Literature DB >> 34723989

Design, synthesis and biological evaluation of N-oxide derivatives with potent in vivo antileishmanial activity.

Leandro da Costa Clementino1,2, Guilherme Felipe Santos Fernandes1,2, Igor Muccilo Prokopczyk2, Wilquer Castro Laurindo1,2, Danyelle Toyama3, Bruno Pereira Motta2, Amanda Martins Baviera2, Flávio Henrique-Silva3, Jean Leandro Dos Santos2, Marcia A S Graminha2.   

Abstract

Leishmaniasis is a neglected disease that affects 12 million people living mainly in developing countries. Herein, 24 new N-oxide-containing compounds were synthesized followed by in vitro and in vivo evaluation of their antileishmanial activity. Compound 4f, a furoxan derivative, was particularly remarkable in this regard, with EC50 value of 3.6 μM against L. infantum amastigote forms and CC50 value superior to 500 μM against murine peritoneal macrophages. In vitro studies suggested that 4f may act by a dual effect, by releasing nitric oxide after biotransformation and by inhibiting cysteine protease CPB (IC50: 4.5 μM). In vivo studies using an acute model of infection showed that compound 4f at 7.7 mg/Kg reduced ~90% of parasite burden in the liver and spleen of L. infantum-infected BALB/c mice. Altogether, these outcomes highlight furoxan 4f as a promising compound for further evaluation as an antileishmanial agent.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34723989      PMCID: PMC8559926          DOI: 10.1371/journal.pone.0259008

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Leishmaniasis is a neglected disease caused by more than 20 species of the genus Leishmania and affects 12 million individuals living mainly in developing countries [1-3]. The current treatment still relies on a small number of old and toxic drugs, administered through the parenteral route, except for the oral drug miltefosine. The drug discovery pipeline for leishmaniasis has been affected by the severe scarcity of new drug candidates achieving clinical trials stages [4]. Therefore, efforts to discover new therapeutic alternatives are urgent. Leishmaniasis is transmitted through the inoculation of promastigotes during the phlebotomines blood meal, followed by their entry and differentiation to amastigotes into mammalian hosts cells, primarily “professional phagocytes’’ such as macrophages [5]. The parasite has developed different strategies to inactivate the macrophages functions, including the expression and secretion of cysteine protease (CPB) [6]. CPB, as well as the Trypanosoma cruzi enzyme cruzain, is a cathepsin L-like protease important for parasite immune evasion [6, 7]. For Leishmania, CPB also allows modulation of the host Th1/Th2 immune response [8, 9] and degradation of MHC class I [10]. The importance of CPB for parasite infection and the lack of redundancy into the mammalian host genome, make it an attractive target for antileishmanial drug development [7, 11]. Several protease inhibitors exhibit electrophilic warheads that undergo nucleophilic attack from thiolate residue of cysteines of the active site of the enzymes [12-19]. Among them, the warhead N-acylhydrazone present protease inhibitory properties and has been previously explored in the synthesis of both antileishmanial and antitrypanocidal compounds [17, 18, 20]. Therefore, in a continuing effort to develop new candidate drugs to treat leishmaniasis, we have first reported a series of furoxan and benzofuroxan derivatives containing the N-acylhydrazone subunit as antileishmanial agents [21]. Among them, the compound Lapdesf14e (E)-4-(4-((2-(3-hydroxybenzoyl)hydrazono)methyl)phenoxy)-3-(phenylsulfonyl)-1,2,5-oxadiazole 2-oxide, previously known as 14e (Fig 1), showed remarkable antileishmanial efficacy in L. infantum–infected hamsters by reducing the parasite load in the spleen (49.9%) and liver (54.2%), without toxic effects [14]. It was suggested that the antileishmanial activity of this furoxan derivative (Lapdesf14e) was related to its ability to release nitric oxide (NO) after biotransformation, which ultimately leads to parasite death mainly through DNA damage [22]. Further investigations have revealed that Lapdesf14e is also targeting the parasite enzyme CPB at micromolar range [20]. Therefore, based on these promising results, we designed a novel series of N-oxide compounds containing N-acylhydrazone subunit, represented by phenyl-furoxan (4a-4g), amide-furoxan (4h-4o), and benzofuroxan (4p-4x) based on Lapdesf14e (Fig 1).
Fig 1

Drug design of the new compounds.

Moreover, to evaluate the contribution of N-oxide subunit, an additional series of analogs containing only the N-acylhydrazone subunit (14a-14g) was also synthesized, excluding the furoxan and benzofuroxan moieties. Thus, based on the attempt to optimize Lapdesf14e, the present study reports the design, synthesis, and biological evaluation of a novel series of N-oxide derivatives (4a-x) and N-acylhydrazones (14a-g), followed by their antileishmanial and inhibitory effect against the recombinant Leishmania cysteine protease LmCPB2.8ΔCTE (CPB), expressed in the yeast Pichia pastoris.

Materials and methods

Chemistry

Reagents and solvents were purchased from commercial suppliers and used as received. Thin-layer chromatography (TLC), precoated with silica gel 60 (HF-254; Merck) to a thickness of 0.25 mm, was used for monitoring all reactions. The plates were revealed under UV light (254 nm) and, when necessary, treated with iodine vapor. All compounds were purified on a chromatography column with silica gel (60 Å pore size, 35-75-μM particle size) and the following solvents were used as mobile phase: dichloromethane, hexane, ethyl acetate, and petroleum ether. The purity was analyzed by HPLC using a Shimadzu LC-10AD chromatograph equipped with a model SPD-10A UV–vis detector (Shimadzu). The purity was superior to 98%. Melting points (mp) were determined in open capillary tubes using an electrothermal melting point apparatus (SMP3; Bibby Stuart Scientific). Infrared (IR) spectroscopy (KBr disc) was performed on an FTIR-8300 Shimadzu spectrometer, and the frequencies are expressed per cm-1. The nuclear magnetic resonance (NMR) spectra for 1H and 13C of all compounds were obtained on a Bruker DRX-600 (600 MHz) NMR spectrometer using deuterated dimethyl sulfoxide (DMSO-d6) or chloroform (CDCl3) as a solvent for sample preparation. Chemical shifts were expressed in parts per million (ppm) relative to tetramethylsilane. The coupling constants are reported in hertz (Hz) and the signal multiplicities are reported as singlet (s), doublet (d), doublet of doublet (dd), doublet of doublet doublets (ddd), triplet (t), and multiplet (m). Elemental analyses (C, H, and N) were performed on a Perkin-Elmer model 240C analyzer. All data were expressed within ± 0.4% of the theoretical values. Compounds 3, 9, 12, 14b, and 14e were prepared according to previously described methodologies [23-27]. Compounds 4p-x were synthesized according to previously described methods and the characterization data are not shown here [24].

General procedures for the synthesis of compounds (4a-o)

The coupling reaction for preparation of compounds (4a-o) involved the treatment of aldehyde group (3, 9, 12) (1.5 mmol) with previously selected hydrazides (5a-e; 6a-b) (1.5 mmol) in 15 mL of ethanol, catalyzed by hydrochloric acid 37% (0.2 mL). The reactions were stirred at room temperature up to 24h and monitored by TLC until the reactive consumption. After, the solvent was partially removed under reduced pressure, followed by the addition of iced water (~ 15 mL) to precipitate the final N-acylhydrazones (4a-o). The precipitate was collected by filtration and washed with cold water to provide the compounds with yields ranging from 82–96%. When necessary, further purification was performed using column chromatography (flash silica, eluent: 50% ethyl acetate; 50% hexane). (E)-4-(4-((2-benzoylhydrazono)methyl)phenoxy)-3-phenyl-1,2,5-oxadiazole 2-oxide (4a). Off-white solid; yield 91%; mp: 210–213°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.94 (s, 1H), 8.49 (s, 1H), 8.09 (d, J = 7.3 Hz, 2H), 7.90 (dd, J = 31.5, 7.2 Hz, 4H), 7.63 (d, J = 7.5 Hz, 4H), 7.60 (d, J = 6.7 Hz, 2H), 7.54 (t, J = 6.8 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 163.2, 161.9, 153.8, 146.8, 133.3, 132.6, 131.8, 130.9, 129.1, 128.8, 128.5, 127.6, 126.7, 121.7, 120.6, 108.4. Anal. Calcd (%) for C22H16N4O4: C: 66.00; H: 4.03; N: 15.98. Found: C: 66.03; H: 4.02; N: 15.98. (E)-4-(4-((2-(4-hydroxybenzoyl)hydrazono)methyl)phenoxy)-3-phenyl-1,2,5-oxadiazole 2-oxide (4b). Off-white solid; yield 90%; mp: 223–225°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.73 (s, 1H), 10.16 (s, 1H), 8.46 (s, 1H), 8.08 (d, J = 7.4 Hz, 2H), 7.84 (d, J = 7.5 Hz, 2H), 7.81 (d, J = 8.5 Hz, 2H), 7.66–7.57 (m, 5H), 6.87 (d, J = 8.5 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 163.0, 162.2, 161.0, 153.9, 145.8, 133.0, 131.2, 130.0, 129.4, 128.9, 127.0, 124.0, 121.9, 120.8, 115.3, 108.6. Anal. Calcd (%) for C22H16N4O5: C: 63.46; H: 3.87; N: 19.21. Found: C: 63.46; H: 3.87; N: 19.23. (E)-4-(4-((2-(4-aminobenzoyl)hydrazono)methyl)phenoxy)-3-phenyl-1,2,5-oxadiazole 2-oxide (4c). Off-white solid; yield 93%; mp: 219–222°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.53 (s, 1H), 8.43 (s, 1H), 8.08 (d, J = 7.3 Hz, 2H), 7.82 (d, J = 8.0 Hz, 2H), 7.67 (d, J = 8.4 Hz, 2H), 7.65–7.57 (m, 5H), 6.59 (d, J = 8.5 Hz, 2H), 5.81 (s, J = 8.4 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 161.9, 153.4, 152,4, 144.6, 133,0, 131.7, 130.9, 129.4, 129.1, 128.4, 126.7, 121.7, 120.5, 119.3, 112.6, 108.4. Anal. Calcd (%) for C22H17N5O4: C: 63.61; H: 4.13; N: 15.41. Found: C: 63.60; H: 4.13; N: 15.41. (E)-4-(4-((2-(4-nitrobenzoyl)hydrazono)methyl)phenoxy)-3-phenyl-1,2,5-oxadiazole 2-oxide (4d). Off-white solid; yield 82%; mp: 226–228°C. 1H NMR (600 MHz, DMSO-d6) δ: 12.23 (s, 1H), 8.51 (s, 1H), 8.39 (d, J = 8.7 Hz, 2H), 8.16 (d, J = 8.7 Hz, 2H), 8.08 (d, J = 7.3 Hz, 2H), 7.90 (d, J = 8.6 Hz, 2H), 7.66–7.59 (m, 5H). 13C NMR (151 MHz, DMSO-d6) δ: 161.8., 154.0, 149.3, 147.7, 139.0, 132.3, 130.9, 129.2, 129.1, 129.0, 126.7, 123.7, 121.7, 120.6, 108.4. Anal. Calcd (%) for C22H15N5O6: C: 59.33; H: 3.39; N: 21.55. Found: C: 59.35; H: 3.41; N: 21.55. (E)-4-(4-((2-(4-(tert-butyl)benzoyl)hydrazono)methyl)phenoxy)-3-phenyl-1,2,5-oxadiazole 2-oxide (4e). Off-white solid; yield 95%; mp: 223–227°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.87 (s, 1H), 8.48 (s, 1H), 8.09 (d, J = 7.5 Hz, 2H), 7.86 (d, J = 8.0 Hz, 4H), 7.65–7.59 (m, 5H), 7.55 (d, J = 8.0 Hz, 2H), 1.32 (s, 9H). 13C NMR (151 MHz, DMSO-d6) δ: 163.2, 162.0, 154.8, 153.8, 146.4, 132.8, 131.1, 130.7, 129.3, 128.9, 127.7, 126.8, 126.8, 125.4, 121.8, 120.7, 108.5, 31.1. Anal. Calcd (%) for C26H24N4O4: C: 68.41; H: 5.30; N: 14.02. Found: C: 68.40; H: 5.32; N: 14.04. (E)-4-(4-((2-carbamoylhydrazono)methyl)phenoxy)-3-phenyl-1,2,5-oxadiazole 2-oxide (4f). Off-white solid; yield 96%; mp: 196–198°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.51 (s, 1H), 8.26 (s, 1H), 8.11–8.05 (m, 4H), 7.95 (d, J = 8.6 Hz, 2H), 7.65–7.59 (m, 3H), 7.56 (d, J = 8.7 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 161.9., 153.6, 140.9, 132.5, 130.9, 129.1, 129.0, 126.7, 121.7, 120.4, 108.4. Anal. Calcd (%) for C16H13N5O4: C: 56.64; H: 3.86; N: 18.86. Found: C: 56.64; H: 3.89; N: 18.86. (E)-4-(4-((2-carbamothioylhydrazono)methyl)phenoxy)-3-phenyl-1,2,5-oxadiazole 2-oxide (4g). Off-white solid; yield 89%; mp: 193–195°C. 1H NMR (600 MHz, DMSO-d6) δ: 10.33 (s, 1H), 8.08 (d, J = 7.3 Hz, 2H), 7.86 (d, J = 8.6 Hz, 3H), 7.65–7.58 (m, 3H), 7.53 (d, J = 8.6 Hz, 2H), 6.56 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 162.0, 156.7, 152.9, 137.8, 133.1, 130.9, 129.1, 128.1, 126.7, 121.7, 120.3, 108.3. Anal. Calcd (%) for C16H13N5O3S: C: 54.08; H: 3.69; N: 13.51. Found: C: 54.11; H: 3.71; N: 13.51. (E)-4-((4-((2-benzoylhydrazono)methyl)phenoxy)methyl)-3-carbamoyl-1,2,5-oxadiazole 2-oxide (4h). Off-white solid; yield 93%; mp: 221–225°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.77 (s, 1H), 8.46 (d, J = 59.2 Hz, 2H), 7.91 (d, J = 6.4 Hz, 2H), 7.85 (s, 1H), 7.70 (d, J = 7.4 Hz, 2H), 7.59 (d, J = 6.1 Hz, 1H), 7.53 (d, J = 6.1 Hz, 2H), 7.15 (d, J = 7.4 Hz, 2H), 5.48 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 163.0, 159.1, 155.7, 155.1, 147.4, 133.5, 131.7, 128.7, 128.5, 127.6, 115.2, 110.5, 61.2. Anal. Calcd (%) for C18H15N5O5: C: 56.69; H: 3.96; N: 20.98. Found: C: 56.70; H: 3.98; N: 20.99. (E)-3-carbamoyl-4-((4-((2-(4-hydroxybenzoyl)hydrazono)methyl)phenoxy)methyl)-1,2,5-oxadiazole 2-oxide (4i). Off-white solid; yield 90%; mp: 201–203°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.56 (s, 1H), 10.13 (s, 1H), 8.44 (d, J = 76.8 Hz, 2H), 7.85 (s, 1H), 7.79 (d, J = 8.1 Hz, 2H), 7.68 (d, J = 7.1 Hz, 2H), 7.13 (d, J = 7.8 Hz, 2H), 6.85 (d, J = 7.8 Hz, 2H), 6.77 (d, J = 8.1 Hz, 1H), 5.47 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 162.6, 160.6, 160.0, 158.9, 146.5, 129.6, 128.8, 128.5, 128.1, 124.0, 115.2, 115.0, 110.5, 61.2. Anal. Calcd (%) for C18H15N5O6: C: 54.41; H: 3.81; N: 24.16. Found: C: 54.39; H: 3.81; N: 24.16. (E)-4-((4-((2-(4-aminobenzoyl)hydrazono)methyl)phenoxy)methyl)-3-carbamoyl-1,2,5-oxadiazole 2-oxide (4j). Off-white solid; yield 91%; mp: 209–214°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.36 (s, 1H), 8.51 (s, 1H), 8.35 (s, 1H), 7.85 (s, 1H), 7.65 (d, J = 7.8 Hz, 4H), 7.13 (d, J = 8.4 Hz, 2H), 6.58 (d, J = 8.3 Hz, 2H), 5.77 (s, 2H), 5.47 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 162.8, 158.7, 155.7, 155.2, 152.2, 145.6, 129.3, 128.4, 128.3, 119.6, 115.1, 112.6, 110.5, 61.2. Anal. Calcd (%) for C18H16N6O5: C: 54.55; H: 4.07; N: 20.18. Found: C: 54.56; H: 4.06; N: 20.19. (E)-3-carbamoyl-4-((4-((2-(4-nitrobenzoyl)hydrazono)methyl)phenoxy)methyl)-1,2,5-oxadiazole 2-oxide (4l). Off-white solid; yield 84%; mp: 229–233°C. 1H NMR (600 MHz, DMSO-d6) δ: 12.07 (s, 1H), 8.51 (s, 1H), 8.43 (s, 1H), 8.38 (d, J = 8.4 Hz, 2H), 8.15 (d, J = 8.4 Hz, 2H), 7.85 (s, 1H), 7.72 (d, J = 8.3 Hz, 2H), 7.16 (d, J = 8.3 Hz, 2H), 5.49 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 161.3, 159.3, 155.7, 148.6, 139.2, 131.8, 129.1, 128.9, 128.4, 123.7, 123.6, 115.2, 110.5, 61.2. Anal. Calcd (%) for C18H14N6O7: C: 50.71; H: 3.31; N: 26.27. Found: C: 50.73; H: 3.31; N: 26.28. (E)-4-((4-((2-(4-(tert-butyl)benzoyl)hydrazono)methyl)phenoxy)methyl)-3-carbamoyl-1,2,5-oxadiazole 2-oxide (4m). Off-white solid; yield 89%; mp: 189–192°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.70 (s, 1H), 8.51 (s, 1H), 8.40 (s, 1H), 7.84 (d, J = 8.2 Hz, 3H), 7.69 (d, J = 8.0 Hz, 2H), 7.54 (d, J = 7.8 Hz, 2H), 7.14 (d, J = 8.0 Hz, 2H), 5.48 (s, 2H), 1.31 (s, 9H). 13C NMR (151 MHz, DMSO-d6) δ: 162.9, 159.0, 155.7, 155.1, 154.5, 147.1, 130.7, 128.7, 127.9, 127.4, 125.3, 115.2, 110.5, 61.2, 34.7, 30.9. Anal. Calcd (%) for C22H23N5O5: C: 60.40; H: 5.30; N: 18.29. Found: C: 60.40; H: 5.33; N: 18.31. (E)-3-carbamoyl-4-((4-((2-carbamoylhydrazono)methyl)phenoxy)methyl)-1,2,5-oxadiazole 2-oxide (4n). Off-white solid; yield 96%; mp: 228–230°C. 1H NMR (600 MHz, DMSO-d6) δ: 11.36 (s, 1H), 8.50 (s, 1H), 8.14 (s, 1H), 7.98 (d, J = 24.2 Hz, 2H), 7.85 (s, 1H), 7.76 (d, J = 8.3 Hz, 2H), 7.07 (d, J = 8.3 Hz, 2H), 5.46 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 158.9, 155.7, 155.1, 141.9, 131.8, 128.9, 127.8, 115.0, 110.5, 61.2. Anal. Calcd (%) for C12H12N6O5: C: 45.00; H: 3.78; N: 24.98. Found: C: 45.03; H: 3.80; N: 24.99. (E)-4-((4-((2-carbamothioylhydrazono)methyl)phenoxy)methyl)-3-carbamoyl-1,2,5-oxadiazole 2-oxide (4o). Off-white solid; yield 90%; mp: 232–234°C. 1H NMR (600 MHz, DMSO-d6) δ: 10.15 (s, 1H), 8.50 (s, 1H), 7.82 (d, J = 37.5 Hz, 2H), 7.67 (d, J = 8.4 Hz, 2H), 7.05 (d, J = 8.4 Hz, 2H), 6.45 (s, 2H), 5.44 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 158.2, 156.8, 155.7, 155.2, 138.8, 128.4, 128.0, 114.9, 110.5, 61.2. Anal. Calcd (%) for C12H12N6O4S: C: 42.85; H: 3.60; N: 19.03. Found: C: 42.86; H: 3.63; N: 19.04.

General procedures for the synthesis of compounds (14a-g)

The compounds 14b and 14e were prepared according to the methodology previously described [21]. The compounds 14a, 14c, 14d, 14f, and 14g were prepared according to the following general procedure: 1.61 mmol of 4-hydroxybenzaldehyde (13) was treated with previously selected hydrazides (5a-e; 6a-b) (1.61 mmol) in 20 mL of ethanol, catalyzed by acetic acid (0.2 mL). The reactions were stirred at room temperature up to 24h and monitored by TLC until the reactive consumption. After, the solvent was partially removed under reduced pressure, followed by the addition of iced water (~ 15 mL) to precipitate the final N-acylhydrazones (14a, 14c, 14d, 14f, and 14g). The precipitate was collected by filtration and washed with cold water to provide the compounds with yields ranging from 34–81.4%. When necessary, further purification was performed using column chromatography (flash silica, eluent: 50% ethyl acetate; 50% hexane). (E)-2-(4-hydroxybenzylidene)hydrazine-1-carboxamide (). Off-white solid; yield 34%; mp: 224–226°C. IR max (cm-1; KBr pellets): 3474 (O-H), 3258 (N-H), 1697 (C = O amide), 1604 (NH2), 1580 (C = N imine), 1508 and 1451 (C = C), 1255 (C-O), 1169 (C-N). 1H NMR (600 MHz, DMSO-d6) δ: 10.02 (s, 1H), 9.73 (s, 1H), 7.73 (s, 1H), 7.52 (d, J = 8.7 Hz, 2H), 6.76 (d, J = 8.6 Hz, 2H), 6.37 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 158.4, 156.9, 139.6, 128.1, 125.8, 115.4. Anal. Calcd (%) for C8H9N3O2: C: 53.63; H: 5.06; N: 23.45. Found: C: 53.65; H: 5.08; N: 23.45. (E)-2-(4-hydroxybenzylidene)hydrazine-1-carbothioamide (). Off-white solid; yield 65%; mp: 227–229°C. IR max (cm-1; KBr pellets): 3522 (O-H), 3198 (N-H), 1613 (C = O amide), 1587 (NH2), 1549 (C = N imine), 1509 and 1451 (C = C), 1383 and 1281 (C = S), 1269 (C-O), 1165 (C-N). 1H NMR (600 MHz, DMSO-d6) δ: 11.25 (s, 1H), 9.87 (s, 1H), 8.06–7.83 (m, 2H), 7.95 (s, 1H), 7.61 (d, J = 8.7 Hz, 2H), 6.77 (d, J = 8.7 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 177.4, 159.2, 142.6, 129.0, 125.1, 115.5. Anal. Calcd (%) for C8H9N3OS: C: 49.22; H: 4.65; N: 21.52. Found: C: 49.21; H: 4.65; N: 21.52. (E)-N’-(4-hydroxybenzylidene)benzohydrazide (). Off-white solid; yield 81%; mp: 244–245°C. IR max (cm-1; KBr pellets): 3194 (O-H), 3065 (N-H), 1608 (C = O amide), 1580 (C = N imine), 1564 and 1520 (C = C). 1H NMR (600 MHz, DMSO-d6) δ: 11.65 (s, 1H), 9.94 (s, 1H), 8.35 (s, 1H), 7.90 (d, J = 7.2 Hz, 2H), 7.60–7.55 (m, 3H), 7.52 (d, J = 7.8 Hz, 2H), 6.84 (d, J = 8.6 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 162.8, 159.4, 148.1, 133.6, 131.5, 128.8, 128.4, 127.5, 125.3, 115.7. Anal. Calcd (%) for C14H12N2O2: C: 69.99; H: 5.03; N: 11.66. Found: C: 69.97; H: 5.02; N: 11.66. (E)-4-hydroxy-N’-(4-hydroxybenzylidene)benzohydrazide (). Off-white solid; yield 34%; mp: 224–226°C. IR max (cm-1; KBr pellets): 3522 (O-H), 3248 (N-H), 1632 (C = O amide), 1604 (C = N imine), 1508 and 1451 (C = C), 1290 (C-O). 1H NMR (600 MHz, DMSO-d6) δ: 11.44 (s, 1H), 10.10 (s, 1H), 9.91 (s, 1H), 8.31 (s, 1H), 7.78 (d, J = 8.6 Hz, 2H), 7.54 (d, J = 8.2 Hz, 2H), 6.85 (d, J = 5.2 Hz, 2H), 6.82 (d, J = 5.1 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 162.6, 160.6, 159.3, 147.2, 129.6, 128.8, 125.5, 124.1, 115.7, 115.0. Anal. Calcd (%) for C14H12N2O3: C: 65.62; H: 4.72; N: 10.93. Found: C: 65.62; H: 4.74; N: 10.94. (E)-4-amino-N’-(4-hydroxybenzylidene)benzohydrazide (). Off-yellow solid; yield 65%; mp: 275–276°C. IR max (cm-1; KBr pellets): 3522 (O-H), 3248 (N-H), 1632 (C = O amide), 1604 (C = N imine), 1508 and 1451 (C = C). 1H NMR (600 MHz, DMSO-d6) δ: 11.25 (s, 1H), 9.86 (s, 1H), 8.29 (s, 1H), 7.65 (d, J = 8.4 Hz, 2H), 7.51 (d, J = 8.3 Hz, 2H), 6.82 (d, J = 8.6 Hz, 2H), 6.58 (d, J = 8.7 Hz, 2H), 2.19 (s, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 162.8, 159.0, 152.1, 146.3, 129.2, 128.5, 125.7, 119.7, 115.6, 112.5. Anal. Calcd (%) for C14H13N3O2: C: 65.87; H: 5.13; N: 16.46. Found: C: 65.87; H: 5.15; N: 16.46. (E)-N’-(4-hydroxybenzylidene)-4-nitrobenzohydrazide (). Off-yellow solid; yield 75%; mp: 266–268°C. IR max (cm-1; KBr pellets): 3331 (O-H), 3191 (N-H), 1665 (C = O amide), 1594 (C = N imine), 1549 and 1440 (C = C), 1514 and 1340 (NO2) 1267 (C-O). 1H NMR (600 MHz, DMSO-d6) δ: 11.94 (s, 1H), 9.99 (s, 1H), 8.37 (s, 1H), 8.36 (d, J = 2.5 Hz, 2H), 8.14 (d, J = 8.5 Hz, 2H), 7.59 (d, J = 8.4 Hz, 2H), 6.85 (d, J = 8.2 Hz, 2H). 13C NMR (151 MHz, DMSO-d6) δ: 161.1, 159.7, 149.2, 149.1, 139.3, 129.1, 125.0, 123.6, 115.7. Anal. Calcd (%) for C14H11N3O4: C: 58.95; H: 3.89; N: 14.73. Found: C: 58.95; H: 3.89; N: 14.74. (E)-4-(tert-butyl)-N’-(4-hydroxybenzylidene)benzohydrazide (). Off-white solid; yield 34%; mp: 224–226°C. IR max (cm-1; KBr pellets): 3522 (O-H), 3248 (N-H), 2961 (C-H, sp3), 1606 (C = O amide), 1577 (C = N imine), 1554 and 1511 (C = C), 1366 and 1305 (CH3), 1278 (C-O), 1165 (C-N) 1H NMR (600 MHz, DMSO-d6) δ: 11.59 (s, 1H), 9.95 (s, 1H), 8.33 (s, 1H), 7.83 (d, J = 8.3 Hz, 2H), 7.56 (d, J = 8.4 Hz, 2H), 7.53 (d, J = 8.3 Hz, 2H), 6.84 (d, J = 8.4 Hz, 2H), 1.31 (s, 9H). 13C NMR (151 MHz, DMSO-d6) δ: 162.8, 159.4, 154.5, 147.8, 130.9, 128.8, 127.4, 125.4, 125.2, 115.7, 34.7, 30.9. Anal. Calcd (%) for C18H20N2O2: C: 72.95; H: 6.80; N: 9.45. Found: C: 72.97; H: 6.83; N: 9.45.

Quantification of nitrite by the Griess reaction

The levels of nitrite resulting from the oxidation of NO in the aqueous medium were quantified through the Griess reaction after incubation with an excess of L-cysteine (1:50) according to previously published methods [23, 27, 28]. The experiments were performed in triplicate and repeated three times on different days. No production of nitrite was observed in the absence of L-cysteine. The results were expressed as a percentage of nitrite (% NO2−; mol/mol). Statistical analysis was carried out using ANOVA followed by Tukey’s Multiple Comparison Test at a significance level of p < 0.05.

Cloning and expression of CPB in the yeast Pichia pastoris

Escherichia coli TOP 10 (Invitrogen) was used as a host for gene cloning experiments, whilst the yeast Pichia pastoris X-33 (Invitrogen), for the expression of CPB2.8 (CPB). The ORF that codes for the Leishmania mexicana CPB, lacking the C terminal extension (CPB2.8ΔCTE) [29], was PCR amplified using the Taq polymerase HiFi (Cellco Biotecnologia, São Carlos, SP) and the pair of primers (5´-AAA) forward and (5´-AAA) reverse, which contains the restriction sites EcoRI and SalI, respectively. The PCR product was purified from 1% agarose gel and cloned into pGEM-T easy vector (Promega), following the manufacturer’s instructions and used to transform TOP10 Escherichia coli (Invitrogen). After identification and production of the recombinant plasmid, it was double digested with EcoRI and SalI, the band of ~1 kbp was isolated from 1% agarose gel and ligated to the EcoRI/SalI digested pPICZαA vector (Invitrogen) to produce a recombinant protein bearing a C-terminal histidine tag. The obtained recombinant vector was confirmed by sequencing using the primers forward α factor (TACTATTGCCAGCATTGCTGC) and reverse 3’AOX1 (GCAAATGGCATTCTGACATCC) and hereafter, linearized with PmeI for the transformation of P. pastoris X-33 (Invitrogen) by electroporation in a Gene-Pulser (Bio-Rad, US) at Gene Pulse X-Cell (Bio Rad), 1,5 KV, 25 μF e 200 Ω, as described [30]. The cells were plated onto YPDS-agar medium (1% yeast extract, 2% peptone, 2% dextrose, 1 M sorbitol, 2% agar) containing 100, 250 and 500 μg.mL-1 of Zeocin™, and incubated at 30°C for 3–5 days for selection of zeocin resistant colonies, which were analyzed by PCR to confirm the presence of the EcoRI/SalI fragment into the yeast genomic DNA. Twenty-four transformants were screened for recombinant protease production after methanol induction in 24-well plates (Whatman) as previously described [31] with modifications in the cultivation and induction [30], and the protease production monitored in 15% (w/v) SDS-PAGE [32]. The clone that better produced rCPB2.8ΔCTE, observed by SDS-PAGE, was induced again in 100 mL of medium, for 96 h for purification. The recombinant enzyme was purified by immobilized metal affinity chromatography (IMAC) using Ni-NTA agarose resin Superflow (Qiagen®) and eluted using a buffer containing different concentrations of imidazole (25 mM to 250 mM) 10 mM Tris, 50 mM Na2HPO4 monohydrate, and 100 mM CaCl2. After elution, dialysis of the fractions containing the recombinant protein was carried out in SnakeSkin Dialysis Tubing, 3.5K MWCO (Thermo Scientific) against 100 mM sodium acetate buffer pH 5.0 (2L), 2X, and the protein quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific).

Enzymatic assays

The concentration of the active recombinant CPB expressed in Pichia pastoris supernatant was determined by active site titration with N-(trans-Epoxysuccinyl)-L-leucine 4-guanidinobutylamide E-64 (CalBiochem) [33] that was found 1 μM. The active enzyme represented about 80% of the total recombinant enzyme. Compounds were dissolved in DMSO to a final concentration of 20 μM. The assays were performed in dark 96 well-plates, containing 200 μL of 100 mM sodium acetate buffer (pH 5.5), 200 mM NaCl, 0.01% Triton-X100, 2 nM enzyme, various concentrations of inhibitor, and 5 μM of the substrate Z-FR-AMC (Calbiochem). The final concentration of DMSO was 1% (v/v). The enzyme was pre-incubated at 30°C for 2 minutes before the inhibitor was added, waited 2 minutes and after this incubation, the reaction was started by the addition of the substrate, Z-FR-AMC. The fluorescence was monitored at 380 nm excitation and 460 nm emission filters for 2 minutes at 30°C in an Infinite 200 PRO microplate reader (Tecan, Männedorf, Switzerland). The residual activity was measured by the ratio between enzyme + substrate and enzyme + inhibitor + substrate. All compounds were evaluated at 20 μM, and the compounds able to inhibit the enzyme at 20 μM (inhibition < 20 μM) were selected and tested again at 10 μM, 5 μM, 2.5 μM, 1.25 μM, 0.62 μM, and 0.3 μM to determine IC50 values [16]. Results were expressed in mean ± standard deviation of two independent replicates using Bioestat Software.

Biological assays

Parasites and cells

Promastigotes of L. infantum strains MHOM/BR/1972/LD and MHOM/MA/67/ITMAP-263 were maintained at 27°C in Schneider’s medium (Sigma) supplemented with 100 mL of heat-inactivated fetal bovine serum (FBS), streptomycin, and penicillin (100 mg mL-1; 100 μM mL-1) (LGC Biotecnologia) and 10% of sterile masculine human urine, in 25 cm2 culture bottles (TPP). Peritoneal macrophages were obtained as previously described [34]. Briefly, cells were collected from the peritoneal cavity of six to eight weeks old male Swiss mice, previously stimulated with thioglycolate 3%. For this, PBS (pH 7.4) was injected into the peritoneal cavity, followed by a slight massage, and the content was collected using a syringe (5 mL). These cells were cultivated in RPMI 1640 medium supplemented with 10% heat-inactivated FBS, 25 mM HEPES, 2 mM L-glutamine, 1% penicillin/streptomycin and incubated at 37°C in a 5% CO2-air mixture in 96 well-plates or 24 well-plates.

Evaluation of cytotoxicity on peritoneal macrophages

In summary, cells (5 x 105 cells mL-1) were incubated in RPMI 1640 medium, containing decreasing concentrations of compounds (500 to 7.8 μM), at a final volume of 100 μL per well, for 24 h at 37°C in a 5% CO2-air. Their viability was measured by the MTT colorimetric assay according to Velasquez et al. (2016) [34] with some modifications. Briefly, after the incubation above described, the supernatant was removed and it was added 100 μL of ethanol and 100 μL of PBS: isopropanol (v/v). The absorbance was read on a spectrophotometer at 570 nm. The cytotoxic concentration of compounds that resulted in 50% of cell growth inhibition (CC50) was determined using non-linear regression on Bioestat® software. The assays were performed in experimental triplicate and two independent replicates. Results expressed in mean ± standard deviation.

Anti-amastigote activity

The antileishmanial activity against L. infantum intracellular amastigotes, according to the following methodology [34]. Murine peritoneal macrophages in RPMI 1640 were seeded at a density of 5 x 105 cells mL-1 (500 μL final volume) containing coverslips of 13 mm diameter arranged in a 24-well plate. After 6 h of incubation at 37°C and 5% CO2-air mixture for macrophage adhesion, promastigote forms of L. infantum at the stationary growth phase (6–7 days) were added to the wells in a ratio of 10:1 (promastigotes: macrophages) and incubated for another 18 h to allow parasites internalization. After incubation, the medium was replaced, non-internalized parasites were removed by PBS washing and added a new medium containing 10 μM to 0.25 μM of compounds and plates were incubated for 24 h at 37°C and 5% CO2-air mixture. Were used infected macrophages as negative control and amphotericin B as the positive control. After incubation, cells were fixed with methanol and Giemsa stained. The effective concentration to 50% amastigotes death (EC) was obtained by counting 100 macrophages in duplicate, in two independent experiments. The values were obtained by non-linear regression on Bioestat® software, and results were expressed in mean ± standard deviation. Additionally, was determined the Selective Index (SI = CC50macrophages/EC50leishmania) indicating how many times the sample is more selective to parasites.

In vivo analysis

To evaluate the in vivo antileishmanial efficacy of compound 4f, male BALB/c mice, 20 ± 4 g, 6 weeks-old (CEMIB-UNICAMP) were intraperitoneally inoculated with 100 μL (1x108 parasites) of infective promastigotes of L. infantum (MHOM/MA/67/ITMAP-263) at the stationary phase. After nine days post-infection, the animals were treated by oral gavage (100 μL per dose) twice daily for 5 days with a 12h interval between doses according to the dosages described below, and euthanized [35, 36]. The adopted doses, obtained through extrapolation based on EC50 and mice blood volume/ body weight [37]; supplementary material were: (0.28 mg/kg/day, 0.85 mg/kg/ day); 2.56 mg/kg/ day; 7.7 mg/Kg/ day, the same used for the reference drug, miltefosine (Cayman chemical) previously reported (7.7 mg/kg/day) [38]. Work solutions were daily prepared in PBS. Negative controls correspond to infected and non-treated mice. As a positive control, a group of mice received 7.7 mg/kg/day of miltefosine, and a group of uninfected and untreated mice (healthy animals) was used for the analysis. The compound and miltefosine were orally administered twice a day for five days. After treatment, the animals were euthanized and the treatment efficacy was assessed by measuring the parasite burden of the infected animals using the LDU index [38, 39]. LDU index. After the euthanasia, mice´s liver and spleen were collected for parasite quantification. Tissues impression onto microscopy slides were made, followed by Giemsa-staining and examining under optical microscopy. The corresponding number of amastigotes per 1,000 nucleated cells/organ weight was expressed as LDU index according to Stauber (1958), Sousa-Batista (2018), and Kwofie (2019) [38-40]. Toxicity for mice assays. The blood was collected in heparinized tubes and immediately centrifuged at 700×g for 10 min at 25°C to obtain plasma. Plasma levels of aspartate (AST), and alanine (ALT) transferases, alkaline phosphatase (ALP), creatinine, urea, and total bilirubin were determined at the end of treatment using commercial kits (Labtest Diagnóstica S.A., Brazil). The assays were performed according to Velasquez et al. (2017) [37] and the data are expressed as average ± SEM. The statistical differences between groups were evaluated using a one-way analysis of variance, followed by the Student-Newman-Keuls multiple comparison test using GraphPad Prism software. Differences were considered significant when P values were 0.05.

Ethics statement

All experiments involving animals were approved by the Ethics Committee for Animal Experimentation of School of Pharmaceutical Sciences, Sao Paulo State University (CEUA-FCF-UNESP), under the number (CEUA/FCF/CAr:17/2020), in agreement with the guidelines of the Sociedade Brasileira de Ciência de Animais de Laboratorio (SBCAL) and the National Council for the Control of Animal Experimentation (CONCEA). Euthanasia was performed using xylazine/ketamine anesthesia, followed by cervical dislocation. All necessary efforts were taken in order to minimize animals discomfort and pain.

Computational methods

In silico prediction of ADME properties

Determination of the potential of oral absorption, drug-likeness, and water solubility of the furoxan derivatives was performed using the Swiss ADME software [41].

Molecular docking

All in silico studies were performed on the Maestro molecular modeling environment. The 3D structures were generated applying the LigPrep procedure. It was used Epik [42] to generate the protonation state in pH 5.5 ± 1.0 (the same used on CPB enzymatic assays) and OPLS03 as a field force. The coordinate for the target (PDB ID: 6P4E), resolution: 1.35 Å [43] was retrieved from Protein Data Bank. The .pdb structure was prepared using ProteinPreparationWizard. The hydrogens were removed and reincluded. The missing residues were corrected. All residues were optimized based on pH 5.5 ± 1.0. The minimization steps run until the converge threshold RMSD equals 0.15 Å. The grid generation was prepared with volume appropriated to cover all investigational sites. The catalytic amino acids CYS26 and HIS164 were considered as deprotonated and protonated, respectively. Before grid generation, it was performed as default Protein Preparation Wizard. It generated a grid box of 15 Å centered on catalytic cysteine. All docking calculations were performed using Glide on Extra-precision mode (XP) [44]. For all docking simulations were generated 20 poses and post-docking minimization. Other parameters were kept as default.

Results

The phenyl-furoxan (3) was obtained in two steps, with an overall yield of 84% (Scheme 1). First, the styrene (1) was treated with sodium nitrite and acetic acid at room temperature in the medium containing dichloromethane as solvent to obtain the furoxan derivative (2) at 87%, as previously described [23]. Then, compound (2) was treated with 4-hydroxybenzaldehyde and 1,8-diazabicyclo [5.4.0] undec7-ene (DBU) in a dichloromethane medium to provide compound (3) at a yield of 90% [21]. The amide-furoxan derivative (9) and benzofuroxan derivative (12) were obtained according to the previously described procedures [24, 25]. Finally, the last step involved the coupling reaction of the aldehyde group in phenyl-furoxan (2), amide-furoxan (9), or benzofuroxan (12) within the appropriate hydrazides (5a-e; 6a-b) in medium containing ethanol and acetic acid at yields ranging from 82 to 96%, providing the N-oxide compounds (4a-x) (Schemes 1 and 2).
Scheme 1

Synthesis of the furoxan derivatives (4a-o).

Scheme 2

Synthesis of benzofuroxan (4p-x) and N-acyl-hydrazones (14a-g) derivatives.

In order to evaluate the contribution of N-oxide subunit, the N-acylhydrazone analogs (14a-g) were prepared through condensation reaction involving 4-hydroxybenzaldehyde and distinct hydrazides (5a-e; 6a-b) in a medium containing ethanol and acetic acid with yields ranging from 82 to 96% (Scheme 2). The structure and the purity (>98.5%) of all final compounds were determined, as well as their 1H NMR spectra (S1 Appendix), which revealed a single signal corresponding to ylidenic hydrogen of the E-diastereomers.

Nitrite measurement

The ability of all synthesized compounds (4a-x) and (14a-g) to release NO was evaluated by indirect determination of NO2− production. The compounds at 10−4 M were incubated for 1 h at 37°C in the presence of L-cysteine (1:50) and the produced NO2− was determined through Griess reaction (Table 1) [23].
Table 1

NO-released data for compounds (4a-x) and (14a-e).

Compounds (10−4 M)% NO2- (mol/mol)
5 mM of L-Cys
DNS 10.5 ± 0.9*a
Lapdesf14e 26.0 ± 1.6*
4a 9.0 ± 0.7*
4b 8.8 ± 0.6*
4c 9.3 ± 0.8*
4d 8.6 ± 0.8*
4e 8.8 ± 0.7*
4f 9.1 ± 0.7*
4g 9.0 ± 0.6*
4h 12.1 ± 1.2*
4i 12.3 ± 0.9*
4j 12.7 ± 0.8*
4l 11.8 ± 1.1*
4m 12.5 ± 1.3*
4n 12.0 ± 1.4*
4o 11.8 ± 1.2*
4p-4x 0
14a-14g 0
AmpB 0

aDNS: isosorbide dinitrate (DNS possesses two ONO2 groups that may release NO). The data are expressed as the means ± standard errors of the means. Significant differences between the experimental and control groups were evaluated by analysis of variance followed by Tukey’s Multiple Comparison Test.

* p < 0.05 vs. ampB.

† p < 0.05 vs. DNS.

aDNS: isosorbide dinitrate (DNS possesses two ONO2 groups that may release NO). The data are expressed as the means ± standard errors of the means. Significant differences between the experimental and control groups were evaluated by analysis of variance followed by Tukey’s Multiple Comparison Test. * p < 0.05 vs. ampB. † p < 0.05 vs. DNS. The furoxan derivative (Lapdesf14e), which contains a phenylsulfonyl moiety attached to C-3 was more prone to release NO (26%) [21], whilst those containing phenyl (4a-g) (9%), or amide (4h-o) (12%) groups at the same position exhibited a similar pattern of nitrite formation when compared to DNS, used as reference NO donor (10.5%). On the other hand, both benzofuroxan (4p-x) and N-acylhydrazones (14a-g) were not able to release NO.

Recombinant expression of CPB

The recombinant cysteine protease CPB was, for the first time, successfully expressed in P. pastoris, circumventing the problem of solubility and yield when expressed in Escherichia coli [29]. The CPB coding sequence was PCR amplified from Leishmania mexicana genomic DNA, excluding the C-terminal extension region, which is not necessary for its activity against Trypanosomatids, as previously described [45, 46] and later confirmed by Sanderson and colleagues [29]. After sequence confirmation (S1 Fig), the plasmid containing the CPB coding region, named pPIC-CPB2.8ΔCTE, was used to transform the P. pastoris X-33 strain. Among the positive clones, the pPIC-CPB2.8#25 was selected for production of CPB in medium containing methanol. The culture supernatants from 0h to 144 h were collected and visualized in 15% SDS-PAGE, stained with Coomassie Brilliant Blue R-250 to verify the expression levels (Fig 2A).
Fig 2

Analysis of CPB expression in P. pastoris.

(A) SDS-PAGE showing the supernatants of non- transformed Pichia pastoris X-33, and aliquots from 0 to 144 hours of the transformed clone pPIC-CPB2.8#25 induced with methanol. The arrow indicates the expected size for active (processed) CPB. The arrowhead indicates the unprocessed protein after 24 and 48 h induction. MW: molecular weight Bench Mark (Invitrogen). (B) Analysis of L. mexicana CPB after purification and dialysis. Coomassie-stained SDS-PAGE 15% showing in MW: molecular weight Page Ruler (Thermo Scientific); 1, the purified and dialyzed recombinant CPB. The arrow indicates the recombinant protein (about 26 kDa) and the arrowheads, the products of proteolysis. (C) Active site titration of the recombinant CPB using the irreversible protease inhibitor E-64. Residual activity % (Relative Fluorescence Units) was measured by the ratio between the enzyme activity in absence or presence of increasing concentrations of E-64.

Analysis of CPB expression in P. pastoris.

(A) SDS-PAGE showing the supernatants of non- transformed Pichia pastoris X-33, and aliquots from 0 to 144 hours of the transformed clone pPIC-CPB2.8#25 induced with methanol. The arrow indicates the expected size for active (processed) CPB. The arrowhead indicates the unprocessed protein after 24 and 48 h induction. MW: molecular weight Bench Mark (Invitrogen). (B) Analysis of L. mexicana CPB after purification and dialysis. Coomassie-stained SDS-PAGE 15% showing in MW: molecular weight Page Ruler (Thermo Scientific); 1, the purified and dialyzed recombinant CPB. The arrow indicates the recombinant protein (about 26 kDa) and the arrowheads, the products of proteolysis. (C) Active site titration of the recombinant CPB using the irreversible protease inhibitor E-64. Residual activity % (Relative Fluorescence Units) was measured by the ratio between the enzyme activity in absence or presence of increasing concentrations of E-64. Protein production started at 24 h and increased until 144 h after methanol induction. At 24 h and 48 h, it is observed bands above 30 kDa that disappear after 72 hours, probably due to medium acidification, leading to the loss of the pro-peptide and conversion of the enzyme to its active form around 26 kDa [29]. Therefore, this clone was chosen for scaling-up production (100 mL) at 96 h, followed by protein purification. The clone pPICZαA#25 was cultivated for 96 h, and the purification of CPB was performed according to the EasySelect Pichia Expression kit (Invitrogen) and further analyzed by 15% SDS-PAGE. The protein was eluted at imidazole 75 mM, presenting a major band around 26 kDa, although low levels of protein were also detected in all concentrations of imidazole (Fig 2B). After quantification, a total of 40 mg L-1 of protein was obtained. The expected size for the fully active form of the protein, approximately 26 kDa (without the pro-peptide) was observed after dialysis. The additional bands might be the result of auto-proteolysis leading to the auto-cleavage of the N-terminus, i.e., the proteolysis products that are fused to the His-tag were purified in the column. Thus, to circumvent the auto-proteolysis process and to determine the percentage of active enzyme present in the purified sample, an active site titration was performed using the cysteine protease inhibitor, E-64 (Fig 2C), according to Barrett et al. (1981) [33], showing that the percentage of the active enzyme was 80%, corresponding to 32 mg L-1 of purified recombinant and active enzyme.

Antileishmanial activity and inhibition of CPB by N-oxide derivatives

Furoxan (4a-4o) and benzofuroxan (4p-4x) antileishmanial activities against L. infantum intracellular amastigotes as well as their inhibitory effect against CPB were investigated. The furoxan derivatives (4a-4h, 4l and 4m) and the benzofuroxan (4r), exhibited anti-amastigote potency (EC50) lower than < 10 μM. These molecules were also able to target the CPB at different levels ranging from 0.8 to 8.8 μM (Table 2). Moreover, except for 4c and 4r, the cytotoxicity of the aforementioned compounds was at least 50 times more selective to the parasite rather than to the macrophages, considering the SI values (Table 2). Interestingly, although the furoxan (4j - 4n) and benzofuroxan (4q, 4u, 4t) inhibited the recombinant enzyme, they did not affect the parasite viability.
Table 2

Inhibition of CPB, biological activities, and safety by furoxan and benzofuroxan derivatives (μM).

CompoundIC50EC50CC50SI
Furoxan Lapdesf14e 3.1 ± 0.43.1 ± 0.1208.3 ± 0.266.4
4a 1.5 ± 0.11.4 ± 0.1> 500357
4b 3.2 ± 0.33.1 ± 0.2166.0 ± 0.554
4c 2.0 ± 0.17.2 ± 0.2122.0 ± 20.017
4d 1.8 ± 0.13.9 ± 0.4> 500128
4e 0.8 ± 0.10.6 ± 0.1> 500833
4f 4.5 ± 0.13.6 ± 0.1> 500139
4g 6.5 ± 1.02.2 ± 0.3> 500227
4h 8.8 ± 0.23.1 ± 0.2> 500161
4i 5.7 ± 0.4> 10> 500-
4j 11.1 ± 0.1> 10> 500-
4l 10.8 ± 2.37.7 ± 2.1> 50065
4m 6.0 ± 0.76.4 ± 1.1> 50078
4n 13.7 ± 1.8> 10> 500-
4o > 20> 10> 500-
Benzofuroxan 8a* > 8018.2 ± 0.163.23.5
4p > 20> 10> 500-
4q 14.0 ± 2.0> 10> 500-
4r 3.4 ± 0.19.5 ± 0.6103.2 ± 2.711
4s > 20> 10152.0 ± 18.0-
4t 4.2 ± 0.2> 1017.2 ± 0.7-
4u 11.7 ± 0.5> 10265.0 ± 5.0-
4v > 20> 10> 500-
4x > 20> 10246.2 ± 0.2-
N-acylhydrazone 14a 2.0 ± 0.1> 10> 500-
14b 11.7 ± 1.0> 10> 500-
14c 2.0 ± 0.3> 10> 500-
14d 2.0 ± 0.1> 10> 500-
14e 1.2 ± 0.1> 10> 500-
14f 4.0 ± 0.1> 10> 500-
14g 7.6 ± 2.1> 10> 500-
Control Amphotericin B -1.0 ± 0.112.1 ± 1.812

IC50—Inhibition of CPB. EC50—Effective Concentration that kills 50% of L. infantum amastigote forms. CC50—Cytotoxic Concentration to kill 50% of murine peritoneal macrophages, all compounds were evaluated from 7.5 to 500 μM. SI—Selective Index (CC50/EC50) [20, 21].

IC50—Inhibition of CPB. EC50—Effective Concentration that kills 50% of L. infantum amastigote forms. CC50—Cytotoxic Concentration to kill 50% of murine peritoneal macrophages, all compounds were evaluated from 7.5 to 500 μM. SI—Selective Index (CC50/EC50) [20, 21]. To provide comprehensive proof of concept regarding the effect of the N-acylhydrazone on CPB, a series of hydrazone derivatives (14a-14e) was also evaluated. Although none of them exhibited antileishmanial activity (EC50 >10 μM), they were able to inhibit CPB at different IC50 levels, ranging from 1.2 to 11.7 μM.

Molecular docking analyses

Molecular docking was carried out to comprehend the pose of synthesized furoxan (4a-o), benzofuroxan (4p-x) and hydrazone derivatives (14a-g) into the CPB active site. The docking results of the N-acylhydrazones series (14a-g) suggested an interaction between the N-H of the compounds and the CYS26 residue of the catalytic site (Fig 3A). Except for hydrazone 14e, which contains a bulky group, similar poses were observed for all other N-acylhydrazones. The contribution of the N-oxide group of the furoxans and benzofuroxans (4a-x) was orientated on the S1’ pocket, performing an interaction between a cation-π and the TRP186 residue (Fig 3B and 3C). Additionally, the imine carbon (C = N) of the N-acylhydrazone moiety (4a-x) has been positioned near the CYS26 at an average distance of 3.56 Å and the N-H of their scaffolds interacts with ASN163 residue through an H-bond (Fig 3B and 3C).
Fig 3

Ligand-CPB complex predicted by molecular docking.

Possible poses and interactions performed by compounds 14a (A), 4a (B) and 4e (C) against CPB. Superposition of 4a (beige), 14a (cyan) and 14e (pink). The yellow surface represents CYS26 and dark blue is HIS164.

Ligand-CPB complex predicted by molecular docking.

Possible poses and interactions performed by compounds 14a (A), 4a (B) and 4e (C) against CPB. Superposition of 4a (beige), 14a (cyan) and 14e (pink). The yellow surface represents CYS26 and dark blue is HIS164. Superposition of 14a, 4a, and 4e revealed an occupancy of the S2 pocket by the phenyl ring of the phenylfuroxan derivatives (4a-g) (Fig 3). Besides, a hydrophobic interaction between the furoxan 4e and the S2 pocket, not observed for the hydrazone 14a, might explain the two-fold higher inhibitory enzyme activity exhibited by the furoxan. The improvement on the occupancy by phenylfuroxan derivatives (4a-g) in the CPB can also explain the better inhibitory effect of this series compared with its respective hydrazones (14a-g) (Fig 3).

In silico ADME studies

In an attempt to select the best hit among the most potent and selective compounds (4a-h, l, and m), we performed in silico analyses using the SwissADME tool [41] to investigate physicochemical properties, pharmacokinetic parameters, and drug-likeness (S1 Table). Amide compounds exhibiting moderate to high solubility, 4a-c and 4f displayed better drug likeness by complying with Lipinski rule of five and the filters Ghose, Veber, Egan, and Muegge in contrast to 4d, 4e, 4g, 4h, 4l, and 4m, which violates some of the properties/descriptors. The analysis of potential binding to main cytochrome CYP450, a superfamily of liver isoenzymes responsible for the metabolization of xenobiotics, suggests a non-promiscuous behavior of compounds 4f, 4h, and 4l since they show potential to inhibit only one isoenzyme (CYP1A2 or CYP2C19). Hence, considering that 4f combines both relevant bioactivity properties and the most favorable ADME parameters, highlighting its potential gastrointestinal absorption potential, this compound was selected for further in vivo studies to evaluate its potential efficacy and toxicity in L. infantum infected mice after oral delivery.

In vivo studies

Parasite load

The compound 4f was investigated concerning its capacity to reduce parasite load in both liver and spleen of L. infantum-infected Balb/C mice. Therefore, nine days post-infection, 4f at four different doses (0.28, 0.85, 2.56, and 7.7 mg/kg/day) or the reference drug miltefosine (7.7 mg/kg/day) were orally administered twice a day for five days. Parasite load evaluation showed that 4f (0.28 mg/kg/day) was able to reduce the number of amastigotes in both organs by 67–68% (Fig 4A and 4B), whilst the highest 4f dose (7.7 mg/kg/day) induced a reduction similar to that obtained for the reference drug, i.e., ~90% in both spleen and liver.
Fig 4

Parasite load evaluation.

The LDU index (number of Leishmania amastigotes in 1,000 nucleated cells per organ weight) was determined in the spleen (A) and liver (B) of L. infantum infected BALB/c mice using. The data are expressed as average ± SD. Control: Infected and non-treated animals. MT: miltefosine. *: Statistically significant difference in all groups compared to the Infected and non-treated animals (p < 0.0001). #: Not statistically significant (p > 0.05).

Parasite load evaluation.

The LDU index (number of Leishmania amastigotes in 1,000 nucleated cells per organ weight) was determined in the spleen (A) and liver (B) of L. infantum infected BALB/c mice using. The data are expressed as average ± SD. Control: Infected and non-treated animals. MT: miltefosine. *: Statistically significant difference in all groups compared to the Infected and non-treated animals (p < 0.0001). #: Not statistically significant (p > 0.05).

In vivo quantification of biomarkers

The plasma levels of AST, ALP, ALT, total bilirubin, and creatinine were monitored to investigate liver and renal functions in healthy and L. infantum-infected mice treated (different doses of 4f or miltefosine) and control. Total bilirubin levels in L. infantum-infected mice increased in contrast to the healthy ones (S2 Fig), whereas no significant alterations were observed for both 4f and miltefosine treatment in comparison to the infected animals. Besides, no alterations were observed for any group to creatinine (S2 Fig). The levels of AST, ALP, ALT, and creatinine were similar in both treated and healthy groups (S2 Fig).

Discussion

The current antileishmanial therapy exhibits several drawbacks, including long-term treatment, adverse side effects, low efficacy, and difficult route of administration, making urgent the need for more effective and safer treatments. Herein, we described the synthesis and antileishmanial properties of new N-oxide derivatives, developed based on the prototype Lapdesf14e focusing on a dual effect: CPB inhibition and NO-release [20, 47]. The herein explored CPB is mainly expressed in amastigotes and has been assigned as a validated target for Leishmania drug discovery due to its important role in parasite escape from the host immune system, thus favoring parasite establishment and proliferation [8, 48, 49]. The CPB consists of active sites comprising pockets or subsites known as S1, S2, S3 (along with the catalytic cysteine to the C-terminal region), and S1’ (along with the catalytic cysteine to the N-terminal region), interacting with the substrates P1, P2, P3 and P1’ [50, 51]. Indeed, several CPB inhibitors have been described, including both natural products [52-55] and synthetic compounds [12, 16, 56, 57]; however, none of them are N-oxide derivatives. The performed molecular docking analyses suggested that the furoxan N-oxide subunit interacts with the S1’ pocket through a cation-π interaction with the TRP186 residue. Noteworthy, for the phenyl furoxan derivatives (4a-g), the S2 pocket is occupied by a phenyl ring attached to C-3, which in association to the hydrophobic nature, might be positively contributing to the observed levels of enzyme inhibition ranging from 0.8 to 6.5 μM in contrast to the lower inhibition activity (6 to >20μM) related to the amide furoxans (4h-o). Indeed, Fey et al. (2018) also reported the binding nature of the aziridine-containing phenylpropil ester groups to the S2 pocket in association with studies of mechanisms of enzyme inhibition [13]. Furthermore, the benzofuroxans (4q, 4r, 4t, 4u) also interact with the S1 and S1´pocket, contributing to the enzyme inhibition at different levels (3.4 to 14 μM). Hereafter, the enzymatic inhibitory properties of the N-oxide derivatives were assessed using the recombinant enzyme CPB, which was alternatively expressed in P. pastoris, overcoming solubility issues commonly associated with the purified enzyme obtained in bacteria [29]. Although other studies suggested that protease inhibition might be caused by nitrosylation of cysteine residues of CPB [58-60], the NO-releasers phenyl and amide furoxans (4a-o) derivatives herein evaluated displayed corresponding levels of CPB inhibition (IC50 ranging from 0.8–13 μM) to those N-acylhydrazone derivatives (14b-g) that do not present NO-release capacity (IC50 ranging from 1.2 μM– 7.6 μM). Thus, besides the pharmacodynamics improvements based on Lapdesf14e allied to the inhibition of the targeted protease, we cannot exclude a contribution of the NO to the antileishmanial activity due to a pleiotropic effect caused by nitrosylation of other parasite proteins/enzymes rather than the cysteine CPB, which might be inducing metabolic/ signaling pathway disruption, ultimately contributing to parasite death [21, 47, 61]. Indeed, all the furoxans derivatives, except 4i, 4j, and 4n, presented anti-L. infantum amastigote activity lower than 10 μM. Although there are several natural and synthetic CPB inhibitors reported [12, 16, 43–48], none of them have been further preclinical evaluated in visceral leishmaniasis models, except for compound K11777, which entered the clinical trials for Chagas disease and was later abandoned due to safety issues [11]. On the other hand, there are few oral antileishmanial compounds active against visceral leishmaniasis at phase I of clinical studies, and at this moment, none of them have their mechanisms of action described [62], which turns difficult further improvements based on medicinal chemical approaches. Thus far, infected mice treated with 4f at 7.7mg/kg/day was able to decrease the parasite load by 90%, consistent with miltefosine in the experimental conditions of this work and accordance with the hit-to-lead criteria established to the drug discovery field of neglected diseases [63]. Furthermore, even at a dose three times lower (2.56 mg/kg/day), the parasite reduction was 77% (0.28 mg/kg/day), successfully indicating a robust reduction of the parasite burden at the target organs in mice, without causing any evident side effect, even at the highest dose, following the biochemical markers evaluated in this study. Noteworthy such significant parasite load reduction was achieved in a short-term treatment (five days). Altogether, these data, in contrast to the long-term (15 days) intraperitoneal administered Lapdesf14e, which decreased by 50% the parasite load in L. infantum-infected hamsters [14], revealed the success of the adopted strategy of hit optimization herein adopted and pinpoints 4f as a new oral antileishmanial compound ready to further advance to the next steps towards the clinical phase of evaluation.

Additional 1H and 13C NMR information.

(DOCX) Click here for additional data file.

Theoretical ADME properties of furoxan and benzofuroxan derivatives.

(DOCX) Click here for additional data file.

Clone pPICZαA_CPB2.8 #2 sequence.

The clone was sequenced using α factor (TACTATTGCCAGCATTGCTGC) and reverse 3’AOX1(GCAAATGGCATTCTGACATCC), and the elements inserted on plasmid (EcoRI—blue and Sal I–grey, sites) were identified upstream and downstream of CPB2.8 gene, respectively. (TIF) Click here for additional data file.

Evaluation of biochemical toxicity markers for healthy mice, infected and untreated with L. infantum and treated with 4f or miltefosine.

Levels of (A) AST—aspartate aminotransferase; (B) ALP—alkaline phosphatase levels; (C) ALT—alanine aminotransferase; (D) Urea; (E) Total bilirubin levels and (F) Creatinine. The data are expressed as average ± SEM. #: Statistically significant compared to the Infected and Untreated animals (p < 0.05). *: Statistically significant compared to the healthy animals (p < 0.05). †: Statistically significant compared to the animals treated with the reference drug miltefosine (p < 0.05). No statistical significance was observed for creatinine compared to healthy and Untreated animals. (TIF) Click here for additional data file. (PDF) Click here for additional data file. 6 Sep 2021 PONE-D-21-22172Design, Synthesis and Biological Evaluation of N-oxide Derivatives with Potent In Vivo Antileishmanial ActivityPLOS ONE Dear Dr. Graminha, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Oct 21 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Bhaskar Saha Academic Editor PLOS ONE Journal requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 3. Thank you for stating the following financial disclosure: “NO” At this time, please address the following queries: a)        Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution. b)        State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” c)        If any authors received a salary from any of your funders, please state which authors and which funders. d)        If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. Thank you for stating the following in the Acknowledgments Section of your manuscript: “This study was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP Process: 2016/09502-7, 2016/06931-4, 2018/17739-2, 2018/11079-0 and 2017/03552-5). Programa de Apoio ao Desenvolvimento Científico da Faculdade de Ciências Farmacêuticas da UNESP – PADC. This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). L.C.C. is CNPq PhD student fellow (143334/2017-4). I.M.P is CNPq postdoctoral fellow (153581/2018-2). J.L.S, F.H.S. and M.A.S.G are recipient of a Research Productivity Scholarship from the National Council for Research and Development (CNPq Ref. Process: 304731/2017-0, 311746/2017-9 and 305174/2020-7, respectively). The authors are grateful to Profº André Tempone and Felipe Torres for Leishmania infantum (MHOM/MA67IMA263) donation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: “MASG (2017/03552-5 and 2016/06931-4) FAPESP - The São Paulo Research Poundation and (305174/2020-7) CNPq - National Council for Scientific and Technological Development JLS (2018/11079-0) FAPESP - The São Paulo Research Poundation and (304731/2017-0) CNPq - National Council for Scientific and Technological Development FHS (311746/2017-9) CNPq - National Council for Scientific and Technological Development LCC (143334/2017-4) CNPq - National Council for Scientific and Technological Development IMP (153581/2018-2) CNPq - National Council for Scientific and Technological Development GFSF (2016/095502-7) (2018/17739-2) - FAPESP - The São Paulo Research Foundation CNPq: https://www.gov.br/cnpq/pt-br FAPESP: https://fapesp.br/en/about Did the sponsors or funders play any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript? NO.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 6. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Additional Editor Comments (if provided): The manuscript reports synthesis of 24 compounds which are tested on Leishmania-infected BALB/c mice for their anti-leishmanial activities. The identified one compound show significant anti-leishmanial activity in both spleen and liver. However, the manuscript requires several moderations as follows: 1. Please merge Figures 2, 3 and 4 into one - Figure 2 2. Please merge Figures 5 and 6 into one - Figure 3 3. Please merge Figure 7 and 8 into one - Figure 4 4. Please move Figure 9 into supplementary figure. This will help shorten the manuscript. Please check the composition of the manuscript. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Minor Revision 1. Page 24, Line 566, the figure legend needs to be written more elaborately. 2. Figure Number 5 is unreadable. 3. Page no 28, line number 601, figure number 6B and 6C is cited. No figure 6B and 6C is in the paper. 4. Page no 28, line no 607, figure 7 is cited, the description does not match with figure7. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 10 Sep 2021 Thank you for all the critiques/suggestions. All answers required are in the letter (Response to Reviewers) that responds each point raised by the academic editor and reviewer. We also performed a careful revision of our Financial Support that should be used to change the online submission form on our behalf. We hope that with all the additions and modifications made to the text, this version of the manuscript is clearer to the readers and suitable to be now accepted to be published at PLos One. We are looking forward to hearing from you soon. Submitted filename: Response to Reviewers (1).docx Click here for additional data file. 11 Oct 2021 Design, synthesis and biological evaluation of N-oxide derivatives with potent in vivo antileishmanial activity PONE-D-21-22172R1 Dear Dr. Graminha, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Bhaskar Saha Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 21 Oct 2021 PONE-D-21-22172R1 Design, synthesis and biological evaluation of N-oxide derivatives with potent in vivo antileishmanial activity Dear Dr. Graminha: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Bhaskar Saha Academic Editor PLOS ONE
  59 in total

1.  High-throughput screening for expression of heterologous proteins in the yeast Pichia pastoris.

Authors:  Mewes Boettner; Bianka Prinz; Caterina Holz; Ulf Stahl; Christine Lang
Journal:  J Biotechnol       Date:  2002-10-09       Impact factor: 3.307

2.  Cleavage of structural proteins during the assembly of the head of bacteriophage T4.

Authors:  U K Laemmli
Journal:  Nature       Date:  1970-08-15       Impact factor: 49.962

3.  Benzophenone derivatives as cysteine protease inhibitors and biological activity against Leishmania(L.) amazonensis amastigotes.

Authors:  Letícia de Almeida; Karina Ferreira Alves; Claudia Mara Maciel-Rezende; Larissa de Oliveira Passos Jesus; Francieli Ribeiro Pires; Claudio Viegas Junior; Mario Augusto Izidoro; Wagner Alves de Souza Júdice; Marcelo Henrique dos Santos; Marcos José Marques
Journal:  Biomed Pharmacother       Date:  2015-09-20       Impact factor: 6.529

Review 4.  Cysteine protease inhibitors as chemotherapy for parasitic infections.

Authors:  J H McKerrow; J C Engel; C R Caffrey
Journal:  Bioorg Med Chem       Date:  1999-04       Impact factor: 3.641

5.  Drug targets in Leishmania.

Authors:  Bhavna Chawla; Rentala Madhubala
Journal:  J Parasit Dis       Date:  2010-10-08

6.  Broad Spectrum and Safety of Oral Treatment with a Promising Nitrosylated Chalcone in Murine Leishmaniasis.

Authors:  Ariane J Sousa-Batista; Douglas Escrivani-Oliveira; Camila Alves Bandeira Falcão; Cintia Iana Monteiro da Silva Philipon; Bartira Rossi-Bergmann
Journal:  Antimicrob Agents Chemother       Date:  2018-09-24       Impact factor: 5.191

7.  Leishmanicidal, antiproteolytic and antioxidant evaluation of natural biflavonoids isolated from Garcinia brasiliensis and their semisynthetic derivatives.

Authors:  Vanessa Silva Gontijo; Wagner A S Judice; Barbara Codonho; Ivan Oliveira Pereira; Diego Magno Assis; Jaqueline Pereira Januário; Elide E Caroselli; Maria Aparecida Juliano; Amanda de Carvalho Dosatti; Marcos José Marques; Claudio Viegas Junior; Marcelo Henrique dos Santos
Journal:  Eur J Med Chem       Date:  2012-06-28       Impact factor: 6.514

8.  Oral activity of the antimalarial endoperoxide 6-(1,2,6,7-tetraoxaspiro[7.11]nonadec-4-yl)hexan-1-ol (N-251) against Leishmania donovani complex.

Authors:  Kofi Dadzie Kwofie; Kai Sato; Chizu Sanjoba; Akina Hino; Rieko Shimogawara; Michael Amoa-Bosompem; Irene Ayi; Daniel A Boakye; Abraham K Anang; Kyung-Soo Chang; Mitsuko Ohashi; Hye-Sook Kim; Nobuo Ohta; Yoshitsugu Matsumoto; Shiroh Iwanaga
Journal:  PLoS Negl Trop Dis       Date:  2019-03-25

9.  Sertraline Delivered in Phosphatidylserine Liposomes Is Effective in an Experimental Model of Visceral Leishmaniasis.

Authors:  Maiara Maria Romanelli; Thais Alves da Costa-Silva; Edezio Cunha-Junior; Daiane Dias Ferreira; Juliana M Guerra; Andres Jimenez Galisteo; Erika Gracielle Pinto; Leandro R S Barbosa; Eduardo Caio Torres-Santos; Andre Gustavo Tempone
Journal:  Front Cell Infect Microbiol       Date:  2019-10-29       Impact factor: 5.293

10.  Design, Synthesis, and Characterization of N-Oxide-Containing Heterocycles with in Vivo Sterilizing Antitubercular Activity.

Authors:  Guilherme Felipe Dos Santos Fernandes; Paula Carolina de Souza; Elsa Moreno-Viguri; Mery Santivañez-Veliz; Rocio Paucar; Silvia Pérez-Silanes; Konstantin Chegaev; Stefano Guglielmo; Loretta Lazzarato; Roberta Fruttero; Chung Man Chin; Patricia Bento da Silva; Marlus Chorilli; Mariana Cristina Solcia; Camila Maríngolo Ribeiro; Caio Sander Paiva Silva; Leonardo Biancolino Marino; Priscila Longhin Bosquesi; Debbie M Hunt; Luiz Pedro S de Carvalho; Carlos Alberto de Souza Costa; Sang Hyun Cho; Yuehong Wang; Scott Gary Franzblau; Fernando Rogério Pavan; Jean Leandro Dos Santos
Journal:  J Med Chem       Date:  2017-10-16       Impact factor: 7.446

View more
  2 in total

1.  Antiparasitary and antiproliferative activities in vitro of a 1,2,4-oxadiazole derivative on Trypanosoma cruzi.

Authors:  Yasmim Mendes Rocha; Emanuel Paula Magalhães; Marlos de Medeiros Chaves; Márcia Machado Marinho; Valentina Nascimento E Melo de Oliveira; Ronaldo Nascimento de Oliveira; Tiago Lima Sampaio; Ramon R P P B de Menezes; Alice M C Martins; Roberto Nicolete
Journal:  Parasitol Res       Date:  2022-05-25       Impact factor: 2.289

2.  Design and Synthesis of Hybrid Compounds as Epigenetic Modifiers.

Authors:  Juliana Romano Lopes; Igor Muccilo Prokopczyk; Max Gerlack; Chung Man Chin; Jean Leandro Dos Santos
Journal:  Pharmaceuticals (Basel)       Date:  2021-12-15
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.