Literature DB >> 34735550

The chromatin insulator CTCF regulates HPV18 transcript splicing and differentiation-dependent late gene expression.

Jack Ferguson1, Karen Campos-León1, Ieisha Pentland1, Joanne D Stockton2, Thomas Günther3, Andrew D Beggs1,2, Adam Grundhoff3, Sally Roberts1, Boris Noyvert1,4, Joanna L Parish1.   

Abstract

The ubiquitous host protein, CCCTC-binding factor (CTCF), is an essential regulator of cellular transcription and functions to maintain epigenetic boundaries, stabilise chromatin loops and regulate splicing of alternative exons. We have previously demonstrated that CTCF binds to the E2 open reading frame (ORF) of human papillomavirus (HPV) 18 and functions to repress viral oncogene expression in undifferentiated keratinocytes by co-ordinating an epigenetically repressed chromatin loop within HPV episomes. Keratinocyte differentiation disrupts CTCF-dependent chromatin looping of HPV18 episomes promoting induction of enhanced viral oncogene expression. To further characterise CTCF function in HPV transcription control we utilised direct, long-read Nanopore RNA-sequencing which provides information on the structure and abundance of full-length transcripts. Nanopore analysis of primary human keratinocytes containing HPV18 episomes before and after synchronous differentiation allowed quantification of viral transcript species, including the identification of low abundance novel transcripts. Comparison of transcripts produced in wild type HPV18 genome-containing cells to those identified in CTCF-binding deficient genome-containing cells identifies CTCF as a key regulator of differentiation-dependent late promoter activation, required for efficient E1^E4 and L1 protein expression. Furthermore, our data show that CTCF binding at the E2 ORF promotes usage of the downstream weak splice donor (SD) sites SD3165 and SD3284, to the dominant E4 splice acceptor site at nucleotide 3434. These findings demonstrate that in the HPV life cycle both early and late virus transcription programmes are facilitated by recruitment of CTCF to the E2 ORF.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34735550      PMCID: PMC8594839          DOI: 10.1371/journal.ppat.1010032

Source DB:  PubMed          Journal:  PLoS Pathog        ISSN: 1553-7366            Impact factor:   6.823


Introduction

Human papillomaviruses (HPVs) are a family of small, double-stranded DNA viruses that infect cutaneous and mucosal epithelia. Most HPV types cause benign epithelial hyperproliferation, which is usually resolved by host immune activation. However, persistent infection with a subset of HPV types (e.g., HPV16 and 18) is the cause of epithelial tumours including cervical and other anogenital cancers, and carcinoma of the oropharyngeal tract [1]. The viral genome is maintained and replicated in the cell nucleus as an extrachromosomal, chromatinised episome which allows the epigenetic regulation of viral transcription in an equivalent manner to host genes [2]. The regulation of HPV gene expression in differentiating epithelia is tightly regulated and is a key strategy in the maintenance of persistent infection. Several distinct transcriptional start sites (TSSs) have been identified including the major early and late promoters, the E8 promoter (PE8) and less well-defined TSSs around nucleotide 520 (P520) and 3000 (P3000). The relative activity of these promoters is dependent on the differentiation status of the host keratinocyte [3-5]. Establishment of HPV infection occurs in the undifferentiated basal keratinocytes of epithelia where viral genome copy number and transcription are maintained at low levels, presumably to prevent host immune activation. We and others have shown that the viral episome is maintained in an epigenetically repressed state in undifferentiated keratinocytes, characterised by low abundance of trimethylation of lysine 4 (H3K4Me3) and enrichment of trimethylation of lysine 27 (H3K27Me3) on histone H3, which attenuate viral gene expression [5, 6]. The host cell chromatin-organising and transcriptional insulation factor, CCCTC-binding factor (CTCF) is important in the maintenance of the epigenetic repression of the HPV genome through the stabilisation of a chromatin loop. CTCF binds to a conserved site in the E2 open reading frame (ORF) of HPV18 approximately 3,000 base pairs downstream of the viral transcriptional enhancer situated in the long control region (LCR) [7]. Although the major CTCF binding site and the viral enhancer are physically separated, we demonstrated that abrogation of CTCF binding resulted in inappropriate epigenetic activation of the HPV18 enhancer and early promoter (termed P102 in HPV18) and increased expression of the viral oncoproteins E6 and E7 (E6/E7) [6, 7]. CTCF physically associates with the transcriptional repressor Yin Yang 1 (YY1) [8] and we subsequently showed that CTCF-dependent epigenetic repression of the HPV18 episome was through interaction with YY1 bound at the viral LCR, such that CTCF and YY1 co-operate to stabilise an epigenetically repressed chromatin loop within the early gene region [6]. While the association of CTCF with the HPV18 episome is not significantly altered by keratinocyte differentiation, YY1 protein expression and binding to the HPV18 genome is dramatically reduced in differentiated keratinocytes leading to loss of CTCF-YY1 dependent chromatin loop stabilisation, although no differentiation-dependent changes in CTCF protein expression were observed [6]. This differentiation-dependent topological change in the HPV episome is coincident with epigenetic activation of the P102 promoter and increased expression of the HPV E6/E7 oncoproteins. Interestingly, HPV18 E7 protein has also been shown to physically associate with YY1. It is unclear whether this contributes to (de)regulation of HPV transcription but an E7-YY1 complex was shown to positively regulate expression of the host gene lnc-FANCI-2 which may have important implications in HPV-mediated carcinogenesis [9]. Activation of the major late promoter (termed P811 in HPV18) in part occurs through epigenetic derepression of the HPV episome upon keratinocyte differentiation [5, 6, 10] and reviewed in [11]. This restricts expression of the viral capsid proteins L1 and L2 to the upper compartment of infected epithelia, limiting their potential for host immune activation [4, 12, 13]. The late promoter also regulates expression of viral intermediate genes including E1, E2, E1^E4 and E5, which are important for viral genome amplification in the upper layers of the infected epithelia [14, 15]. The mechanisms underlying the differentiation-dependent epigenetic activation of late promoter activity are not clear, but it has been shown that the viral enhancer in the LCR is required for late promoter activation [16] and that differentiation-dependent enhancement of transcription elongation may play a key role in late promoter activation [17]. Further enhancing the complexity of HPV gene expression regulation, the polycistronic HPV mRNA is subject to extensive post-transcriptional splicing, which gives rise to an array of transcripts that each encode a distinct subset of full length, and/or fusion proteins. While studies have mapped the HPV18 transcriptome [18-20], the quantification of HPV promoter activity and the abundance of each mature transcript has not been reported. Cellular splicing factors are utilised and manipulated by the virus to co-ordinate differentiation dependent viral transcript splicing, including the serine-arginine rich (SR) proteins and heterogeneous ribonucleoproteins (hnRNPs) [20-22]. In addition to its functions in chromatin looping and epigenetic isolation, CTCF can play an important role in regulating alternative gene splicing, most likely through multiple mechanisms. In the host cell CD45 locus, CTCF binding within exon 5 promotes inclusion of upstream exons by creating a “roadblock” to pause RNA polymerase II progression, allowing more efficient recognition of weak exons by the splicing machinery [23]. It has also been shown that DNA methylation-dependent binding of CTCF within normally weak exons promotes inclusion during co-transcriptional splicing [24]. To support these findings, a significant enrichment of CTCF binding sites in close proximity to alternatively spliced exons has been reported [25]. However, CTCF binding at distant sites can also influence alternative exon usage through the stabilisation of intragenic chromatin loops [26]. Our early analysis of CTCF-dependent control of HPV18 transcript splicing indicated an important role for this factor in maintaining the complexity of splicing events [7] but the global effect of CTCF on HPV18 transcript processing was not analysed. Next generation sequencing (NGS) has revolutionised virology research by providing nucleotide resolution data on existing and emerging pathogens, prevalence, and evolution. However, conventional Illumina-based RNA sequencing (RNA-Seq) methods are limited in that information on the structure of full-length transcripts, including alternative splicing is sacrificed to preserve accuracy and read depth [27]. Direct, long-read Nanopore sequencing overcomes this limitation by providing quantitative data on the abundance of individual mRNA isoforms [28]. In this study, we use Nanopore sequencing to quantify the spectrum of HPV18 transcripts in HPV18 episome-containing primary human keratinocytes and to map differentiation-induced changes in promoter usage, splicing and transcript abundance. Furthermore, we characterise the global effect of CTCF binding to the HPV18 genome on transcript splicing and early and late promoter activity.

Methods

Ethical approval

The collection of neonatal foreskin tissue for the isolation of primary human foreskin keratinocytes (HFKs) for investigation of HPV biology was approved by Southampton and South West Hampshire Research Ethics Committee A (REC reference number 06/Q1702/45). Written consent was obtained from the parent/guardian. The study was approved by the University of Birmingham Ethical Review Committee (ERN 16–0540).

Cell culture, methylcellulose differentiation and organotypic raft culture

Normal primary HFKs from neonatal foreskin epithelia were transfected with recircularised HPV18 wild type (WT) or -ΔCTCF genomes and maintained on irradiated J2-3T3 fibroblasts in complete E medium [29] as previously described [7]. For methylcellulose-induced keratinocyte differentiation, 3 x106 HPV18 or ΔCTCF-HPV18 genome containing keratinocytes were suspended in E-media supplemented with 10% FBS and 1.5% methylcellulose and incubated at 37°C, 5% CO2 for 48 hrs. Cells were then harvested by centrifugation at 250 x g followed by washing with ice-cold PBS. Cells were then either suspended in medium containing 1% formaldehyde to cross-link for chromatin immunoprecipitation (ChIP) as described below, or DNA, RNA and protein was extracted from cell pellets as previously described [7]. Southern blotting was carried out as previously described [6]. Organotypic raft cultures were prepared as previously described [7]. Rafts were cultured for 14 days in E medium without epidermal growth factor to allow cellular stratification. Raft cultures were fixed in 3.7% formaldehyde and paraffin embedded and sectioned by Propath Ltd (Hereford, United Kingdom).

Antibodies

Anti-CTCF (61311) and anti-H4Ac (39925) antibodies was purchased from Active Motif and used at 5–8 μg/sample for ChIP alongside mouse anti-FLAG (M2; Sigma Aldrich) as a negative control. For immunofluorescence staining, HPV18 L1 (5A3) antibody was purchased from Nova Costra (used at 1:100) and rabbit polyclonal E1^E4 antisera (1:5000), were produced as previously described [30]. Alexa-488 and –594 conjugated anti-rabbit/mouse secondary antibodies (Invitrogen) were used at 1:1000. For Western blotting, anti-GAPDH (6C5; 1:5000) was purchased from Santa Cruz. HPV18-specific antibodies were as follows: mouse E1^E4 (1D11; 1:10 [30]), E6 was purchased from Santa Cruz (G-7; 1:50), E7 was purchased from Abcam (8E2; 1:100) and sheep anti-E2 antisera (1:1000) were produced as previously described [31]. Involucrin antibody (SY5) was purchased from Sigma Aldrich and used at 1:1000. HRP-conjugated anti-mouse and anti-rabbit secondary antibodies (Jackson Laboratories) were used 1:5000.

Chromatin immunoprecipitation-qPCR (ChIP-qPCR)

ChIP-qPCR assays were performed using the ChIP-IT Express Kit (Active Motif) as per the manufacturer’s protocol. Briefly, cells were fixed in 1% formaldehyde for 5 mins at room temperature with gentle rocking, quenched in 0.25 M glycine and washed with ice-cold PBS. Nuclei were released using a Dounce homogeniser. Chromatin shearing was carried out by sonication at 25% amplitude for 30 secs on/30 secs off for a total time of 15 mins using a Sonics Vibracell sonicator fitted with a microprobe. ChIP efficiency was assessed by qPCR using SensiMix SYBR master mix using a Stratagene Mx3005P (Agilent Technologies, Santa Clara, CA, USA). Primer sequences for ChIP experiments are shown in Table 1. Cycle threshold (CT) values were used to calculate fold enrichment compared to a negative control FLAG antibody with the following formula:
Table 1

Primer sequences used for ChIP-qPCR experiments. Ta, annealing temperature; bp, base pairs.

Primer pair (amplicon mid-point)Amplicon length (bp)Forward (5’– 3’)Reverse (5’– 3’)Ta (°C)
4539198GGGGTCGTACAGGGTACATTGATGTTATATCAAACCCAGACGTG56
5479196TCTGCCTCTTCCTATAGTAATGTAACGGGAATAAAATAATATAATGGCCACAAA56
5753195CCTCCTTCTGTGGCAAGAGTGGTCAGGTAACTGCACCCTAA56
6746175AGTCTCCTGTACCTGGGCAAAACACCAAAGTTCCAATCCTCT58
7363123GTGTGTTATGTGGTTGCGCCGGATGCTGTAAGGTGTGCAG58
779699ACTTTCATGTCCAACATTCTGTCTATGTGCTGCCCAACCTATTT56
224140TGTGCACGGAACTGAACACTCAGCATGCGGTATACTGTCTC58
819136CGAACCACAACGTCACACAATACGGACACACAAAGGACAGG58
141870GCAATGTATGTAGTGGCGGCTACACTGCTGTTGTTGCCCT58
2884131TGCAGACACCGAAGGAAACCCATTTTCCCAACGTATTAGTTGCC58
3022191GGCAACTAATACGTTGGGAAAATGTCTTGCAGTGTCCAATCC56
3221113AGGTGGCCAAACAGTACAAGTGCCGTTTTGTCCCATGTTCC58
3478194TGGGAAGTACATTTTGGGAATAATCCACAGTGTCCAGGTCGT56
4029102TATGTGTGCTGCCATGTCCCCTGTGGCAGGGGACGTTATT56
Where ΔCT target = Input CT−Target CT and ΔCT IgG = Input CT−IgG CT. Each independent experiment was performed in technical triplicate and data shown are the mean and standard deviation of three independent repetitions.

ChIP-Seq

ChIP and respective input samples were used for generation of ChIP-Seq libraries as described [32]. Briefly, 2–10 ng DNA was used in conjunction with the NEXTflex Illumina ChIP-Seq library prep kit (Cat# 5143–02) as per the manufacturer’s protocol. Samples were sequenced on a HiSeq 2500 system (Illumina) using single read (1x50) flow cells. Sequencing data was aligned to the HPV18 genome (accession number: AY262282.1) using Bowtie [33] with standard settings and the -m1 option set to exclude multi mapping reads [34]. Alignment to human genome: Similar to HPV, CTCF and input ChIP-seq reads of two independent infections with either HPV18 or ΔCTCF-HPV18 were aligned to the human reference genome hg19 using Bowtie. Reads mapping to multiple host loci were excluded. CTCF peaks were called using MACS1.4 for the individual replicates using input material as background control. Peaks were stringently filtered and kept only if present in the two replicate samples of either wild type or mutant. Overlapping CTCF peak regions between wild type infection and infection with the mutant virus were detected by bedtools. Quantification, scatter plots for correlation analysis and visualization were performed in EaSeq (https://easeq.net/).

RNA sequencing and data analysis

For RNA-Seq, libraries were prepared using Tru-Seq Stranded mRNA Library Prep kit for NeoPrep (Illumina, San Diego, CA, USA) using 100ng total RNA input according to manufacturer’s instructions. Libraries were pooled and run as 75-cycle–pair end reads on a NextSeq 550 (Illumina) using a high-output flow cell. Sequencing reads were aligned to human (GRCh37) and HPV18 (AY262282.1) genomes with STAR aligner (v2.5.2b) [35]. The computations were performed on the CaStLeS infrastructure [36] at the University of Birmingham. Sashimi plots were generated in Integrative Genomics Viewer (IGV), Broad Institute (http://software.broadinstitute.org/software/igv/).

Nanopore direct RNA sequencing and data analysis

8x107 cells from undifferentiated or methylcellulose differentiated keratinocytes containing HPV18 (WT or ΔCTCF) samples for RNA extraction using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions and DNaseI treated (Promega). 500 ng of polyA+ RNA was used in conjunction with the direct RNA sequencing kit (Oxford Nanopore technologies, Oxford, UK [SQK-RNA002]). All protocol steps are as described in [37]. The reads were aligned to the human (GRCh37) and HPV18 (AY262282.1) genomes using minimap2 [38] with options “-ax splice -uf -k14” for nanopore direct RNA mapping. The splicing coordinates were extracted from the bam files using custom scripts. HPV18 transcripts were included in the dataset when a minimum threshold of three reads per million in at least two samples was achieved to ensure that each transcript was identified at least four times in multiple samples. Illumina and Nanopore data sets used in this study are available at the European Nucleotide Archive (http://www.ebi.ac.uk/ena/data/view/PRJEB47821).

Quantitative RT-PCR

cDNA was synthesised using Superscript III (Invitrogen) according to the manufacturer’s instructions. qPCR was performed using a Stratagene Mx3005P detection system with SyBr Green incorporation and the primers listed in Table 2.
Table 2

Primer sequences used for qRT-PCR experiments. Ta, annealing temperature; bp, base pairs.

Primer set nameAmplicon length (bp)Forward (5’– 3’)Reverse (5’– 3’)Ta (°C)
3165^3434129CTGCTTTAAAAAAGTACCAGTGAGCCGACGTCTGGCCGTAGGTCTTTGCGG60
3284^3434129CATGGGACAAAACTACCAGTGACGGCCGACGTCTGGCCGTAGGTCTTTGCGG60
E1^E4126GATCCAGAAATACCAGTGACGGCCGACGTCTGGCCGTAGGTCTTTGCGG60

Cell lysis and western blotting

Cells were lysed with urea lysis buffer (ULB; 8 M urea, 100 mM Tris-HCl, pH 7.4, 14 mM ß-mercaptoethanol, protease inhibitors) and protein concentration determined. Protein extracts from organotypic raft cultures were harvested using ULB and homogenised using a Dounce homogeniser contained with a category II biological safety cabinet. Lysates were incubated on ice for 20 mins before centrifugation at 16,000 x g for 20 mins at 4°C. Supernatant was transferred to a fresh tube and protein concentration assessed by Bradford Assay. For Western blotting, equal quantities of protein lysates were separated by SDS-PAGE and western blotting was carried out by conventional methods. Chemiluminescent detection was carried out using a Fusion FX Pro and densitometry performed with Fusion FX software.

Immunofluorescence

Immunofluorescence was carried out on paraffin embedded organotypic raft culture sections using the agitated low temperature epitope retrieval (ALTER) method as previously described [39]. Briefly, slides were sequentially immersed in Histoclear (Scientific Laboratory Supplies) and 100% IMS and incubated at 65°C in 1 mM EDTA (pH 8.0), 0.1% Tween 20 overnight with agitation. Slides were then blocked in PBS containing 20% heat-inactivated normal goat serum and 0.1% BSA (Merck). Primary antibodies were diluted in block solution and incubated overnight at 4°C followed by 3x PBS washes. Fluorophore-conjugated secondary antibodies were diluted in block buffer and added to slides which were incubated at 37°C for 1 hour. Slides were subsequently washed 4x 10 mins in PBS with Hoechst 33342 solution (10 μg/ml) added to the final PBS wash. Slides were mounted in Fluoroshield (Sigma-Aldrich) and visualised using a Nikon inverted Epifluorescent microscope fitted with a 40x oil objective. Images were captured using a Leica DC200 camera and software.

Results

We have previously characterised a CTCF binding site within the E2 open reading frame (ORF) of HPV18 which is strongly bound by CTCF in a primary HFK model of the HPV18 life cycle () [6, 7]. Although the E2-CTCF binding site was the most CTCF enriched region of the HPV18 genome in our ChIP-qPCR analysis, there did appear to be other regions of the viral genome that were bound at a lower level by CTCF. In addition, CTCF binding sites have been predicted in the late gene region of HPV18 and other high-risk HPV types and binding has been demonstrated in HPV31 episomes [7, 40]. To analyse CTCF binding to the HPV18 genome with greater sensitivity, we opted to map CTCF binding peaks using ChIP-sequencing (ChIP-Seq). Anti-CTCF immunoprecipitated chromatin harvested from HFKs harbouring HPV18 episomes was subject to Illumina next generation sequencing. Reads were aligned to the HPV18 genome revealing robust enrichment of CTCF in the E2 ORF with maximal binding between nucleotides 2960–3020, corresponding to the previously identified E2-CTCF binding site (). No other distinct CTCF peaks were observed in the HPV18 genome. In addition, ChIP-Seq analysis of CTCF enrichment in ΔCTCF-HPV18 genomes in which the E2-CTCF binding site was mutated to prevent CTCF binding by the introduction of three conservative nucleotide substitutions that did not alter the E2 protein sequence (; herein termed ΔCTCF-HPV18), revealed a complete loss of CTCF binding to the E2-ORF with no evidence of enhanced binding at secondary sites (), confirming our previous ChIP-qPCR analysis of this mutant virus. These findings were consistent in two independent HFK donors.

Abrogation of CTCF recruitment to the HPV18 E2 ORF alters early transcript splicing.

(A) Nucleotide sequence of the CTCF binding site identified in the E2 ORF (nucleotides 2988–3023; blue text). The primary and secondary CTCF binding sites are shown as detailed in [46]. Conservative nucleotide substitutions introduced in ΔCTCF-HPV18 mutant (red text) are shown in bold. The E2 protein sequence (black text) is unaltered. Graphical representation of the primary CTCF binding site motif was obtained from JASPER2018 (http://jaspar.genereg.net/). (B) Enrichment of CTCF in the HPV18 genome was assessed by ChIP-Seq in either HPV18 (blue) or ΔCTCF-HPV18 (red) genome-containing keratinocytes. Next generation sequencing data were visualised using IGV. The position of HPV18 ORFs, LCR and E2-CTCF binding site (blue oval) are indicated below the alignment profiles. (C) Exon-exon junctions in Illumina RNA-Seq data sets of either HPV18 (blue) or ΔCTCF-HPV18 (red) genome-containing keratinocytes were identified and quantified in IGV and represented in Sashimi plots. The co-ordinates of splice donor and acceptor sites and annotated ORFs are indicated. The number of reads at each exon-exon junction is indicated. *denotes splicing event identified in HPV18 but reduced or not detected in ΔCTCF-HPV18 genome containing cells. Having established that ΔCTCF-HPV18 episomes do not bind CTCF at the E2-ORF or any other secondary site(s), we sought to determine whether CTCF recruitment to HPV18 episomes altered the distribution of binding sites within the host genome. This was achieved by comparison of CTCF binding peaks within the cellular genome of HPV18 HFKs to ΔCTCF-HPV18 HFKs in two independent keratinocyte donors. The total number of CTCF binding peaks identified were 36,808 and 36,378 for HPV18 and ΔCTCF-HPV18, respectively () and this was consistent in an independent keratinocyte donor. Heatmap analysis of all CTCF peaks demonstrated no obvious difference in the distribution of CTCF binding in HPV18 compared the ΔCTCF-HPV18 (). These data provide evidence that sequestration of CTCF protein to HPV18 episomes per se does not affect CTCF function in the regulation of host cell gene expression. Our previous studies showed that abrogation of CTCF binding at the HPV18 E2 ORF resulted in increased transcriptional activity of the HPV18 early promoter (P102) and a concomitant increase in E6/E7 protein expression [6, 7]. These studies also revealed alterations in the splicing of early transcripts, indicated by a significant reduction in the abundance of transcripts spliced at 233^3434 upon amplification by semi-quantitative RT-PCR [7]. To confirm these findings and to further characterise CTCF-dependent regulation of HPV18 transcript splicing, we utilised high-depth Illumina RNA-Seq data in HPV18 and ΔCTCF-HPV18 transfected primary HFKs to quantify individual splicing events (). While there were a similar number of splicing events at 233^3434 in the HPV18 and ΔCTCF-HPV18 genome-containing cells (403 and 407 events, respectively), splicing at 233^416 was increased in ΔCTCF-HPV18 genome containing cells in comparison to wild type (28,918 events compared to 16,557 events respectively, Fisher’s test p-value <0.00001), which could account for the observed relative reduction in amplification of transcripts spliced at 233^3434 by qRT-PCR [7]. Interestingly, we also noted a reduction in splicing at 3284^3434, previously proposed to encode a truncated form of the E2 protein, E2C and a complete loss of splicing at 3165^3434 in ΔCTCF-HPV18 genome containing cells compared to wild type HPV18. Found at relatively low abundance, splicing at 3165^3434 has been previously described and predicted to encode a novel E2^E4 fusion protein termed E2^E4L [41]. Similarly, splicing at 2853^3434 has been proposed to encode a shorter form of E2^E4 fusion protein, E2^E4S [41], however, this splice was not detected in our Illumina RNA-Seq data. These findings suggest that CTCF may play a role in controlling acceptor site usage downstream of the E2-CTCF binding site. While individual splicing events can be quantified using conventional short-read RNA sequencing methods, the evaluation of the structure of individual transcripts and the multiple splicing events that occur within a single transcript is not possible. To fully characterise and, for the first time, quantify the relative abundance of individual HPV18 transcripts in primary HFKs, purified and polyA+ enriched RNA was analysed by direct long-read Nanopore sequencing. Cells were either grown in monolayer culture on feeder cells (undifferentiated) or embedded in semi-solid methylcellulose containing medium for 48 hours, to induce synchronous differentiation. Previous analysis has demonstrated that ΔCTCF-HPV18 episomes are maintained at similar copy number to wild type HPV18 in undifferentiated keratinocytes [6, 7]. Differentiation of keratinocytes induces amplification of HPV18 episomes, which was confirmed by Southern blotting in both HPV18 and ΔCTCF-HPV18 genome-containing HFKs () and this was consistent in an independent keratinocyte donor (). To ensure induction of cellular markers of differentiation, host transcripts were quantified and normalised as reads per million (RPM) for each sample. Principal component analysis (PCA) showed very little variance in host cell gene expression between HPV18 and ΔCTCF-HPV18 before and after differentiation, but clear separation in principal component 1 upon differentiation of both cell populations (). Induction of a cellular marker of keratinocyte differentiation, involucrin (IVL) was observed in HPV18 ( Fisher’s test p-value < 0.00001) and ΔCTCF-HPV18 HFKs (). In addition, an alteration in expression and transcript splicing of the keratinocyte-specific extracellular matrix protein, ECM1, upon keratinocyte differentiation has been reported [42]. Undifferentiated keratinocytes express full length ECM1 transcript 2 but expression of a shorter, alternatively spliced transcript (transcript 3) is induced upon keratinocyte differentiation. Analysis of ECM1 transcripts in our Nanopore sequencing data demonstrated the appearance of ECM1 transcript 3 which lacks exon 7 in methylcellulose differentiated keratinocytes only (Figs ). Furthermore, gene set enrichment analysis of host cell gene expression changes induced by synchronous differentiation of both HPV18 and ΔCTCF-HPV18 genome-containing cells revealed a significant enrichment of biological processes including keratinocyte differentiation and epithelial cell differentiation (), with broadly consistent alteration of genes involved in keratinocyte differentiation in both HPV18 and ΔCTCF-HPV18 HFKs ().

Analysis of differentiation-dependent host cell gene expression and HPV transcriptional start site usage.

HPV18-HFK were synchronously differentiated in methylcellulose for 48 hrs. (A) Amplification of HPV18 and ΔCTCF-HPV18 episomes was detected by Southern blotting following digestion with EcoRI to linearise the HPV18 episomes, or BglII which digests cellular DNA only (OC, open circle; L, linear; SC, supercoiled). (B-D) Host and viral transcriptomes in undifferentiated (blue) and differentiated (green) HPV18-HFK were analysed by long read Nanopore RNA-Seq, demonstrating enhanced involucrin (IVL) expression following keratinocyte differentiation (B) and enhanced ECM1 expression combined with differentiation-induced exon 7 skipping in transcript variant 3; exon numbering and transcript variants are indicated to the right and below the ECM1 gene annotation. (D) Clustered HPV18 promoter usage in undifferentiated and differentiated keratinocytes showing differentiation-dependent alteration of the major early (P102) and major late (P811) promoter usage. ****p < 0.0001 (Fisher’s test). Virus host fusion transcripts were identified at very low abundance (<2% of total HPV reads), indicative of low-level viral integration, with no obvious differences in the spectrum of integration sites identified in HPV18 or ΔCTCF-HPV18 HFKs (, and ). Nonetheless, these fusion transcripts were removed from our data set prior to analysis to include only those transcripts derived from HPV episomes. Data were then normalised to the total number of reads in each sample to calculate RPM of each viral transcript species. In agreement with previous reports [18, 19], five clear groupings of transcriptional start regions were identified in undifferentiated HPV18 genome containing cells, which originated between nucleotides 1–350 (P102), 351–700 (P520), 701–900 (P811), 1000–1400 (P1193) and 2800–4000 (P3000) () at previously described transcriptional promoters [18, 19], which were used to define transcript species in subsequent quantifications. Keratinocyte differentiation resulted in a significant change in promoter usage characterised by activation of the P811 major late promoter (). In undifferentiated HPV18 genome-containing cells, the most abundant transcript was initiated at the P102 promoter and spliced at 233^416–929^3434 (transcript 3; ). This transcript has the potential to encode E6*I, E7, E1^E4 and E5. Several novel transcripts were identified above our inclusion threshold of at least three individual reads in at least two samples including transcripts 10 and 22, which have the potential to encode E6*I, E7 and E5. Although these transcripts have not been previously described, the specific splicing combination only includes previously annotated splice sites, but in a previously undetected combination. As they are low abundance, these transcripts are unlikely to be of major biological significance. Interestingly, splicing at both 3165^3434 and 3284^3434 was observed in undifferentiated and differentiated HPV18 cells (transcripts 8 and 9; ). However, these transcripts originated from the P3000 promoter and therefore lack the E2 start codon at nt2816 and more likely encode E5 in the basal keratinocytes rather than E2^E4 fusion proteins as previously suggested [41].

Quantitative analysis of the HPV18 transcriptome in undifferentiated and differentiated keratinocytes and alterations induced by abrogation of CTCF binding.

Alignment of Nanopore direct RNA sequencing data to the HPV18 genome facilitated the characterisation of all HPV-specific transcripts. Transcripts were included in the data set if they were represented by three or more individual reads in at least two samples. The relative abundance of each transcript type was calculated in reads per million (RPM) of the total reads in each sample. Relative abundance (RPM) of each transcript is shown for HPV18 (blue) and ΔCTCF-HPV18 (red) genome-containing cells in undifferentiated keratinocytes (left) and for HPV18 (green) and ΔCTCF-HPV18 (purple) in differentiated keratinocytes (right). Splice donor (blue) and acceptor (green) sites are indicated above the transcript map and HPV18 ORFs encoded by each transcript are shown. *denotes transcripts that have previously been identified [18, 19]. Comparison of viral transcripts in HPV18 and HPV18-ΔCTCF genome-containing cells revealed a significant increase in abundance of the major early transcript 3, which encodes E6*I, E7, E1^E4 and E5 (, Fisher’s test p-value < 0.00001). A more modest increase in the second most abundant transcript in undifferentiated cells, originating from the P102 promoter and spliced at 929^3434 was also observed, which has the potential to encode full length E6 as well as E7, E1^E4 and E5 (transcript 4; , Fisher’s test, non-significant). The increased abundance of these major early viral transcripts corroborates the previously observed increase in E6 and E7 protein expression when CTCF binding site is ablated [6, 7]. Transcripts spliced at 929^3440 (transcripts 10, 11 and 12) were also detected at low abundance. Notably, splicing at both 3165^3434 and 3284^3434 (transcripts 8 and 9; ) was significantly reduced in undifferentiated and differentiated HPV18-ΔCTCF genome containing cells compared to HPV18 (Fisher’s test p-value < 0.00001 and 0.01, respectively) corroborating our finding in Illumina RNA-Seq datasets that CTCF may function to enhance the activity of downstream weak SD sites in the HPV18 genome. The reduction in splicing at 3165^3434 and 3284^3434 was validated by qRT-PCR using primers specific to these splice events. A significant reduction in 3165^3434 spliced transcripts was observed in undifferentiated and differentiated ΔCTCF-HPV18 episome containing cells in comparison to wild type and this was consistent in two independent HFK donors (). Similarly, splicing at 3284^3434 was reduced in ΔCTCF-HPV18 episomes. Although this reduction did not reach significance in undifferentiated HFK donor 1, the reduction was significant in donor 2 and in both donors following differentiation (). Together, these data show that abrogation of CTCF binding within the E2 ORF of HPV18 results in reduced splicing between the downstream weak splice donor sites SD3165 and SD3284 and the dominant spice acceptor site SA3434.

Loss of CTCF binding at the E2-ORF of HPV18 causes reduced downstream transcript splicing.

Splicing at (A) 3165^3434 and (B) 3284^3434 was assessed by qRT-PCR in two independent keratinocyte donors cultured in monolayer (undifferentiated; red) and in methylcellulose for 48 hrs (differentiated; purple). Data shown are the mean and standard error of transcript abundance normalised to β-actin and expressed and fold expression (2-ΔΔCT) compared to donor matched HPV18 episome containing cells. Transcripts that originate from the P811 late promoter were abundantly expressed in undifferentiated cells; transcripts originating from this promoter and spliced at 929^3434 to encode E1^E4 and E5 proteins (transcript 6; ) were the second most abundant transcript in undifferentiated cells. As expected, the abundance of this transcript was dramatically increased around 50-fold (Fisher’s test p-value < 0.00001) upon differentiation of HPV18 cells in methylcellulose. However, while differentiation of HPV18-ΔCTCF genome-containing cells similarly resulted in an increase in abundance of this major E1^E4 encoding transcript, the overall abundance of this transcript was reduced by around 50% compared to HPV18. It is also interesting to note that transcripts encoding the L1/L2 capsid proteins (transcripts 25–28; ) were induced upon cellular differentiation in HPV18 genome-containing cells, albeit at a low level, but these transcripts were all lower in abundance in HPV18-ΔCTCF cells. These data suggest that recruitment of CTCF to the HPV18 genome at the E2-ORF may be important for differentiation-dependent activation of the viral late promoter. The major transcriptional promoters in the HPV18 genome have been previously mapped using 5’ RACE [18]. Although transcript sequencing by Nanopore does not provide nucleotide resolution accuracy in mapping transcription start sites [43], the clustering of the 5’ end of viral transcripts was clearly enriched at the previously annotated viral promoters (). Therefore, to characterise the differential activity of the major viral promoters in HPV18 and ΔCTCF-HPV18 cells, the 5’ end of each viral read in our Nanopore datasets was mapped and quantified. The 5’ end of most transcripts (>90%) mapped in the region of three previously described promoters; P102, P811 and P3000 (). Interestingly, the 5’ end of transcripts that originated from both the P102 and P811 promoters clustered as a sharp peak at the previously annotated transcriptional start site whereas the 5’ end of transcripts originating from the P3000 promoter were more broadly distributed (). As expected, the P102 promoter was the most active promoter in undifferentiated HPV18 genome-containing cells with very few transcripts originating from the P811 late promoter. Differentiation of these cells resulted in a dramatic increase in transcripts originating from the P811 promoter (Fisher’s test p-value < 0.00001), coincident with a slight increase in P102 activity (Fisher’s test p-value < 0.00001) (). Transcripts originating from the P102 promoter were ~30% more abundant in HPV18-ΔCTCF genome containing cells than HPV18, which was further activated upon cellular differentiation confirming enhanced activity of the early promoter in the absence of CTCF recruitment. Interestingly, the activity of the P811 late promoter was notably lower in differentiated ΔCTCF-HPV18 genome containing cells compared to HPV18 (Fisher’s test p-value < 0.00001), providing evidence that the activity of the late promoter in differentiated cells is attenuated when CTCF recruitment is abrogated. Very few transcripts originated from P3000 in undifferentiated cells, however this promoter was strongly activated following cellular differentiation in HPV18 genome containing cells. As was observed at P811, differentiation-dependent activation of P3000 was reduced in ΔCTCF-HPV18 genome containing cells compared to HPV18. The PE8 (P1193) and P520 promoters were only weakly active with less than 10% of transcripts originating at these promoters in undifferentiated cells and the activity of these promoters was not altered by keratinocyte differentiation or mutation of the E2-CTCF binding site.

Quantitative analysis of transcription start site usage in undifferentiated and differentiated keratinocytes and CTCF-dependent regulation of promoter activity.

The 5’ end of each HPV18 transcript was identified in Nanopore RNA sequencing data sets and relative abundance calculated as reads per million (RPM). Total counts at each nucleotide position were binned into 10 (A and B) or 100 (D) nucleotide regions in the data shown. Transcripts originating around the P102 (A), P811 (B) and P3000 (C) promoters were identified in HPV18 and ΔCTCF-HPV18 cells in undifferentiated (blue and red, respectively) and methylcellulose differentiated (green and purple, respectively) cultures. Relevant HPV18 genome features are shown alongside each panel. The E2-CTCF binding site is indicated by a blue oval. Analysis of promoter usage in the bulk population of viral transcripts revealed that while there was a greater proportion of transcripts which initiated from the P102 early promoter in ΔCTCF-HPV18 episomes than HPV18 (indicated by tighter density grouping and increased slope of the violin plot kernel), this did not reach significance (p = 0.16) (). In contrast, highly significant differences were observed between promoter usage in ΔCTCF-HPV18 episomes compared to HPV18 following keratinocyte differentiation (p < 1E-16). While in HPV18 cells, the promoter usage density was highly enriched at the P811 promoter, transcripts in ΔCTCF-HPV18 genome-containing cells were less abundant at the P811 promoter, and the P102 promoter was proportionately more active than in HPV18 episomes (). These analyses demonstrate that differentiation-dependent stimulation of P811 major late promoter activity is facilitated by recruitment of CTCF to the E2 ORF.

CTCF regulates efficient differentiation-dependent HPV18 late promoter activation.

The 5’ end of each viral transcript was identified and the distribution shown in violin plots in (A) undifferentiated and (B) differentiated keratinocytes containing HPV18 (blue and green, respectively) and ΔCTCF-HPV18 (red and purple, respectively) episomes. Data distribution are shown by the kernel shape and median indicated with a vertical solid line. The widest sections of each violin plot indicates the highest probability of promoter usage within that region of the HPV18 genome. The shape of the distribution indicates the concentration of data points in a particular region; the steeper the side of each bubble indicates a greater concentration of data points. ns, non significant; ****p<0.0001 (Fisher’s test). To determine whether the reduced differentiation-dependent activation of P811 in ΔCTCF-HPV18 genomes resulted in reduced late protein expression, we analysed E1^E4 transcript and protein abundance in methylcellulose differentiated cultures. The reduction in E1^E4 transcript abundance in ΔCTCF-HPV18 in comparison to HPV18 following differentiation was validated in two independent keratinocyte donors by qRT-PCR (). Western blotting of lysates harvested from HPV18 and ΔCTCF-HPV18 genome containing cells before and after differentiation revealed an induction of involucrin protein expression. However, there was a significant attenuation of E1^E4 protein expression when CTCF binding to the viral genome was abrogated () and this was consistent in an independent keratinocyte donor (). Since L1 protein is not robustly expressed in methylcellulose differentiated keratinocytes, we analysed L1 protein expression by immunostaining organotypic raft culture sections derived from two independent donors of HPV18 and ΔCTCF-HPV18 genome containing cells. L1 positive cells were visible in the upper layers of HPV18 genome containing rafts but were barely detectable in ΔCTCF-HPV18 rafts and this difference was significant (). While the total number of E1^E4 positive cells in the upper layers of ΔCTCF-HPV18 rafts was not altered, the intensity of E1^E4 staining was notably reduced (). Western blot analysis of protein lysates harvested from three independent raft cultures confirmed a significant reduction in E1^E4 protein abundance in HPV18-ΔCTCF genome containing raft cultures in comparison to HPV18 (). Conversely, an increase in both E6 and E7 protein expression in raft lysates was observed () while expression of E2 protein was not altered (), as previously reported [7] and in agreement with our Illumina and Nanopore RNA-seq datasets.

Abrogation of CTCF binding to the HPV18 genome causes a significant reduction in differentiation-dependent late protein abundance.

(A) HPV18 genome containing keratinocytes (HPV18 or ΔCTCF-HPV18) grown in monolayer (undifferentiated, 0h) or differentiated in methylcellulose (48h) and E1^E4, involucrin (IVL) and GAPDH protein expression analysed by Western blotting. (B) Relative E1^E4 protein expression in comparison to GAPDH was quantified in three independent experiments by densitometry. Data are the mean +/- standard deviation. * denotes p<0.05. (C) E1^E4 (red) and L1 (green) protein abundance was analysed by indirect immunofluorescence in epithelia derived from HPV18 and ΔCTCF-HPV18 genome-containing keratinocytes grown in organotypic raft culture. Cellular nuclei are shown in blue, and the basal layer indicated with white arrows. Scale bar indicates 10 μm. (D) The total number of L1 positive cells per section of three independent raft cultures grown from two independent keratinocyte donors was counted. Data show the mean +/- standard deviation. *** p<0.001, **** p<0.0001. (E) E1^E4, E6 and E7, and (F) E2 protein expression in organotypic raft cultures was assessed by Western blotting lysates harvested from three independent raft cultures alongside GADPH loading control. Molecular weight markers are indicated on the left of Western blots (kDa). We previously demonstrated that in undifferentiated cells, ΔCTCF-HPV18 episomes had a higher abundance of trimethylation of lysine 4 in histone 3 (H3K4Me3) at the P102 early promoter compared to HPV18, correlating with increased promoter activity and early transcript abundance. Interestingly, while differentiation of HPV18 genome-containing cells resulted in a significant enrichment of H3K4Me3 at the P811 late promoter, no further enrichment above that observed in undifferentiated cells was observed in ΔCTCF-HPV18 episomes [6]. These data suggested that abrogation of CTCF binding resulted in an alternative epigenetic chromatin state of HPV18 episomes, driving enhanced early transcript production. However, we did not go any further to determine the impact of this altered chromatin state on late promoter activation and late gene transcription. To further understand the epigenetic changes that regulate promoter usage throughout the HPV18 life cycle, we opted to study the acetylation status of histone 4 (H4Ac), which is deposited downstream of H3K4Me3 and a hallmark of enhanced activation of transcription by facilitating increased chromatin accessibility and the recruitment of transcriptional activators [44]. H4Ac abundance in the viral genome in undifferentiated cells was detectable at low levels, consistent with restricted virus transcription (). Differentiation of the cells in methylcellulose resulted in a dramatic increase in H4Ac abundance throughout the HPV18 genome, with an over 10-fold enrichment upstream of the P811 late promoter, consistent with increased production of late transcripts. In contrast, H4Ac marks were barely detectable in ΔCTCF-HPV18 episomes in undifferentiated cells and only a small increase at the P811 following differentiation was observed (). However, it is important to note that H4Ac abundance at the P811 promoter of ΔCTCF-HPV18 episomes was above that observed in undifferentiated HPV18 episomes, indicating attenuation rather than complete loss of activation of the HPV late promoter. These findings correlate with reduced late transcript abundance in differentiated ΔCTCF-HPV18 episomes compared to wild type. Together, these findings suggest that CTCF recruitment to the E2-ORF is necessary for appropriate epigenetic programming of the viral chromatin and differentiation-dependent transcriptional activation of P811.

Keratinocyte differentiation induces increased H4Ac abundance at the HPV18 late promoter in wild type but not ΔCTCF-HPV18 genome-containing cells.

HPV18 and HPV18-ΔCTCF genome-containing primary keratinocytes grown in monolayer (undifferentiated; blue and green, respectively) or differentiated in methylcellulose-containing media for 48 hrs (green and purple, respectively). Enrichment of H4Ac was assessed by ChIP-qPCR. Each bar in the chart represents the mid-point for primer pairs used to amplify immunoprecipitated chromatin. Fold binding over IgG control was calculated. The data shown are the mean and standard deviation of three independent replicates. Annotation of the HPV18 LCR, promoters, ORFs and CTCF binding site (blue oval) is provided below.

Discussion

The differentiation-dependent regulation of papillomavirus transcription is fundamental to the productivity and persistence of infection. Previous studies have shown that the viral early (P102) promoter is active in basal keratinocytes and becomes further activated as the cells enter terminal differentiation [5, 6]. In contrast, the viral late promoter (P811) is repressed in undifferentiated basal cells and strongly activated upon induction of cellular differentiation [4, 5, 10, 17, 45]. In this study, we have utilised direct, long-read RNA sequencing to quantitatively analyse HPV18 promoter activity and to dissect the role of CTCF in regulating viral transcription at key stages of the virus life cycle. Our findings confirm the differentiation-dependent model of HPV transcription control; transcripts that originate from the P102 promoter are dominant in undifferentiated cells and further increased in abundance upon cellular differentiation. The abundance of transcripts originating from the P811 late promoter is low in undifferentiated cells but is dramatically upregulated when cells are differentiated. Transcription originating from the P520 and P3000 promoter regions is also activated by cellular differentiation but overall, these promoters are far less active than either the P102 or P811 promoters. The PE8 promoter is equally weak in both undifferentiated and differentiated cells with only two transcript species that originate from this promoter region. The most dominant transcript identified from the PE8 promoter was spliced at 1357^3434 and encodes E8^E2 and E5. The second transcript, spliced at 1357^3465 to encode E5 only, was slightly increased in expression in differentiated cell cultures. Transcripts that encode fusion products between the E2 and E4 ORFs (E2^E4) have been previously described [41]. These transcripts were reported to originate upstream of the E2 start codon at position 2816 in HPV18 and therefore encode a protein fusion between the N-terminus of E2 and the C-terminus of E4. E2^E4S encoding transcripts, spliced at 2853^3434, were not identified in any of our Nanopore or RNA-Seq datasets. We did however detect transcripts spliced at 3165^3434, which have been previously described to encode a fusion protein termed E2^E4L [41]. However, this transcript was detected at very low abundance (~1 RPM) and only in differentiated keratinocytes. Interestingly, most of the transcripts that originated from the P3000 promoter were also spliced at 3165^3434 or 3284^3434 (transcripts 8 and 9). These transcripts were in higher abundance than those originating from the P102 promoter in both undifferentiated and differentiated cells, but since they lack the E2 start codon, they are likely to encode E5 protein only. Supporting this hypothesis, splicing of transcripts originating from the P3000 promoter at 3165^3434 and 3284^3434 removes several intronic ATG start codons (7 and 11, respectively), potentially facilitating enhanced translation of E5. Comparison of the HPV18 transcript map between HPV18 and ΔCTCF-HPV18 genome-containing cells revealed several important phenotypes. Firstly, abrogation of CTCF binding resulted in enhanced production of transcripts originating from the P102 promoter, in agreement with our previous findings [6, 7]. The increased P102 activity resulted in an increase in transcripts spliced at 233^416–929^3434 (encoding E6*I, E7, E1^E4 and E5) and 929^3434, (encoding E6, E7, E1^E4 and E5) while there was a small decrease in transcripts spliced solely at 233^416 (encoding E6*I, E1, E7 and E2) and 233^3434 (the only known transcript to encode E6*II), confirming our previous observation that abrogation of CTCF binding to the HPV18 genome reduces the abundance of transcripts spliced at 233^3434 [7]. In addition, a marked decrease in transcripts spliced at 3165^3434 and 3284^3434 was observed in ΔCTCF-HPV18 genome containing cells in comparison to HPV18, confirming our initial analysis of HPV18 transcript splicing by conventional RNA-Seq and validated by qRT-PCR in two independent keratinocyte donors. These data indicate that CTCF plays a key role in splice donor choice when splicing to the dominant splice acceptor site at nucleotide 3434 in the HPV18 genome. A functional role for CTCF in influencing cellular co-transcriptional alternative splicing has been previously demonstrated. CTCF binding within or downstream of weak exons can promote exon inclusion by creating a roadblock to pause RNA polymerase II progression, allowing greater splicing efficiency [23-25]. Interestingly, CTCF-mediated chromatin loop stabilisation between gene promoter and exon regions also plays a key role in regulating alternative splicing events. Exons downstream of a CTCF stabilised promoter-exon loop are more likely to be included in the nascent mRNA, providing a functional link between three-dimensional chromatin organisation and splicing regulation [26]. Notably, we have previously shown that CTCF binding to the HPV18 E2 ORF stabilises a chromatin loop with the viral LCR [6]. This loop is positioned immediately upstream of weak slice donor sites at 3165 and 3284. Since CTCF binding loss results in decreased splicing at both 3165^3434 and 3284^3434 to produce E5 encoding transcripts, we hypothesise that CTCF chromatin loop formation plays an important role in HPV18 splice site choice. It also remains to be determined whether CTCF-directed splicing at the downstream SD sites is due to RNA polymerase II stalling via CTCF-mediated roadblock repression. As expected, cellular differentiation strongly induced P811 promoter activation in HPV18 episomes. However, ΔCTCF-HPV18 genome containing cells displayed a notable reduction in the abundance of transcripts originating from this promoter following differentiation. Differentiation dependent activation of the P3000 promoter was also attenuated in HPV18 episomes unable to bind CTCF. In agreement with the observed differentiation induced activation of the P811 and P3000 promoters in HPV18 episomes, we demonstrated a marked increase in H4Ac enrichment, particularly in around the P811 and P3000 promoters. Interestingly, a similar level of H4Ac enrichment following differentiation was not recapitulated in ΔCTCF-HPV18 episomes, indicating that CTCF binding to the E2-ORF is important for enhanced transcriptional activation in the late stages of the virus life cycle, either through direct mechanisms or indirectly via increased E6/E7 expression. Importantly, attenuation of differentiation-dependent late promoter activation in ΔCTCF-HPV18 resulted in significantly reduced E1^E4 protein expression following methylcellulose differentiation and a marked reduction in L1 protein expression in stratified epithelia. These results demonstrate for the first time that CTCF has essential functions in differentiation-dependent transcriptional dynamics in the productive phase of the HPV life cycle.

Limited alteration of host CTCF binding by ΔCTCF-HPV18 episome establishment compared to HPV18.

(A) Venn diagram of CTCF peak regions in cells containing either HPV18 or ΔCTCF-HPV18 episomes showing the average total number of peaks present in two independent replicates within each condition as well as the number of overlapping and unique peaks. (B) Heatmap visualization of CTCF ChIP-Seq replicates from two independent HFK donors (#1 and #2) and corresponding input sample centered on the combined peak regions detected in HPV18 and/or ΔCTCF-HPV18 samples. (C) Scatter plots of pairwise sample comparisons show high correlation between replicates as well as between HPV18 and ΔCTCF-HPV18 samples. Pearson’s correlations coefficients (r) are given in the plots and are above 0.93 in any pairwise comparison. (TIF) Click here for additional data file.

Southern blot analysis of episome copy number and methylcellulose-induced genome amplification in HPV18 and ΔCTCF-HPV18 episome containing cells (donor 2).

Amplification of HPV18 and ΔCTCF-HPV18 episomes was detected by Southern blotting following digestion with EcoRI to linearise the HPV18 episomes, or BglII which digests cellular DNA only (OC, open circle; L, linear; SC, supercoiled). (TIF) Click here for additional data file.

Global analysis of differentiation-dependent changes to host gene expression.

(A) PCA of host cell transcriptome in undifferentiated HFKs containing HPV18 (blue) and ΔCTCF-HPV18 (red) episomes and following 48hr incubation in methylcellulose (green and purple, respectively). Close clustering of HPV18 and ΔCTCF-HPV18 samples is observed in both undifferentiated and differentiated cell populations, indicating similar transcriptional profiles. Clear separation in PC1 is induced by host cell differentiation. (B-D) Gene expression changes in undifferentiated (red) and differentiated (purple) ΔCTCF-HPV18 genome-containing HFKs were analysed by long read Nanopore RNA-Seq, demonstrating enhanced involucrin (IVL) expression (B) and enhanced ECM1 expression combined with differentiation-induced exon 7 skipping in transcript variant 3; exon numbering and transcript variants are indicated to the right and below the ECM1 gene annotation (C). (D) Gene set enrichment analysis of differentiation-induced host differential gene expression in HPV18 and ΔCTCF-HPV18 episome containing HFKs. The top 10 most significant terms in Gene Ontology set; Biological Processes are shown with associated p value (-log10). (TIF) Click here for additional data file.

Differentiation-induced expression changes of genes associated with keratinocyte differentiation.

Heatmap showing differentiation-induced expression changes of genes within Biological Processes term GO:0030216:Keratinocyte Differentiation with a mean normalised count of >10 in HPV18 and ΔCTCF-HPV18 genome containing HFKs. (TIF) Click here for additional data file.

Chromosomal location of human-HPV18 fusion transcripts detected by nanopore sequencing of HPV18 and ΔCTCF-HPV18 episome containing HFKs.

Approximate location of human-HPV fusion transcripts is highlighted on the karyotype (image from BioRender) for HPV18 (blue) and ΔCTCF-HPV18 (red). Where multiple transcripts with identical virus-host fusion co-ordinates were identified, the number of reads is indicated. (TIF) Click here for additional data file.

Abrogation of CTCF binding to the HPV18 genome causes a reduction in differentiation-induced E1^E4 expression (donor 2).

HPV18 genome-containing keratinocytes (Donor 2; HPV18 or ΔCTCF) grown in monolayer (undifferentiated, 0h) or differentiated in methylcellulose (48h) and E1^E4, involucrin (IVL) and GAPDH protein expression analysed by Western blotting. Molecular weight markers are indicated on the left (kDa). (TIF) Click here for additional data file.

Virus-host fusion transcripts identified by Nanopore analysis of HPV18 genome containing HFKs.

Showing the nearest annotated human gene, coordinates of identified transcripts mapped to the human (Hg19) and HPV genomes and the number of reads detected. (DOCX) Click here for additional data file.

Virus-host fusion transcripts identified by Nanopore analysis of ΔCTCF-HPV18 genome containing HFKs.

Showing the nearest annotated human gene, coordinates of identified transcripts mapped to the human (Hg19) and HPV genomes and the number of reads detected. (DOCX) Click here for additional data file.

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present. 9 Jun 2021 Dear Dr. Parish, Thank you very much for submitting your manuscript "The chromatin insulator CTCF regulates HPV18 transcript splicing and differentiation-dependent late gene expression" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. [2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts. Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Paul Francis Lambert Associate Editor PLOS Pathogens Karl Münger Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************** Reviewer's Responses to Questions Part I - Summary Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship. Reviewer #1: Ferguson et al. describe a long-read RNA-seq analysis of HPV transcripts using cells that maintain wt HPV 18 genomes in comparison to those with mutated CTCF sites in E2. Previous studies by this group showed that that loss of CTCF binding at this sE2 site results in increased early transcripts, altered splicing patterns and changes in chromatin factors. In the present study the authors use long-read RNA seq to extend the analysis to late transcripts upon differentiation. Mutation of the CTCF site reduces late E1^E4 transcripts by 50% with slightly greater decreases in protein levels. The most significant effect of mutating CTCF site is alteration in splice site utilization along with substantially reduced levels of H4Ac histone modifications. This study provides useful information that extends the authors previous findings on altered splice site usage and epigenetic modifications of the HPV early region with the CTCF mutant genome. The manuscript could benefit from a more mechanistic analysis of how loss of CTCF binding leads to altered splice site choice and changes in histone modifications. Reviewer #2: This manuscript hones in on the understanding of HPV early and late gene regulation. The group has previously identified that the genome-organising protein CTCF is involved in forming a chromatin loop that regulates HPV gene expression. The group uses Nanopore sequencing to understanding HPV early and late transcriptional regulation that appears to be regulated by the presence of a CTCF binding site in the E2 ORF. CTCF is emerging as a new player in regulating alternative splicing via co-transcriptional, genomic and epigenetic mechanisms. Even more recently CTCF has been shown to be involved in regulating splicing in different viral genomes. This is a timely study and uses long-read sequencing to quantify the contribution of CTCF in alternative splicing regulation and transcriptional control in HPV18. Figure 3 is particularly impressive and the authors should be commended. However, there are some deficiencies in results, data analysed and mechanistic understanding that need to be addressed or expanded. Reviewer #3: Manuscript by Joanna Parish, et al. describes the chromatin insulator CTCF regulates HPV18 transcript splicing and differentiation-dependent late gene expression. The authors in this report first found a CTCF binding site in the N-terminal transacting active domain of E2 and then compared viral gene expression in HFKs transfected with recirculated wt HPV18 or �CTCF-HPV18 DNA initially by RNA-seq and then by Nanopore-seq (long reads sequencing) analyses using mRNAs extracted from the transfected HFKs. The authors found that the cells with �CTCF-HPV18 DNA transfection exhibited a much high level of viral early gene expression from P102 promoter by RNA-seq analysis (Fig. 1B). However, the data from Nanopore-seq did not show the similar profile with the enhanced expression of viral early genes in HFKs transfected with �CTCF-HPV18 DNA (Figs. 3-5). Although most viral splicing profiles and promoter usage were confirmative and the observation of CTCF binding to the E2 region to regulate viral genome expression is attractive, the data provided in this report are not conclusive, and more confirmation experiments are needed to draw a definite conclusion. The data in RNA-seq and Nanopore-seq appear to be compiled from only a single sample each in wt and �CTCF-HPV18 genome transfection. To avoid sample bias and outliers and batch effects in RNA-seq and Nanopore (long reads sequencing), minimal three RNA samples in high quality in each group are needed for statistical analysis. Like any other methods, the authors should also provide the perimeters or cutoff values used to count the real splice-junction reads and their long reads. Most importantly, introduction of point mutations to disrupt the CTCF binding site in the N-terminal transacting domain of E2 should not affect E2 protein translation and E2 function. Thus, functional E2 data from the �CTCF-HPV18 DNA-transfected HFKs should be provided to ensure that CTCF, not the E2, regulates viral promoter activities. ********** Part II – Major Issues: Key Experiments Required for Acceptance Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions. Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject". Reviewer #1: 1). CTCF was shown to interact by looping with YY1 in the URR. Does mutation of the YYI site in the LCR recapitulate mutation of the CTCF site in E2 on late splicing effects? YY1 levels decrease upon differentiation so it is unclear how loss of CTCF looping affects late events. Could the effects on late splice site choice be mediated by altered levels of an early gene product that is affected by CTCF YY1 looping? 2). Is the 50% reduction in E1^E4 transcripts in the CTCF mutant the result of altered differentiation dependent replication or changes in cell cycle? Southern analysis should be performed to look at genome levels upon differentiation with the CTCF mutant genomes. Does the previously reported increase in E6/E7 transcription upon CTCF site mutation affect induction of late functions? Is reduced E1^E4 responsible for altered splicing patterns? Is there a difference in how CTCF affects splice site choice in the early region as opposed to late? 3). The reduction in H4Ac is interesting but the effects only reduce late promoter activity by 50%. Is there an increase in repressive histone marks or other modified histones on the late or early regions? Reviewer #2: 1. Nearly one-third of the abstract is reporting previously published results. The focus should be more on the current study, the results and the implications/significance. 2. More details should be provided of the E2 ORF CTCF binding site. This should be given a precise location (other HPV genomic features are) rather than a generic location. A sequence and co-ordinates should be provided as well as an alignment with the CTCF core consensus motif. 3. ChIP sequencing nicely identified differences in binding to WT vs CTCFmutant HPV in infected keratinocytes. However, no changes in host CTCF genome-wide binding were mentioned. These should be analysed and described (at least in Supplementary data). 4. In Figure 1B what differences in host gene expression was observed? If there were changes in gene expression in HPV genome due to the deletion of the CTCF sites, then changes in host gene expression would also be expected. Please detail. 5. Examples of differentiation-dependent host cell gene expression in HPV-infected keratinocytes were provided (IVL and EMC1) but this was limited at best – cherry picking at worst. More genes need to be examined to create an overall picture. This could be in Supplementary. 6. Line 315: ‘Viral host fusion transcripts’ – Is there evidence, if any, that an absence of CTCF binding site in HPV genome could affect HPV viral integration? Loss of a CTCF site could affect episomal folding and/or association with the host genome and/or viral integration. Please comment in Discussion. 7. Why was H4 acetylation examined as opposed to other histone marks? This is not made clear. 8. The confirmation of differentially expressed HPV proteins by Western blot is a bit limited (Figure 7a & E) and only E1^E4 is shown. This reviewer would have more confidence in CTCF’s role in regulating late viral gene expression if more HPV proteins are examined. If possible, a viral protein that is predicted to remain unchanged (based on Nanopore sequencing) should also be included. E6 and E7 should be examined. 9. Figure 7A: The authors had previously shown CTCF expression increase upon HPV transduction. However, this has not been yet shown for differentiation. For completeness, total CTCF protein levels should also be examined. 10. A mechanism by which CTCF regulates alternative splicing is via the ‘roadblock model’ by pausing RNAPII elongation. Is RNAPII enriched at the HPV CTCF site during keratinocyte differentiation? 11. Are cohesin subunits eg RAD21 enriched at the HPV CTCF site and enforcing the CTCF-mediated chromatin loop? 12. By the authors own review (Ref 10), HPV episomal genome can be methylated. Is there any evidence that the E2 ORF CTCF binding site or other CTCF sites can be impacted by methylation. This is important as this could account for lack of CTCF binding during the HPV viral cycle. The authors should conduct COBRA or clonal bisulfite sequencing of the E2 ORF and other possible CTCF sites. Reviewer #3: Fig. 1. Lines 271-274 and Fig. 1A. Please show the details of the mutated sequences in the mapped CTCF binding site (nt 2960-3020) which is positioned at the N-terminal domain of E2. Hope the mutated sequences in the CTCF binding site are neutral (not being suppressive or enhancive to the viral genome expression!) and most importantly, will not inactivate the functional transactivation domain of E2, with normal E2 protein production. Lines 280-285 and Fig. 1B. The increased splicing of 233^416 was most likely resulted from increased expression of delta CTCF genome because total viral reads were all increased across the entire virus genome! How did the authors confirm the same amount of recirculated wt and mt HPV18 DNA being transfected into the HFKs? Some quantitative verification data on input viral genome copies in transfected cells are needed at the beginning of the study. Fig. 2C. How many repeats do you have? Is this just one sample data or one representative of three qualified Nanopore-seq? Plus, all RNA-seq raw data should be submitted to NCBI Geo before manuscript submission. Fig. 3. Lines 327-336 and Fig. 3 transcriptome summary. Additional methods should be applied to verify “novel transcripts” identified from this single sample study. Lines 337-339. Not sure about E2^E4L from the reported study (reference #38) but should be verified too in this report. Fig. 3. HPV18 transcripts of wt vs CTCF mt in HFKs under undifferentiated and differentiated conditions: As the reads are so low (many are less than 5 reads per million) in so called “new transcripts”, how did we know these splice-junction reads were not background noise reads. What were the bioinformatics perimeters and thresholds used in the analyses? Where are the verification data on these new transcripts? Obviously, the late transcripts are so low due to poor HFK differentiation under methylcellulose condition where the RNA was prepared for RNA-seq or Nanopore-seq. Plus, all Nanopore-seq raw data should be submitted to NCBI Geo to obtain a Geo Accession number for manuscript inclusion and submission. Fig. 4 and Fig. 5. Because the RNA 5’ cap prevents linker ligation, RNA-seq and Nanopore-seq can’t be used to precisely map a transcription start site. What the authors’ reads counts in the two figures are the reads counts downstream of a real TSS. Fig. 4B. Since only one or two reads were identified at each nt position in the virus genome, it would be better to delete those reads or state clearly in text that the biological functions of these rare TSSs are minimal. Fig. 4D. If possible, please verify the promoter P3000 TSS by 5’ RACE. Line 410-411 and Fig. 5. Need to be careful on the statement only until the authors ensure a functional E2 expression from �CTCF-HPV18 virus and the HFKs receiving the same amount of wt and mt HPV18 DNA. What are reads-scales in the Fig. 5A and 5B? To this reviewer, both the P102 and the P811 promoters appear more active from the �CTCF-HPV18 virus than wt HPV18 virus in differentiated HFKs, despite that the authors claim only the P102, but not the P811, being more active in the differentiated HFKs. The difference in Fisher’s test must be showing more transactivation in �CTCF-HPV18 virus than wt HPV18. Fig. 6 and Fig. 7. Fig. 6. Please make the annotated genome positions in scale to relative H4Ac positions. Where is your Fig. 6B (lines 24-426)? Line 429. Not sure this statement is correct on reduction of P811 promoter activation from �CTCF-HPV18 virus in differentiated HFKs (Fig. 5B). Fig. 7D and 7E. Now we can see the sample variations when three biological samples were examined. Thus, the same principle should be applied to all RNA-seq and Nanopore-seq for the data shown in Figs. 1-5. ********** Part III – Minor Issues: Editorial and Data Presentation Modifications Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. Reviewer #1: (No Response) Reviewer #2: 1. Line 134: splicing 2. Include antibody dilutions or amounts used in each application 3. Include amplicon size in Table 1 4. It is not obvious how images (Figure 7) were scored or analysed. Was it done by image analysis or by a researcher blinded to the experimental arm? 5. A scale and 0- Z(?) x-co-ordinates should be provided on each HPV plot. At a suggestion, the CTCF site should be indicated with a black triangle or similar on Figure 1B & 6. 6. Figure 1 ‘wild type’ is used, but HPV18 is used thereafter. Please be consistent with usage in all Figures and text. 7. Figure 1 Legend: ‘Next generation sequencing data were IGV.’ The sentence isn’t complete? 8. Figure 2B – number and label the exons. No mention of EMC1 isoform(?) numbers 1, 2 & 3 are mentioned in the legend. 9. Lines 513-514 – ‘….in virus unable to bind CTCF’. Please rectify. Reviewer #3: Introduction Lines 97-103. In addition to CTCF, YY1 also interacts with HPV E7. Line 105. It would be better to describe this promoter as P102 instead of P105 for HPV 18 E6/E7 and make it consistent in the entire manuscript. In fact, the main TSS in raft cultures starts from the P102, not much so from the P105. Lines 119-123. The full HPV18 transcriptome has been summarized in a JVI article (JVI 90: 9138-952, 2016) and host SRSF3 and hnRNPA1 regulation on HPV18 RNA splicing has been described in the same paper. Discussion Please make the promoter P102 as a name consistently in the entire manuscript, including figures and text. Lines 469-483. These spliced transcripts are rare and should not be emphasized too much. In your best estimate, they are less than 10 reads per million both in undifferentiated and differentiated conditions (Fig. 3)! Lines 484-509. Because the RNA-seq and Nanopore-seq lack qualified biological sample repeats and there was no data on functional E2 data from �CTCF-HPV18 virus, this paragraph is not relevant. ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Dr Chuck Bailey Reviewer #3: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at . Data Requirements: Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols 12 Oct 2021 Submitted filename: PLoS Path response to reviewers.docx Click here for additional data file. 13 Oct 2021 Dear Professor Parish, We are pleased to inform you that your manuscript 'The chromatin insulator CTCF regulates HPV18 transcript splicing and differentiation-dependent late gene expression' has been provisionally accepted for publication in PLOS Pathogens. Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests. Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated. IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS. Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Paul Francis Lambert Associate Editor PLOS Pathogens Karl Münger Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************************************************** Reviewer Comments (if any, and for reference): 29 Oct 2021 Dear Professor Parish, We are delighted to inform you that your manuscript, "The chromatin insulator CTCF regulates HPV18 transcript splicing and differentiation-dependent late gene expression," has been formally accepted for publication in PLOS Pathogens. We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly. Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064
  44 in total

1.  Role of the E1--E4 protein in the differentiation-dependent life cycle of human papillomavirus type 31.

Authors:  Regina Wilson; Frauke Fehrmann; Laimonis A Laimins
Journal:  J Virol       Date:  2005-06       Impact factor: 5.103

2.  In vivo analysis of the cell cycle dependent association of the bovine papillomavirus E2 protein and ChlR1.

Authors:  Katherine M Feeney; Anastasia Saade; Krzysztof Okrasa; Joanna L Parish
Journal:  Virology       Date:  2011-04-13       Impact factor: 3.616

Review 3.  Coming of age: ten years of next-generation sequencing technologies.

Authors:  Sara Goodwin; John D McPherson; W Richard McCombie
Journal:  Nat Rev Genet       Date:  2016-05-17       Impact factor: 53.242

4.  Differentiation-dependent alternative splicing and expression of the extracellular matrix protein 1 gene in human keratinocytes.

Authors:  P Smits; Y Poumay; M Karperien; P Tylzanowski; J Wauters; D Huylebroeck; M Ponec; J Merregaert
Journal:  J Invest Dermatol       Date:  2000-04       Impact factor: 8.551

5.  Construction of a full transcription map of human papillomavirus type 18 during productive viral infection.

Authors:  Xiaohong Wang; Craig Meyers; Hsu-Kun Wang; Louise T Chow; Zhi-Ming Zheng
Journal:  J Virol       Date:  2011-06-15       Impact factor: 5.103

6.  HPV-18 E2^E4 chimera: 2 new spliced transcripts and proteins induced by keratinocyte differentiation.

Authors:  Chye Ling Tan; Jayantha Gunaratne; Deborah Lai; Laetitia Carthagena; Qian Wang; Yue Zhen Xue; Ling Shih Quek; John Doorbar; Françoise Bachelerie; Françoise Thierry; Sophie Bellanger
Journal:  Virology       Date:  2012-04-27       Impact factor: 3.616

Review 7.  The human papillomavirus family and its role in carcinogenesis.

Authors:  Massimo Tommasino
Journal:  Semin Cancer Biol       Date:  2013-12-04       Impact factor: 15.707

8.  The transcription map of human papillomavirus type 18 during genome replication in U2OS cells.

Authors:  Mart Toots; Andres Männik; Gaily Kivi; Mart Ustav; Ene Ustav; Mart Ustav
Journal:  PLoS One       Date:  2014-12-30       Impact factor: 3.240

9.  Disruption of CTCF-YY1-dependent looping of the human papillomavirus genome activates differentiation-induced viral oncogene transcription.

Authors:  Ieisha Pentland; Karen Campos-León; Marius Cotic; Kelli-Jo Davies; C David Wood; Ian J Groves; Megan Burley; Nicholas Coleman; Joanne D Stockton; Boris Noyvert; Andrew D Beggs; Michelle J West; Sally Roberts; Joanna L Parish
Journal:  PLoS Biol       Date:  2018-10-25       Impact factor: 8.029

10.  LARP1 isoform expression in human cancer cell lines.

Authors:  Hagen Schwenzer; Mai Abdel Mouti; Pia Neubert; Josephine Morris; Joanne Stockton; Sarah Bonham; Martin Fellermeyer; James Chettle; Roman Fischer; Andrew D Beggs; Sarah P Blagden
Journal:  RNA Biol       Date:  2020-04-14       Impact factor: 4.652

View more
  2 in total

Review 1.  Epigenetic and Transcriptomic Regulation Landscape in HPV+ Cancers: Biological and Clinical Implications.

Authors:  Rosario Castro-Oropeza; Patricia Piña-Sánchez
Journal:  Front Genet       Date:  2022-06-14       Impact factor: 4.772

Review 2.  HPV16 and HPV18 Genome Structure, Expression, and Post-Transcriptional Regulation.

Authors:  Lulu Yu; Vladimir Majerciak; Zhi-Ming Zheng
Journal:  Int J Mol Sci       Date:  2022-04-29       Impact factor: 6.208

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.