why p53m248 and p53m273 but not p53m175 can promote the invasive potential of the non-invasive bladder cancer cells RT4. More experiments are needed to propose that these mutant p53 proteins have “gain-of-function” in bladder cancer cells, which may take a major effort to achieve this goal. Therefore, we removed the results in Figure 5 and eliminated all statements on the “gain-of function” as reviewer suggested. Having said that we believe our results show direct relationship between p53 point mutations and bladder cancer invasion ability. Our results show that knockdown p53 in invasive BC cells, J82, T24 and HT1197 which carry p53 mutations in both alleles (J82, p53m271/p53m271), and one allele (T24, p53m126/in flame deletion, HT1197, p53m365/wt) reduces both migration and the invasion ability to 50%. These results indicate that factors other than p53m contribute to the invasion ability of these cells. It is well established that 50% of MIBC carry p53 point mutations with codons 248, 273, 280, 282 and 285 as mutation hotspots. In contrast, less than 10% of non-invasive bladder cancers carry p53 mutation. Since all three MIBC cells lines bear one or two alleles with p53 point mutation these results strongly suggest that mutated p53 proteins play an important role in the invasive property of these cancer cells. Our results shown in Figure 4 that knockdown of the p53 expression in T24, J82 and HT1197 can further reduce the invasiveness of these cancer cells significantly. The results from J82 cells are particularly strong, since both p53 alleles in J82 cells are mutated, and knockdown of the expression of the p53m271 reduces the invasion potential by 50%. We believe these results support the clinical findings that the mutated p53 protein may play important role in making bladder cancer invasive. 2) The authors should examine the regulation of DNA repair by δ-N forms in bladder cancer cells or explain the rationale for examining TA isoforms only in this study. There are two major reasons for examining the roles of TAp63 isoforms but not ΔNp63 isoforms in regulating DNA repair and cell invasion function in bladder cancer cells. First, we have found that no p63 expression, including all the TAp63 and ΔNp63 isoforms, at either the protein and mRNA level, were detected in the muscle invasive bladder cancer (MIBC) cells such as T24, HT1197 and J82 cells (Figure 2 and Supplementary S-Figure 2). On the other hand, the TAp isoforms are highly expressed in non-invasive bladder cells (NMIBC) RT4 at both mRNA and protein level (Figure 2 and Supplementary S-Figure 2). At protein level ΔNp63 isoforms were barely or not detectable in the NMIBC RT4 cells (Figure 2 and Supplementary S-Figure 2). It has been established that TAp63 isoforms have transcription activation function while ΔNp63 isoforms lack this function. Since we found that MIBC cells are deficient in NER and BER and have a suppressed expression of not only multiple DNA repair genes, such as XPC, hOGG1/2 and Ref1, but also TAP63γ. In contrast, both DNA repair genes and TAp63γ are highly expressed in NMIBC cells. These results raise the possibility the expression of these multiple repair genes requires transcription activation of TAp63γ. Second, it has been found that ΔNp63 isoforms do not function as transcription activation factor (lack of transcription activation domain) (Petitjean et al., carcinogenesis, 2008). It has been suggested that DNp63 isoforms function as inhibitors for TAp63 isoforms (via polymerization with monomeric TAp63?). Since at protein level ΔNp63 isoforms were not detectable in the MIBC, and were barely detectable or not detectable in NMIBC, these results strongly suggest that the deficient of DNA repair of MIBC has nothing to do with ΔNp63 function, and ΔNp63 isoforms may not play important role in both DNA repair and tumor invasion function. Our results confirm that both of these reasons are correct. Our results are both necessary and sufficient to demonstrate that TAp63g role in DNA repair and invasion. These are the reasons we focused our research on determining the function of TAp63. We believe the same rationales are shared by many researchers in this area. For example, Liu et al., found that TAp63γ upregulates NER (DNA repair, 2012). There are more than six TAp63 isoforms and six ΔNp63 isoforms have been identified in human cells. The results that MIBC cells are lacking expression of TAp63g and multiple DNA repair genes, and that while NMIBC cells lack ΔNp63 expression, they have abundant expression of TAp63γ and DNA repair genes, and that TAp63 isoforms have transcription activation function while ΔNp63 isoforms do not has led us to make a reasonable practical decision to test the role of major TAp63 isoforms including TAp63g rather than testing DNp63 isoforms in DNA repair function. 3) The authors examined the effect of ectopic TAp63γ expression in invasive bladder cancer only (not in non-invasive bladder cancer) and TAp63 knockdown in non-invasive bladder cancer only (not in invasive bladder cancer). It is requested that the authors perform these experiments in both type of cells to compare whether there are difference between invasive and non-invasive bladder cancer cells or provide rationale for the current experiment design. Our results show that MIBC cells are deficient in TAp63γ expression and repair, in contrast, NMIBC cells are repair proficient and have normal to hyper-expression of TAp63γ. To further find out the causative role of the expression of TAP63γ and the repair capacity in these two types of cells, we determined whether or not changing the expression of this isoform in MIBC and NMIBC would result in changing the repair capacity and invasion phenotypes. Our results in Figures 2-4 demonstrate that it is indeed the case. Namely, the TAp63γ expression is clearly related to the DNA repair capacity and invasion phenotypes of NMIBC and MIBC. The biochemistry results also clearly support the idea that TAp63γ regulates the DNA repair function (Figure 3). We believe these results are necessary and sufficient to support the hypothesis that TAp63γ regulates both repair and invasion function. Since MIBC cells are deficient in TAp63γ already, it is difficult to envision that further knocking down this gene expression (to reduce p63 expression in the cells which have zero p63 expression) will provide more information on the role of this gene in DNA repair and invasion. The same is true in the case of NMIBC, since TAp63γ is highly expressed in these cells and these cells are repair proficient and non-invasive, it is difficult to envision further forced TAp63γ expression would yield more information on the role repair and invasion. Therefore, we believe that further knocking down the TAP63γ in cells which are deficient in the expression of this gene, and forced expression of this gene in cells which are already proficient in its expression, will not render more information on the role of this protein in DNA repair and invasion function. 4) Please provide quantitation for migration, invasion, and wound healing experiments to increase the clarity, and provide error bars for the quantitative results. We added the quantification results with error bars on migration in addition to the invasion results in Figure 4 in the revised manuscript. The wound healing assay is a different approach to demonstrate the effect of TAp63γ on the migration ability of MIBC and NMIBC. We believe this method at best is semiquantitative. Furthermore, the results are consistent with the results obtained from the chamber migration method in which we have presented the proper quantified results. 5) The statement 'It should be noted that the level of p63 expression in NMIBC cells, is higher than in HBEP and that NMIBC cells have a higher repair activity than HBEP cells.' (line 164-165) is not supported by Figure 2A; please clarify. In the revised manuscript, we presented the results which show that the expression of p63 in NMIBC is higher than in HBEP (Figure 2A) and that NMIBC cells have a higher repair activity than HBEP cells (Figure 1 E and 1 F). 6) Figure 3 shows that TAp63γ does not change XPA expression in bladder cancers. Therefore, the association of XPA and TAp63γ in bladder patient samples (Figure S3) may not be due to the direct regulation of XPA by TAp63. This should be addressed in the Discussion. We agreed with the reviewer that the relationship between XPA expression in the different BC grades and stages and p63 expression is not as straightforward as in established cell lines. The causes are unclear. It is possible other factors may regulate XPA expression. Since we have examined only few cases, the relationship between XPA and p63, more examples are needed to further establish the relationship between XPA and p63 in human BC tumor. We addressed this issue in the Discussion in the revised manuscript as reviewer suggested. 7) Please discuss and clarify the virtual absence of both NER and BER in the NMIBC cells. Is it because these cells are sickly and difficult to culture? These tumors should be extremely sensitive to DNA damaging agent, such as ionizing radiation. NIMBC are proficient in both NER and BER. However, human bladder mucosa cells which are highly differentiated (95% of the expression of these cells are uroplakins) are deficient in both NER and BER (Supplementary S-Figure 4). We found that no DNA repair genes are expressed in these cells (Supplementary S-Figure 4). We have published these results (Lee et al., Oncotarget, 2015). However, in the established NMIBC and MIBC cells, which are derived from BC, and uroplakins are not expressed (Lee et al., Oncotarget, 2015). We found that while MIBC cells are deficient in NER and BER, NMIBC are proficient in both. Since MIBC cells are deficient in BER, we expect that these cells are sensitive to ionizing radiation as review suggested. However, determining the ionizing radiation induced cytotoxicity, which requires ionizing radiation sources is beyond the scope of this research. 8) The high levels of unmutated (WT) p53 expression in NMIBC cells should lead to cell cycle arrest and possibly apoptosis unless a downstream protein is mutated or altered in expression. It is requested that the authors test whether the p53 damage response pathway is functional in these cells. We found that the level of p53 expression in NMIBC is similar to, but not higher than the p53 expression in the primary cultured normal human bladder urothelial progenitors (HBEP), both carry wilt type of p53 gene (Figure 2A). We added this information in the revised manuscript (Figure 2A). These results, led us to assume that there is no a priori reason that p53 in the NMIBC would induce different p53 damage response, such as apoptosis and cell cycle effect, from normal bladder urothelial cells. In other words, we believe p53 gene function “normally” in NMIBC the same as in normal bladder urothelial cells. Therefore, we did not investigate whether or not the p53 in NMIBC cells (wild type with normal expression level as in primary cultured bladder urothelial cells) induces unusual DNA damage responses. 9) Please discuss the potential role of low levels p63 in MIBC in double strand break repair. The repair of DNA double strand break (DSB) mainly occurs via homologous DNA recombination and non-homologous end-to-end joint. The recognition and the process of DSB repair are independent from NER and BER, thus beyond the scope of our current focus. Since we do not have any relevant results on this aspect, we believe it would be highly speculative to discuss the role of p63 in DSB repair in this manuscript. However, we believe it is a distinct possibility that p63 may regulate genes that are involved in DSB repair. 10) The authors state that the NMIBC cells are hyperactive for DNA repair but they seem to be normal. Please tone down this conclusion or clarify it with data or examples from the literature. In the revised manuscript we present results which show that DNA repair capacity in NMIBC (RT4) is significantly higher than in primary cultured normal human bladder urothelial progenitor (HBEP) cells (100% vs 29-38%) in Figure 1E and 1F. 11) Please explain why the two wavelengths of UV are used in the two assay in Figure 1. Low mercury pressure germicidal lamp which emits 254 nm UVC (>95%) is the only UV source used for irradiation in all experiments. We added this statement in the revised manuscript. Reviewer #1: Figure 2A shows that all types of p63 isoforms are largely disappeared in invasive bladder cancer lines, indicating the down regulation of both TA and δ-N forms. It is suggested to examine the regulation of DNA repair by δ-N forms in these cells. There are two major reasons for examining the roles of TAp63 isoforms but not ΔNp63 isoforms in regulating DNA repair and cell invasion function in bladder cancer cells. First, we have found that no p63 expression, including all the TAp63 and ΔNp63 isoforms, at either the protein and mRNA level, were detected in the muscle invasive bladder cancer (MIBC) cells such as T24, HT1197 and J82 cells (Figure 2 and Supplementary S-Figure 2). On the other hand, the TAp isoforms are highly expressed in non-invasive bladder cells (NMIBC) RT4 at both mRNA and protein level (Figure 2 and Supplementary S-Figure 2). At protein level ΔNp63 isoforms were barely or not detectable in the NMIBC RT4 cells (Figure 2 and Supplementary S-Figure 2). It has been established that TAp63 isoforms have transcription activation function while ΔNp63 isoforms lack this function. Since we found that MIBC cells are deficient in NER and BER and have a suppressed expression of not only multiple DNA repair genes, such as XPC, hOGG1/2 and Ref1, but also TAP63γ. In contrast, both DNA repair genes and TAp63γ are highly expressed in NMIBC cells. These results raise the possibility the expression of these multiple repair genes requires transcription activation of TAp63γ. Second, it has been found that ΔNp63 isoforms do not function as transcription activation factor (lack of transcription activation domain) (Petitjean et al., carcinogenesis, 2008). It has been suggested that DNp63 isoforms function as inhibitors for TAp63 isoforms (via polymerization with monomeric TAp63?). Since at protein level ΔNp63 isoforms were not detectable in the MIBC, and were barely detectable or not detectable in NMIBC, these results strongly suggest that the deficient of DNA repair of MIBC has nothing to do with ΔNp63 function, and ΔNp63 isoforms may not play important role in both DNA repair and tumor invasion function. Our results confirm that both of these reasons are correct. Our results are both necessary and sufficient to demonstrate that TAp63g role in DNA repair and invasion. These are the reasons we focused our research on determining the function of TAp63. We believe the same rationales are shared by many researchers in this area. For example, Liu et al., found that TAp63γ upregulates NER (DNA repair, 2012). There are more than six TAp63 isoforms and six ΔNp63 isoforms have been identified in human cells. The results that MIBC cells are lacking expression of TAp63g and multiple DNA repair genes, and that while NMIBC cells lack ΔNp63 expression, they have abundant expression of TAp63γ and DNA repair genes, and that TAp63 isoforms have transcription activation function while ΔNp63 isoforms do not has led us to make a reasonable practical decision to test the role of major TAp63 isoforms including TAp63g rather than testing DNp63 isoforms in DNA repair function. Authors examined the effect of ectopic TAp63γ expression in invasive bladder cancer only (not in non-invasive bladder cancer) and TAp63 knockdown in non-invasive bladder cancer only (not in invasive bladder cancer). It is suggested to perform these experiments in both type of cells to compare whether there are difference between invasive and non-invasive bladder cancer cells. Our results show that MIBC cells are deficient in TAp63γ expression and repair, in contrast, NMIBC cells are repair proficient and have normal to hyper-expression of TAp63γ. To further find out the causative role of the expression of TAP63γ and the repair capacity in these two types of cells, we determined whether or not changing the expression of this isoform in MIBC and NMIBC would result in changing the repair capacity and invasion phenotypes. Our results in Figures 2-4 demonstrate that it is indeed the case. Namely, the TAp63γ expression is clearly related to the DNA repair capacity and invasion phenotypes of NMIBC and MIBC. The biochemistry results also clearly support the idea that TAp63γ regulates the DNA repair function (Figure 3). We believe these results are necessary and sufficient to support the hypothesis that TAp63γ regulates both repair and invasion function. Since MIBC cells are deficient in TAp63γ already, it is difficult to envision that further knocking down this gene expression (to reduce p63 expression in the cells which y have zero p63 expression) will provide more information on the role of this gene in DNA repair and invasion. The same is true in the case of NMIBC, since TAp63γ is highly expressed in these cells and these cells are repair proficient and non-invasive, it is difficult to envision further forced TAp63γ expression would yield more information on the role repair and invasion. Therefore, we believe that further knocking down the TAP63γ in cells which are deficient in the expression of this gene, and forced expression of this gene in cells which are already proficient in its expression, will not render more information on the role of this protein in DNA repair and invasion function. Figure 5 shows that in bladder cancer cell lines tested, only selective mutant p53 proteins exhibit the promoting effects on migration and invasion. The role of mutant p53 in migration and invasion in bladder cancer needs to be further characterized. Since the main topic of this study is the repair capacity in bladder cancer cell lines and the connection between p63 and DNA repair in bladder cancer cells, authors may consider remove this part of the study. We accepted the reviewer’s critique and suggestion. We removed the results of the selective mutant p53 proteins the promoting effects on migration and invasion and revised the text accordingly. Please provide quantitation for migration, invasion, and wound healing experiments to increase the clarity, and provide error bars for the quantitative results. We added the quantification results with error bars on migration in addition to the invasion results in Figure 4 in the revised manuscript. The wound healing results are to show the effect of TAp63g on the migration ability of MIBC using different approach. We believe this method at best is semiquantitative. Furthermore, the results are consistent with the results obtained from chamber migration method in which we have presented the proper quantified results. Reviewer #2: In Figure 2A, the weak exposure of p63 (4A4) blot should be presented, in order to observe the expression difference of p63 between HBEP and RT4 cells. We added the lighter exposure picture in Figure 2A as reviewer suggested in the revised manuscript. In Figure 3A, 3B and 3D, the authors should remove the XPA blots, otherwise, the authors would like to discuss in the main text. Our results show that XPA is expressed in the established NMIBC (RT4) and MIBC (T24 and HT1197) cells. Forced TAp63γ expression in MIBC cells does not affect the XPA expression and knockdown TAp63γ also does not affect XPA expression in NMIBC cells. These results indicate that XPA expression is not regulated by TAp63γ. Similar results were also reported by Liu et al., (DNA Repair, 2012). However, our results show that the levels of both XPA and TAp63 in bladder tumors isolated from T3/T4 patients are relatively low compared to those in T1/T2 and Ta patients. To establish the relationship between the XPA expression and the stage of bladder cancer we need to examine a lot more samples from more T3/T4 patients. We discussed this aspect in the revised manuscript (also suggested by Reviewer #3). I suggest to remove the Figure 4A and Figure 5A. This study lacks mechanical analyses (DNA repair, gene expression etc.) to support the idea that mutant p53 plays a role here. In addition, the data from cell lines used in this study cannot support the main statement for these two figures. We accepted reviewer’s critique and suggestion. We removed the results of the selective mutant p53 proteins the promoting effects on migration and invasion and revised the text accordingly. Reviewer #3: There are however three points which should be addressed in the Discussion: the virtual absence of both NER and BER in the NMIBC cells bothers me. I would expect these cells to be sickly and difficult to culture. In addition, these tumors should be extremely sensitive to DNA damaging agent, such as ionizing radiation. Secondly, the high levels of unmutated p53 expression in NMIBC cells should lead to cell cycle arrest and possibly apoptosis unless a downstream protein is mutated or underexpressed. It would have been good to know if the p53 damage response pathway was functional in these cells. However, this information is not essential to support the conclusions of this study. Finally, many cancer cell types have defects in double strand break repair. The low levels of p53 in MIBC cells should affect DSB repair. The authors could discuss this. NMIBC cells are NER and BER proficient. I believe the reviewer meant that MIBC cells are deficient in NER and BER. We agree with the reviewer that MIBC cells should be more sensitive than NMIBC to DNA damaging agents and discuss the possibility of using DNA damaging agents for therapeutic purpose for MIBC in the revised manuscript. It is well established that many genes, including NER and BER genes and p53, are part of DNA damage response network and that the response is DNA damaging agent dependent. We agreed with the reviewer that the information obtained from studying the DNA damaging response in MIBC versus NMIBC is not essential to support the conclusions of this study. Based on the pleiotropic functions of p53 we agreed with reviewer that MIBC and NMIBC may have different repair capacity for DSB. However, we do not have any relevant results on this aspect, we believe it would be highly speculative to discuss the role of p63 in DSB repair in this manuscript.
  59 in total

Review 1.  Normal and neoplastic urothelial stem cells: getting to the root of the problem.

Authors:  Philip Levy Ho; Antonina Kurtova; Keith Syson Chan
Journal:  Nat Rev Urol       Date:  2012-08-14       Impact factor: 14.432

Review 2.  Human cancers express mutator phenotypes: origin, consequences and targeting.

Authors:  Lawrence A Loeb
Journal:  Nat Rev Cancer       Date:  2011-05-19       Impact factor: 60.716

3.  Two molecular pathways to transitional cell carcinoma of the bladder.

Authors:  C H Spruck; P F Ohneseit; M Gonzalez-Zulueta; D Esrig; N Miyao; Y C Tsai; S P Lerner; C Schmütte; A S Yang; R Cote
Journal:  Cancer Res       Date:  1994-02-01       Impact factor: 12.701

4.  Effect of CpG methylation at different sequence context on acrolein- and BPDE-DNA binding and mutagenesis.

Authors:  Hsiang-Tsui Wang; Mao-wen Weng; Wen-chi Chen; Michael Yobin; Jishen Pan; Fung-Lung Chung; Xue-Ru Wu; William Rom; Moon-shong Tang
Journal:  Carcinogenesis       Date:  2012-10-06       Impact factor: 4.944

5.  Loss of p63 expression is associated with tumor progression in bladder cancer.

Authors:  Marshall J Urist; Charles J Di Como; Ming-Lan Lu; Elizabeth Charytonowicz; David Verbel; Christopher P Crum; Tan A Ince; Frank D McKeon; Carlos Cordon-Cardo
Journal:  Am J Pathol       Date:  2002-10       Impact factor: 4.307

6.  Properties of the six isoforms of p63: p53-like regulation in response to genotoxic stress and cross talk with DeltaNp73.

Authors:  A Petitjean; C Ruptier; V Tribollet; A Hautefeuille; F Chardon; C Cavard; A Puisieux; P Hainaut; C Caron de Fromentel
Journal:  Carcinogenesis       Date:  2007-11-28       Impact factor: 4.944

7.  The immortalized UROtsa cell line as a potential cell culture model of human urothelium.

Authors:  M R Rossi; J R Masters; S Park; J H Todd; S H Garrett; M A Sens; S Somji; J Nath; D A Sens
Journal:  Environ Health Perspect       Date:  2001-08       Impact factor: 9.031

8.  The UBC-40 Urothelial Bladder Cancer cell line index: a genomic resource for functional studies.

Authors:  Julie Earl; Daniel Rico; Enrique Carrillo-de-Santa-Pau; Benjamín Rodríguez-Santiago; Marinela Méndez-Pertuz; Herbert Auer; Gonzalo Gómez; Herbert Barton Grossman; David G Pisano; Wolfgang A Schulz; Luis A Pérez-Jurado; Alfredo Carrato; Dan Theodorescu; Stephen Chanock; Alfonso Valencia; Francisco X Real
Journal:  BMC Genomics       Date:  2015-05-22       Impact factor: 3.969

9.  p63 and p73 transcriptionally regulate genes involved in DNA repair.

Authors:  Yu-Li Lin; Shomit Sengupta; Katherine Gurdziel; George W Bell; Tyler Jacks; Elsa R Flores
Journal:  PLoS Genet       Date:  2009-10-09       Impact factor: 5.917

10.  p63 transcriptionally regulates the expression of matrix metallopeptidase 13.

Authors:  Ivana Celardo; Alexey Antonov; Ivano Amelio; Margherita Annicchiarico-Petruzzelli; Gerry Melino
Journal:  Oncotarget       Date:  2014-03-15
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.