Assessing the potential role of copper and cobalt in stimulating angiogenesis for tissue regeneration.

The use of copper (Cu2+) and cobalt (Co2+) has been described to stimulate blood vessel formation, a key process for the success of tissue regeneration. However, understanding how different concentrations of these ions affect cellular response is important to design scaffolds for their delivery to better fine tune the angiogenic response. On the one hand, gene expression analysis and the assessment of tubular formation structures with human umbilical vein endothelial cells (HUVEC) revealed that high concentrations (10μM) of Cu2+ in early times and lower concentrations (0.1 and 1μM) at later times (day 7) enhanced angiogenic response. On the other hand, higher concentrations (25μM) of Co2+ during all time course increased the angiogenic gene expression and 0.5, 5 and 25μM enhanced the ability to form tubular structures. To further explore synergistic effects combining both ions, the non-toxic concentrations were used simultaneously, although results showed an increased cell toxicity and no improvement of angiogenic response. These results provide useful information for the design of Cu2+ or Co2+ delivery scaffolds in order to release the appropriate concentration during time course for blood vessel stimulation.

1 Introduction

Tissue regeneration involves different sequential phases in which blood vessel formation is one of the essential phases to ensure a successful tissue formation. For instance, bone regeneration is a multi-step process involving different events such as inflammation of damaged zone, blood vessel formation (angiogenesis), recruitment of osteoprogenitor cells to the zone of healing and their subsequent osteogenic differentiation for bone formation [1]. Bone has a native capacity to regenerate itself in situations in which the size of the defect is small, such as cracks and small fractures. However, when the size of the defect exceeds the critical size, bone has a limited capacity to regenerate itself [2]. Among the different events that take place in bone regeneration, blood vessel formation has been recognized as one of the key processes for the success of bone fracture healing, showing limited regeneration when the vascular network was poorly developed [3]. For this reason, bone defects exceeding ≥ 2.5 cm are unable to regenerate without aid [2], mainly due to lack of vascularization, which leads to necrosis and cell death. Vascularization is generally triggered by the appearance of growth factors that are naturally found in the tissues during regenerative processes and have been proved to be successful in angiogenesis stimulation, as long as a graft is present in the site of defect. In order to mimic the natural angiogenesis process that will eventually promote bone tissue regeneration, the use of synthetic grafts combined with growth factors, such as vascular endothelial growth factor (VEGF), have been used to stimulate blood vessel formation [4]. However, they have delicate handling properties and short half-life. An alternative approach to mimic native cellular functions is the use of ions, which have shown similar functionality as growth factors and that are as well intrinsically found in the human body at low concentrations or as trace elements [5, 6]. An advantage of ions compared to growth factors is their higher stability, allowing longer periods of storage and an easy manipulation [7]. Therefore, in the last years, ions have been considered as a promising alternative.

Among the biological active metal ions, copper (Cu2+) and cobalt (Co2+) have been proposed as good candidates for angiogenesis stimulation, as both ions are described to mimic hypoxic conditions by up-regulating hypoxia inducible factor-1α (HIF-1α). This, in turn, up-regulates angiogenic-related genes, such as vascular endothelial growth factor (VEGF), and therefore, triggers blood vessel formation [8, 9]. Despite their great potential, the doses released from synthetic grafts and hence administered into the site of defect should be in the therapeutic window while avoiding the induction of cytotoxicity. There are several strategies to incorporate ions within these synthetic grafts, allowing a fine tuning of their release upon implantation [10]. Despite the significant number of scaffolds that have incorporated these ions into their structure, the optimum concentrations required at each time point of the angiogenic response are still unknown. Generally, ion release from scaffolds is measured as a cumulative release after several days, obtaining the angiogenic response at the end point of the experiment [11, 12] or in a single time point during the course of the experiment [13-16], which is generally never in the initial hours [17-19]. Hence, it is difficult to understand and design novel scaffolds with optimum concentrations as well as with the adequate release patterns that will match the exact time points at which the different ions need to be present. For this purpose, tissue engineering and scaffold design have the need of systematic experimental plan to unravel these concentrations.

While the use of individual metal ions has proved to be beneficial for the stimulation of different cell functions, combinatorial approaches have demonstrated to induce synergistic effects. For instance, the combination of silicon (Si4+) and strontium (Sr2+) increased the expression of angiogenic genes, such as VEGF and KDR, in HUVEC cells in vitro, and significantly increased the percentage of blood vessel area formation in vivo [20]. In another study, authors demonstrated a significantly stronger stimulatory effect up-regulating angiogenic growth factors when Cu2+ and Si2+ were combined together, requiring lower doses of each one compared with their individual effect [21]. Therefore, the combination of ions might serve as another strategy to stimulate blood vessel formation.

In this study, we aimed to screen a range of concentrations of two hypoxia mimicking ions (Cu2+ and Co2+) in order to evaluate their non-toxic concentrations and, at the same time, to evaluate how different concentrations affects the angiogenic response during early (hours) and later (days) time points. Furthermore, the possible synergistic combinatorial effect of these non-toxic ion concentrations was assessed, in order to open the possibility of combining ions to stimulate angiogenesis as this has not been studied before. Overall, the results may provide insights of how to design tissue engineering scaffolds that release ions for the early control of angiogenesis.

2 Materials & methods

2.1. Cell culture

Human Umbilical Vein Endothelial Cells (HUVEC; Lonza) were used to assess the angiogenic response. For cell expansion, HUVEC were seeded at a density of 2500 cells/cm2 and maintained with endothelial growth medium-2 bulletkit (EGM-2) (Lonza; Ref. H3CC-3162), containing VEGF, rhFGF-B, rhEGF, r-IGF-I, hydrocortisone, ascorbic acid, gentamicin sulfate, amphotericin-B and 2% FBS. When cells reached 70–85% confluence, they were passaged using 0.25% Trypsin-EDTA (Gibco). Cells were maintained in standard culture conditions (37°C and 5% CO2). Passages equal or below P5 were used for subsequent assays. Preliminary experiments tested two types of cell culture media supplemented with ions: i) basal medium (Lonza; Ref. CC-3156), supplemented with 2% FBS and amphotericin-B; ii) and EGM-2 medium, previously described.

2.2. Cell cytotoxicity assay

CuCl2 and CoCl2 (both from Sigma-Aldrich) were used as a source for cell culture media supplementation for Cu2+ and Co2+, respectively. For viability assay, concentrations of Cu2+ tested were 0, 0.1, 1, 10, 100 and 200 μM and for Co2+ concentrations assessed were 0, 0.5, 5, 25, 50 and 100 μM. HUVEC were seeded at a density of 5000 cells/cm2. After 24h of seeding, the culture with ion supplemented medium started for a total of 7 days, with change of media every two days. Viability of cells was assessed using a commercially colorimetric available kit, specifically the Cell Counting Kit-8 (CCK-8) (Sigma-Aldrich). This kit contains a water-soluble tetrazolium salt WST-8 which is reduced by dehydrogenases of cells, resulting in a yellow-colored product (formazan). The amount of formazan generated is considered directly proportional to the number of viable cells, and has an absorbance spectrum peak at 450–460 nm. CCK-8 was performed according to manufacturer’s instructions. Briefly, at time points of 2 and 7 days after medium supplementation with ions, CCK-8 solution was added in each well and incubated with cells for 3 hours. After this period, supernatant was placed in a 96 well plate (Greiner bio-one) and the absorbance was read at 450 nm using a multi-detection microplate reader (Synergy HT, BioTek). Results were normalized with the control medium, which did not contain supplemented ion. Percentages over 80% were considered non-toxic. The viability of HUVEC cells was also assessed with the combination of Cu2+ and Co2+ with the highest and half of the highest non-toxic concentrations that induced an angiogenic response.

2.3. Cell morphology with phalloidin

Cell morphology and organization was performed by immunofluorescence of actin filament staining with phalloidin (Acti-stain 488 fluorescent phalloidin, Cytoskeleton, Inc). For this purpose, 24 well plate coverslips were autoclaved and placed in each well. Then, 20 μL of 1% sterilized gelatin (Sigma-Aldrich) was added on the surface of each coverslip and incubated at room temperature for 30 min. Afterwards, the excess of gelatin was aspirated and 24 well plates were placed in the incubator at 37°C for 30 minutes. After this incubation period, cell culture media was added and HUVEC were seeded in each well with a density of 5000 cells/cm2. After 24h of seeding, the cell culture media was replaced with the one containing ion supplementation, with the concentrations that proved to be non-toxic. Control samples were cultured without ions supplementation. At the time points of 2 and 7 days after medium supplementation, cells were rinsed with PBS 1X and subsequently fixed with 4% PFA during 20 min at room temperature. Next, cells were rinsed three times with PBS 1X and permeabilized with 0.5% Triton-100x/PBS for 10 min. After three washes with PBS 1X, samples were incubated with 100 nM Acti-stain phalloidin (Cytoskeleton, Inc) for 30 min protected from light. Then, after PBS 1X rinsing, cells were incubated with DAPI (NucBlue Fixed Cell stain DAPI, LifeTechnologies) for 5 min. Finally, cells were rinsed one last time with PBS 1X and then, cover slips were detached from 24 well plate and mounted on a microscope slide with Fluoromount-G (BioNova). Samples were kept in the dark at 4°C and they were visualized by confocal laser microscopy (Leica SP8, LAS X software version 3.5.5.19976). Excitation/emission wavelengths were 480/520 nm for phalloidin and 405/460 for DAPI. Images were processed with the same confocal software (LAS X Life Science software, Leica).

2.4. Gene expression RT-qPCR

Gene expression was analyzed by quantitative real time polymerase chain reaction (qPCR) at early time points (1, 2, 4, 10 and 24h) and later time points (day 7 and 7) to assess the early and later angiogenic response, respectively. With the combination of ions, the gene expression was analyzed at day 2 and 7. Cell pellets were collected at time points above mentioned using 0.25% Trypsin-EDTA (Gibco) and spin centrifugation of 1500 rpm for 5 min. Then, total RNA was isolated from cells using NucleoSpin RNA Kit (Macherey-Nagel) including DNAse treatment step following manufacturer’s instructions. Quantification of isolated RNA was performed using a microvolume plate (Take 3) to measure absorbance ratio of wavelengths 260/280 nm in a microplate reader (Synergy HT Multi-detection Microplate Reader, BioTek). A ratio of ~2 was considered pure RNA. Reverse-transcription (RT) of RNA to cDNA was performed using Transcriptor First Strand cDNA Synthesis Kit (Roche) following manufacturer’s instructions using T100 Thermal Cycler (Bio-Rad). For the amplification and quantification of cDNA targets, QuantiNova SYBR Green PCR kit (Qiagen) was used following manufacturer’s instructions. Briefly, 20 ng of cDNA per reaction were amplified under the following conditions: an initial heat activation step of 2 min at 95°C followed by 40 cycles of denaturation for 5s at 95°C and annealing/extension for 10s at 60°C, using a CFX96 Real-Time PCR Detection System (Bio-Rad). The primers sequences used for vascular endothelial growth factor (VEGF), hypoxia-inducible factor 1-alpha (HIF-1α), platelet endothelial cell adhesion molecule-1 (PECAM-1) and the endogen gen beta-actin (β-Actin) are listed in Table 1. To normalize data, β-Actin was used as internal reference for each reaction. Relative expression was calculated using the 2-ΔΔCt method and all data of conditions tested were expressed as fold-changes compared to each time point control to better elucidate the angiogenic effects of the ions through time course.

Table 1

List of primers sequences used for cDNA amplification in RT-qPCR.

	Gene	Primer	Sequence (5’-3’)
Endogen	β-Actin	Forward	AGAGCTACGAGCTGCCTGAC
		Reverse	AGCACTGTGTTGGCGTACAG
Angiogenic	VEGF	Forward	CCCACTGAGGAGTCCAACAT
		Reverse	AAATGCTTTCTCCGCTCTGA
	HIF-1α	Forward	TGCTCATCAGTTGCCACTTC
		Reverse	TCCTCACACGCAAATAGCTG
	PECAM-1	Forward	TCAAATGATCCTGCGGTATTC
		Reverse	CCACCACCTTACTTGACAGGA

2.5. Matrigel assay for tubular formation

In vitro tubular formation analysis was performed using Matrigel® Growth Factor Reduced (GFR) (Corning® Matrigel®, Ref. 734–0268) with HUVEC cells in 96 well plates. First, 75 μL of Matrigel at 4°C were transferred to each well and incubated for 10 min at room temperature. After this period, plates were incubated in a humidified incubator at 37°C for 30 min. Then, 75 μL of cell culture media was added to each well. For the conditions of ion supplementation, the supplemented media contained doubled the final desired ion concentration (of non-toxic concentrations). Plates were incubated 30 min at 37°C. Then, 70 000 cells/cm2 were added in each well with a volume of 75 μL. At the time points of 4 and 8h, cells were rinsed once with PBS 1X and fixed with 4% PFA for 30 min. Afterwards, cells were rinsed three times and stored at 4°C with PBS 1X. There were three triplicates per condition and two fields per well were photographed using an inverted microscope coupled with a camera (Nikon Eclipse TS2-S-SM) and its software (IC Measure software). The phase contrast images were analyzed using the freely Angiogenesis Analyzer plugin of Image J. Number of nodes, number of meshes and total tubule length were analyzed.

2.6. Statistical analysis

Statistical analysis was performed using SPSS software (SPSS v21, IBM). Kruskal-Wallis and Mann Whitney U non-parametric tests were used to compare viability, gene expression and tubule formation (number of nodes, meshes and total tubule length) between experimental groups and control of the same time point (data represented as mean ± standard deviation; n = 4 for viability and n = 3 for gene expression and Matrigel assay for each condition). Spearman non-parametric test was used to study the correlation between HIF-1α and VEGF gene expression. Control samples were cells without any supplementation ion in cell culture media.

3 Results

3.1. Viability, proliferation and morphology

3.1.1. Copper (Cu2+)

In order to elucidate the ion concentrations which are not cytotoxic, HUVEC cells were cultivated under different copper (Cu2+) and cobalt (Co2+) concentrations. Additionally, their viability effect was tested with both basal and growth media, to find out which one was more appropriate to use for further assays. Generally, we could observe an increase of detached cells and cell debris (when HUVEC were cultivated with basal medium (BM) (S1 Fig) compared to growth medium (GM) (S2 Fig). Moreover, a reduction of cells was observed in a dose-dependent manner during culture time when Cu2+ was added in both cell culture mediums, which was more evident with BM.

Results of viability assays were in accordance with the observations of cell culture. With BM, all the concentrations tested resulted to be cytotoxic at the end of culture (S3 Fig). Alternatively, when HUVEC were cultured with GM supplemented with Cu2+, they presented a proper viability with Cu2+ concentrations up to 10 μM (Fig 1A). Due to these viability results, we considered to use GM for the subsequent assays.

Fig 1

HUVEC cultured with Cu2+ supplemented media.

(A) HUVEC viability cultured with different concentrations of Cu2+ (0, 0.1, 1, 10, 100 and 200 μM) at day 2 and 7. (B) HUVEC morphology cultured with different non-toxic concentrations of Cu2+ (0, 0.1, 1 and 10 μM) at day 2 and 7 (actin filament staining (green); nucleus (blue). Scale bar = 50 μm. Statistically significant differences were represented with * (p<0.05).

The influence of Cu2+ on cell morphology and arrangement was evaluated with actin filament staining. At day 2, no apparent differences between control and experimental groups were observed (Fig 1B). From 2 to 7 days, cells reached confluence and started to grow and proliferate over the monolayer, and some cells acquired an elongated phenotype.

3.1.2. Cobalt (Co2+)

Regarding HUVEC culture with BM supplemented with Co2+, there were high amounts of cell debris and detached cells compared with GM (S4 and S5 Figs). These observations were more evident when the concentration of Co2+ was increased, which was in accordance with viability results. With BM, all the concentrations resulted to be cytotoxic at the end of the experiment, (S6 Fig). Alternatively, when HUVEC cells were cultured with GM supplemented with Co2+, concentrations up to 50 μM demonstrated to be not toxic for HUVEC at the end of culture (Fig 2A). Considering the lower viability of cells with BM, we decided to use GM for the subsequent assays.

Fig 2

HUVEC cultured with Co2+ supplemented media.

(A) HUVEC viability cultured with different concentrations of Co2+ (0, 0.5, 5, 25, 50 and 100 μM) at day 2 and 7 (n = 4). (B) HUVEC morphology cultured with different non-toxic concentrations of Co2+ (0, 0.5, 5, 25 and 50 μM) at day 2 and 7 (actin filament staining (green); nucleus (blue). Scale bar = 50 μm. Statistically significant differences were represented with * (p<0.05).

With regards to HUVEC morphology, there were less number of cells with higher concentrations compared to control (Fig 2B). From day 2 to 7, HUVEC reached confluence and some cells proliferated over the monolayer with an elongated morphology although this was not observed with 50 μM.

3.2. Ion influence on angiogenesis gene expression

To further assess the potential of Cu2+ and Co2+ in stimulating angiogenic response in HUVEC, we analyzed the expression of three principal genes involved in the angiogenic response: HIF-1α, VEGF and PECAM-1. For this purpose, the gene expression profile was analyzed in a short period of hours (1, 2, 4, 10 and 24h), and subsequently, in longer periods (2 and 7 days), to assess the early and later angiogenic response, respectively.

3.2.1. Copper (Cu2+)

In general, within the initial hours, HUVEC cultured with Cu2+ showed only a significant increase at 10h with 10 μM concentration (Fig 3A). Regarding the VEGF expression profile, it is worth mentioning that all Cu2+ concentrations induced a significantly higher VEGF expression within 1h in a dose-dependent manner compared to control, and the conditions of 0.1 and 10 μM could also increase it at 10h (Fig 3B). Finally, PECAM-1 expression was significantly up-regulated at different time points (1, 10 and 24h) with different conditions, being 10 μM able to increase it in all of them (Fig 3C).

Fig 3

HUVEC gene expression profile cultured with Cu2+ within short (hours) and longer (days) time points.

Different Cu2+ concentrations were evaluated at 1, 2, 4, 10 and 24h for the gene expression of (A) HIF-1α, (B) VEGF and (C) PECAM-1. Different Cu2+ concentrations were also evaluated at 2 and 7 days for the expression of (D) HIF-1α, (E) VEGF and (F) PECAM-1. Data represented correspond to fold-changes compared to each time point control. Statistically significant differences were represented with * (p<0.05).

At day 2, HUVEC HIF-1α expression analysis revealed similar expression with no significant differences compared to control (Fig 3D). At day 7, HIF-1α was significantly increased with the lowest concentration of 0.1 and 1 μM. Regarding VEGF expression at day 2, all Cu2+ concentrations significantly up-regulated it compared to control, in a dose-dependent manner (Fig 3E). Remarkably, 10 μM concentration induced 2.5 fold VEGF expression compared to control, and at the same time, it was higher than VEGF expression induced by 0.1 and 1 μM. Interestingly, at day 7 all the concentrations tested induced a higher VEGF expression compared to control. It is worth mentioning that 0.1 μM induced the highest effect with two-fold VEGF expression. Finally, PECAM-1 expression remained the same for all experimental conditions at day 2 and was significantly increased in a dose-dependent manner by 0.1 and 1 μM at day 7 (Fig 3F).

As HIF-1α is described to transcribe VEGF gene, we further assessed if there was a correlation between HIF-1α and VEGF expression (S1 Table). Although a significant correlation at 2 and 4h was found, there was no significant and strong correlation between the gene expression of HIF-1α and VEGF.

3.2.2. Cobalt (Co2+)

When HUVEC were cultured with Co2+ supplementation, results of HIF-1α expression within initial hours in general revealed an up-regulation at 1, 10 and 24h (Fig 4A). Regarding VEGF expression, there was an up-regulation at 1, 2 and 10h (Fig 4B). It is worth mentioning that, at 1h, all Co2+ concentrations tested induced a higher VEGF expression compared to control, presenting 3 fold expression with 5 and 25 μM conditions. Finally, PECAM-1 expression was up-regulated at 1, 2, 10 and 24h, being worth to mention that 5 and 25 μM induced more than 3 fold expression at 1h (Fig 4C).

Fig 4

HUVEC gene expression profile cultured with Co2+ within short (hours) and longer (days) time points.

Different Co2+ concentrations were evaluated at 1, 2, 4, 10 and 24h for the gene expression of (A) HIF-1α, (B) VEGF and (C) PECAM-1. Different Co2+ concentrations were also evaluated at 2 and 7 days for the expression of (D) HIF-1α, (E) VEGF and (F) PECAM-1. Data represented correspond to fold-changes compared to each time point control. Statistically significant differences were represented with * (p<0.05).

In later time points, at day 2, HUVEC HIF-1α expression analysis showed a gradual increase in a dose-dependent manner, being a significant up-regulation with 5, 25 and 50 μM compared to control (Fig 4D). Later on, at day 7, only 25 μM induced a significant increase of HIF-1α expression. A similar trend was observed with VEGF expression. At day 2, there was a significant up regulation of VEGF for all concentrations tested in a dose-dependent manner, reaching 3-fold expression with 50 μM compared to its time point control (Fig 4E). At day 7, only 25 and 50 μM showed an up-regulation of VEGF expression. Finally, PECAM-1 expression at day 2 and 7 was significantly up-regulated by higher concentrations, specifically 25 and 50 μM, reaching almost 2.5 fold expression (Fig 4F).

As previously mentioned, HIF-1α is described to transcribe VEGF expression. For this reason, we further assessed if there was a correlation between HIF-1α and VEGF expression with Co2+ supplementation (S2 Table). Statistical results show significant and strong correlation between the expressions of these two genes.

3.3. Tubule formation ability

The ability of Cu2+ and Co2+ to promote formation of tubular-like structures was further assessed by culturing HUVEC on Matrigel substrate.

3.3.1. Copper (Cu2+)

In general, with Cu2+ supplementation, thicker tubular structures were observed in comparison to control samples with phase contrast images at 4 and 8 hours (Fig 5A). The results of number of nodes at 4h resulted in an increase in a dose-dependent manner with Cu2+ supplementation, although it was only statistically significant with 10 μM (Fig 5B). At 8h, the number of nodes decreased in all conditions compared to 4h. Regarding the number of meshes and total tube length, no significant differences were found between experimental conditions and control for the same time point (Fig 5C and 5D).

Fig 5

Effects of Cu2+ on tubule formation assay with HUVEC.

(A) Images of tubules formed under different non-toxic concentrations of Cu2+ (0, 0.1, 1 and 10 μM) at 4 and 8h. (B) Analysis of number of nodes, (C) meshes and (D) total tube length of HUVEC under different Cu2+ concentrations at 4 and 8 hours. Scale bar = 50 μm. Statistically significant differences were represented with * (p<0.05).

3.3.2. Cobalt (Co2+)

The assessment of Co2+ influence in tubule-like structures formation showed, in general, broken vascular structures with 50 μM concentration at 4 and 8h (Fig 6A). Moreover, control at 8h also showed broken vascular network. Regarding the analysis of number of nodes, number of meshes and total tube length, a similar pattern was observed. More specifically, at 4h, there was a significant increase in the number of nodes with 0.5, 5 and 25 μM (Fig 6B). A significant increase was also observed at 4h with 5 μM of Co2+ regarding the number of meshes and total tube length (Fig 6C and 6D). At 8h, no significant increase was observed between experimental groups and control regarding the number of nodes, number of meshes and total tube length (Fig 6B–6D). However, a significant decrease was observed in all parameters with 50 μM.

Fig 6

Effects of Co2+ on tubule formation assay with HUVEC.

(A) Images of tubules formed under different non-toxic concentrations of Co2+ (0, 0.5, 5, 25 and 50 μM) at 4 and 8 hours. (B) Analysis of number of nodes, (C) meshes and (D) total tube length of HUVEC under different Co2+ concentrations at 4 and 8 hours. Scale bar = 50 μm. Statistically significant differences were represented with * (p<0.05).

3.4. Influence of dual ion culture on viability, proliferation and morphology

Additionally to the individual ion evaluation in angiogenesis response, we wanted to elucidate if the combination of both ions could have synergistic effects. To this purpose, we selected the concentration of 10 μM of Cu2+, which demonstrated an important increase of VEGF at early time points, and the concentration of 25 μM of Co2+, which also showed a significant improvement of VEGF and PECAM-1 at early and later time points. This combination was coded as Cu10/Co25. As we considered the possibility that the combination of these two higher concentrations could be cytotoxic for cells due to their ability to form reactive oxygen species (ROS) when they are at high concentrations, we also assessed the combination of half of these concentrations, being 5 μM for Cu2+ and 12.5 μM for Co2+, coded as Cu5/Co12.5.

Results obtained with viability analysis showed that cells cultured with Cu5/Co12.5 and Cu10/Co25 reached a viability of almost 80% at day 2, but it was reduced down to 62% and 52% at day 7, respectively, being significantly lower compared to control (Fig 7A).

Fig 7

HUVEC viability, cell number and morphology with Cu2+ and Co2+ supplementation.

(A) Viability and (B) morphology of HUVEC under different combinations of Cu2+ and Co2+ (actin filament staining (green); nucleus (blue). Scale bar = 50 μm. Abbreviations: Cu5/Co12.5 = 5 μM of Cu2+ and 12.5 μM of Co2+; Cu10/Co25 = 10 μM of Cu2+ and 25 μM of Co2+. Statistically significant differences were represented with * (p<0.05).

The influence of the combination of both ions on HUVEC morphology and organization was also evaluated with actin filament staining. At day 2, there were no apparent differences between experimental conditions (Fig 7B). At day 7, control samples reached confluence and HUVEC cells grew over it. Regarding both combination of ions, there were no differences regarding morphology compared to control.

3.5. Influence of dual ion culture on angiogenesis

To our surprise, the evaluation of angiogenic gene expression did not show any significant up or down-regulation of HIF-1α, VEGF or PECAM-1 for any of the combinations tested compared to control samples (Fig 8). As a final assessment, tubule formation capability of HUVEC under both ion combinations was also assessed with Matrigel as a substrate. Apparently, with phase contrast images there seemed to be no differences between all conditions tested (Fig 9A). Results of the analysis of number of nodes, number of meshes and total tube length resulted in non-statistically significant differences between experimental groups for each time point, confirming the previous observations (Fig 9A–9C).

Fig 8

HUVEC gene expression.

Different Cu2+ and Co2+ concentrations were evaluated at 2 and 7 days for the expression of (A) HIF-1α, (B) VEGF and (C) PECAM-1. Data represented correspond to fold-changes compared each time point control. Abbreviations: Cu5/Co12.5 = 5 μM of Cu2+ and 12.5 μM of Co2+; Cu10/Co25 = 10 μM of Cu2+ and 25 μM of Co2+.

Fig 9

Effects of Cu2+ and Co2+ on tubule formation assay with HUVEC.

(A) Images of tubules formed under different concentrations of Cu2+ and Co2+ at 4 and 8 hours. (B) Analysis of number of nodes, (C) meshes and (D) total tube length of HUVEC at 4 and 8 hours. Abbreviations: Cu5/Co12.5 = 5 μM of Cu2+ and 12.5 μM of Co2+; Cu10/Co25 = 10 μM of Cu2+ and 25 μM of Co2+. Scale bar = 50 μm.

4 Discussion

In order to use therapeutic ions for angiogenesis stimulation, a screening for non-toxic concentrations that at the same time induce a therapeutic effect is required. In this study, Cu2+ and Co2+ were selected, both described to be angiogenic, with the aim to elucidate how different concentrations affect the angiogenic response during time course (within hours and days), to determine which are the appropriate concentrations to be delivered when an ion delivering scaffold wants to be designed. As it is reported that the combination of some ions have a synergistic effects [20, 21], the combination of Cu2+ and Co2+ was also assessed in this study, as it has not been addressed before to the best of our knowledge.

The different assays were performed with growth media (GM) due to the presence of cell debris and detached cells with difficulties to proliferate with basal media (BM). Results showed non-toxic concentrations up to 10 μM for Cu2+ and 50 μM for Co2+ (Figs 1A and 2A). Decrease of cell viability with high concentrations of ions might be due to cellular toxicity induced by reactive oxygen species (ROS). In the presence of superoxide (·O2-) (produced by the mitochondria during cellular respiration) or reducing agents, such as glutathione (GSH) or ascorbic acid (generally found in cells [22] and in cell culture media that we used for the experiments, respectively), Cu2+ can be reduced to Cu+, which in turn, can catalyze the formation of hydroxyl radicals (OH·) from hydrogen peroxide (H2O2) (produced during normal cell metabolism [23]), through Haber-Weiss reaction [24]:

Similarly, Co2+ has also been described to be involved in ROS formation [25, 26]. More specifically, with the presence of oxygen, Co2+ might generate the radical intermediate Co+-OO· species [27]:

With the presence of superoxide dismutase enzyme (SOD) (an antioxidant enzyme present in cells [28]), it can catalyze the decomposition of Co+-OO· species to H2O2 and Co+:

Finally, it was proposed that Co+ could participate in the formation of OH· radicals through Fenton reaction:

Results of HUVEC viability when both ions were combined support the proposed equations of ROS generation by Cu2+ or Co2+ discussed in the literature. Surprisingly, HUVEC viability was considerably reduced in the presence of both ions (Fig 7A), compared to the viability with individual ions (Figs 1A and 2A). As observed in ROS generation equations, Cu2+ generates O2, whereas Co2+ consumes it. Therefore, there is the possibility that the presence of both ions might feedback the formation of ROS. Furthermore, it is widely reported that the generation of ROS can result in DNA damage, lipid peroxidation, depletion of protein sulfhydryls and other effects that leads to apoptosis of cells [27], and that might explain the decreased viability of cells when the concentrations of ions were increased. To confirm low viability due to ROS formation, further studies including quantification of ROS species will need to be undertaken.

Comparing viability results of HUVEC cultured with Cu2+ with published ones, we found similarities with another study. Similarly, they reported a decreased HUVEC viability when cultured with concentrations equivalent to 7, 21 and 63 μM compared to control [29]. However, our results differ from other studies reporting viability of HUVEC up to 50 μM [30] or 500 μM [31]. These differences might be due to the time of exposure of Cu2+, which was relatively short for the later studies (48h), whereas in our study and the one with similar results [29] the Cu2+exposure was up to 7 and 14 days respectively. Regarding Co2+, similar to our results, Peters et al., described a proliferation decrease in a dose-concentration manner with concentrations of 10, 50, 100, 300 and 700 μM [32]. Conversely, Tao Zan et al reported an enhanced proliferation of EC in a dose-dependent manner with Co2+ concentrations of 50, 100 and 200 μM [33]. These differences might be due to the degree of differentiation of EC. Endothelial progenitor cells (EPC) are described to possess higher antioxidant capacity than mature endothelial cells such as HUVEC [34], therefore, being resistant to oxidant cytotoxicity generated by ROS. Tao Zan et al used EPC for their study, and that might explain the absence of toxicity up to 200 μM.

Non-toxic concentrations of Cu2+ (≤10 μM) demonstrated an enhancement of angiogenic response both in a gene expression level and in the ability to form tubular structures. Regarding the gene expression our results demonstrated that, in a wide overview, higher concentrations (10 μM) of Cu2+ have a significant contribution in angiogenesis at early time points observed with VEGF and PECAM-1 expression (up to day 2), whereas lower concentrations (0.1 and 1μM) have a more therapeutic effect at later stages (day 7) (Fig 3). Statistical analysis revealed no correlation between HIF-1α and VEGF expression (S1 Table), however, a previous study described that Cu2+ can enhance angiogenic response by the stabilization and increase of HIF-1α, which in turn triggers VEGF transcription [8]. Our findings are in agreement with a later published study, in which authors suggested that Cu2+ might be required for the binding of HIF-1α to hypoxia response element (HRE) sequence of target genes such as VEGF, but its deprivation did not affect the expression or stability of HIF-1α (total amount of HIF-1α in cells) but it did decrease VEGF expression [35]. Therefore, authors suggest that Cu2+ does not increase HIF-1α expression, but it is required for HIF-1 transcriptional complex formation. This might explain why we could observe an increase of VEGF although it was not correlated with HIF-1α expression. In addition, we observed a significant increase of PECAM-1 expression with higher doses at early times (10 μM at 24h) and with lower doses at later times (0.1 and 1 μM at day 7). It has been described that PECAM-1 is involved in endothelial cell migration and angiogenesis [36-38], and a reduction of blood vessel formation was reported when being inhibited [39]. Therefore, PECAM-1 expression results further suggests an enhancement of angiogenic response with Cu2+. Gene expression results of VEGF and PECAM-1 seem to be in accordance with results obtained with tubule formation assay (Fig 5). More specifically, an increase of number of nodes and meshes was observed with the high concentration of 10 μM at 4h, whereas at later time point, the increase was observed with 0.1 μM. Therefore, our results suggest that Cu2+ is able to establish a higher degree of vascular network connections with concentrations ranging from 0.1 to 10 μM.

Non-toxic concentrations of Co2+ (≤50 μM) could also demonstrate an enhancement of angiogenic response, although differences were found with the highest therapeutic dose between gene expression results and the ability to form tubular structures. Regarding results of gene expression induced by Co2+, although lower concentrations can enhance the angiogenic response within hours, it seems that higher concentrations of 25 and 50 μM enhance the response either at 2 and 7 days through the increase of HIF-1α, VEGF and PECAM-1 expression (Fig 4). Remarkably, we found a strong and significant correlation between HIF-1α and VEGF expression (S2 Table). These results are similar to a previous study demonstrating that Co2+ induced increased HIF-1α and VEGF expression in a dose-dependent manner, although the concentrations that they used were higher, specifically 50, 100 and 200 μM [33]. Authors mentioned that Co2+ act as prolyl hydroxylation inhibitor, hence inhibiting HIF-1α degradation and stabilizing it, with subsequent VEGF expression. Moreover, the up-regulation of PECAM-1 expression with high concentrations further indicates an enhancement of angiogenic response. Alternatively, the results obtained from tubule formation assay indicated that Co2+ have an effect in vascular structure formation (Fig 6). More specifically, there was an increase of number of nodes, number of meshes and total tube length with 0.5, 5 and 25 μM at early time of 4h. Importantly, the highest concentration of 50 μM induced an impairment of angiogenesis at 8h. This impairment was in accordance with a previous study where the in-vitro capillary formation of human EC was impaired with Co2+ concentrations of 50, 100 and 300 μM [32]. The authors hypothesized that Co2+ exposure could induce interference of integrin signaling, which is normally regulated by divalent metal ions such as Ca2+, Mg2+ and Mn2+. Integrins recognize and respond to a variety of extracellular matrix proteins [40] and their signaling interference can lead to a loss of EC adhesion [41], which might be an explanation for the impairment of vascular network structures formation with the highest concentration of Co2+.

Finally, as we observed an enhanced angiogenic response with individual culture of Cu2+ and Co2+ with HUVEC, we further evaluated the response when combined together. As far as we know, no previous studies are reported analyzing the role of these two ions combined together, neither as cell culture media supplement or as delivered from scaffolds. To our surprise, we could not observe any significant up or down-regulation of HIF-1α, VEGF or PECAM-1 between conditions during all time course of the experiment (Fig 8), or any significant difference of number of nodes, number of meshes and total tube length with the in vitro tubule formation assay compared to control (Fig 9). As we observed differences when both ions were cultured individually, these results point to the likelihood that both ions are mutually inhibiting or interacting with each other when being together. A possible hypothesis is that copper and cobalt might interact with some components of the cell culture media forming new complexes. In this regard, it is described in the literature that copper and cobalt can interact with each other with the presence of histidine, forming a new complex Co-Cu-His [42]. As aminoacids, being histidine one of them, are added in the cell culture media formulations as essential nutrients [43], the possibility of forming the complex Co-Cu-His is possible. This would eventually explain why there is no increase in the angiogenesis response, as copper and cobalt might not be found freely to be able to enhance the HIF-1α binding to HRE (copper) and to inhibit the HIF-1α degradation (cobalt). However, future research is needed to test this hypothesis regarding the lack of synergy when both ions are combined together.

The results obtained in this study regarding the individual effects of ions provide useful information for the design of scaffolds for the delivery of Cu2+ or Co2+ in tissue engineering field. Fig 10 shows schematic representation of the different doses of Cu2+ and Co2+ that proved to enhance the angiogenic response, either increasing VEGF or PECAM-1 and improving the ability to form tubule structures, through time course up to 7 days. The released amount from scaffolds within these ranges of concentrations might have the potential to stimulate blood vessel formation.

Fig 10

Schematic representation of angiogenic therapeutic doses of Cu2+ and Co2+.

(A) Profile of doses of Cu2+ and Co2+ that enhanced the angiogenic response within hours and days and (B) the corresponding cumulative release. Representation made based on VEGF and PECAM-1 gene expression and tubule formation assay results.

5 Conclusions

The results of this study indicate that Cu2+ and Co2+ ions individually enhanced the angiogenic response in HUVEC cells with different concentrations, although results showed that some concentrations have earlier therapeutic effects than others. Higher concentrations of Cu2+ have an early angiogenic effect, whereas lower concentrations are required for the increase of angiogenic response at later time points. Alternatively, in a wide overview, higher doses of Co2+ stimulates an angiogenic response at early and later times. These results have important implications regarding the design of Cu2+ or Co2+ delivery scaffolds when blood vessel formation wants to be stimulated at early or later times. Otherwise, our results indicate that the combination of both ions should be avoided.

Optical images of HUVEC cultured with Cu2+ supplemented basal media.

(TIFF)

Click here for additional data file.

Optical images of HUVEC cultured with Cu2+ supplemented growth media.

(TIFF)

Click here for additional data file.

HUVEC cultured with Cu2+ with basal medium.

Viability of HUVEC cultured with basal medium supplemented with Cu2+. Statistically significant differences were represented with * (p<0.05).

(TIFF)

Click here for additional data file.

Optical images of HUVEC cultured with Co2+ supplemented basal media.

(TIFF)

Click here for additional data file.

Optical images of HUVEC cultured with Co2+ supplemented growth media.

(TIFF)

Click here for additional data file.

HUVEC cultured with Co2+ with basal medium.

Viability of HUVEC cultured with basal medium supplemented with Co2+. Statistically significant differences were represented with * (p<0.05).

(TIF)

Click here for additional data file.

HIF-1α and VEGF expression correlation results with Cu2+ supplementation.

Symbols: ns = non-significant (p>0.05); * = p<0.05; ** = p<0.01.

(TIF)

Click here for additional data file.

HIF-1α and VEGF expression correlation results with Co2+ supplementation.

Symbols: ns = non-significant (p>0.05); * = p<0.05; ** = p<0.01.

(TIF)

Click here for additional data file.

8 Sep 2021

PONE-D-21-25451Assessing the potential role of copper and cobalt in stimulating angiogenesis for tissue regenerationPLOS ONE

Dear Dr. Perez,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Oct 23 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Selvaraj Vimalraj

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript titled on "Assessing the potential role of copper and cobalt in stimulating angiogenesis for tissue

regeneration" is an interesting article. However there are few questions should be addressed by author.

1) What is the rationale for choosing copper and cobalt?. Its already available for treating several diseases.

2) Why an author chosen HUVEC cell line, rather than other cell lines?

3) Do an author checked the protein expression of vegf after stimulation in endothelial cells ?

Reviewer #2: MAJOR COMMENTS

This study by Bosch-Rué et al. examined the role of copper (Cu2+) and cobalt (Co2+) for inducing angiogenesis process and tested their hypothesis in vitro using Human Umbelical vein endothelial cell (HUBEC) by gene expression analysis and the assessment of tubular formation structures. The findings could be interesting and important for understanding the molecular basis of biological active metal ions like copper (Cu2+) and cobalt (Co2+) in angiogenesis and subsequent future therapeutic application in tissue regeneration. However, the data represented in this manuscript is only based on in vitro study and assessment of individualistic and synergistic effect of copper (Cu2+) and cobalt (Co2+) in angiogenesis. It could have been better if the in vitro tested dosage of copper (Cu2+) and cobalt (Co2+) is tested in a tissue regeneration model using synthetic grafts.

Although the data related separate dosage effect of copper (Cu2+) and cobalt (Co2+) in angiogenesis would be useful for the scientific community but synergistic effect did not show any significant improvement. Thus, a mechanistic data of the insignificant combinatorial role of copper (Cu2+) and cobalt (Co2+) in angiogenesis could have been interesting and that could add the missing novel insights in this existing story.

MINOR COMMENTS

1. All fluorescence images should be marked as stained accordingly. Like actin filament (Green) / phalloidin (Green) and DAPI (Blue).

2. Page 21, Line 432 & 433 “Stähli et al. reported a decreased HUVEC viability when 433 cultured with concentrations equivalent to 7, 21 and 63 μM compared to control (29).” Formatting should be corrected as per journal requirement.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Subhra Prakash Hui

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

22 Sep 2021

Reviewer #1

The manuscript titled on "Assessing the potential role of copper and cobalt in stimulating angiogenesis for tissue regeneration" is an interesting article. However there are few questions should be addressed by author.

1) What is the rationale for choosing copper and cobalt?. Its already available for treating several diseases.

We would like to thank the reviewer for revising the manuscript and for the valuable feedback. The reason for choosing copper and cobalt is because it is well established that these ions are able to induce hypoxic conditions and subsequently an angiogenesis response. However, although there are several studies that have incorporated cobalt or copper into their scaffolds, the angiogenic response and or release has not been measured during the entire time course. Instead, they are generally measured at the end of the experiment or in a single time point during the ion exposure. These studies do not provide enough data for new scaffold design in terms of delivering appropriate doses of copper or cobalt at specific times that are non-toxic and promotes the angiogenic response at the same time. Therefore, we consider interesting and useful to study the angiogenic response during the first period of time (hours) and later time points (days). Special importance is the doses released during the first hours, as burst release can happen from scaffolds and induce toxicity. Hence, establishing a therapeutic non-toxic range is necessary. We mentioned these characteristics as relevant in the introduction (line 61-66):

“Despite the significant number of scaffolds that have incorporated these ions into their structure, the optimum concentrations required at each time point of the angiogenic response are still unknown. Generally, ion release from scaffolds is measured as a cumulative release after several days, obtaining the angiogenic response at the end point of the experiment (11,12) or in a single time point during the course of the experiment (13–16), which is generally never in the initial hours (17–19)”.

A part from that, there is no previous report combining both ions, copper and cobalt, together and assessing if there exist a synergistic effect, previous demonstrated to be an alternative strategy of angiogenesis stimulation with the combination of other ions. As it has been demonstrated that both ions have an angiogenic potential when individually used, we wanted to elucidate if their combination could enhance the angiogenic response or not. This information is also useful for a new ion-doped scaffold design, in order to combine or avoid both ions together. A new nuance has been added regarding the combination of the two ions (line 85).

“Furthermore, the possible synergistic combinatorial effect of these non-toxic ion concentrations was assessed, in order to open the possibility of combining ions to stimulate angiogenesis as this has not been studied before”.

2) Why an author chosen HUVEC cell line, rather than other cell lines?

In order to study the angiogenic response due to ion stimuli, an endothelial cell line was needed. In this regard, HUVEC cells have been extensively used, with approximately 5432 search results in Pubmed for “HUVEC and Angiogenesis”:

https://pubmed.ncbi.nlm.nih.gov/?term=%28HUVEC%29+and+%28angiogenesis%29&sort=pubdate

Moreover, in a recent review (Medina Leyte DJ, Domínguez Pérez M, Mercado I, Villarrreal Molina MT, Jacobo Albavera L. Use of Human Umbilical Vein Endothelial Cells (HUVEC) as a Model to Study Cardiovascular Disease: a review. Appl Sci. 2020;10(3)) is mentioned that HUVEC faithfully represents human endothelial cell behavior as compared to other cell lines, and that they are useful for angiogenesis model, particularly suitable for in vitro screening, the evaluation of ultrastructure of capillary formation, amongst others.

For these reasons, we decided to use HUVEC cell line as it is considered a good in vitro model for angiogenesis studies, with similar behavior of other endothelial cell lines.

3) Do an author checked the protein expression of vegf after stimulation in endothelial cells?

We did not check the protein expression of VEGF after ion stimulation. We consider that protein expression of vegf is to verify the functionality of the cells, providing information not only if the genes are expressed but also if cells will behave induce the production of a blood vessel. Alternatively, we decided to test functionality by performing the tubule formation assay which is mainly mediated by VEGF. Moreover, we used a growth factor reduced matrigel in order to observe clearly the effects of individual ions in vascular-like network formation. Therefore, with tubule formation results we have evidence that the angiogenic response is enhanced, especially with cobalt ion.

Reviewer #2

MAJOR COMMENTS

This study by Bosch-Rué et al. examined the role of copper (Cu2+) and cobalt (Co2+) for inducing angiogenesis process and tested their hypothesis in vitro using Human Umbelical vein endothelial cell (HUBEC) by gene expression analysis and the assessment of tubular formation structures. The findings could be interesting and important for understanding the molecular basis of biological active metal ions like copper (Cu2+) and cobalt (Co2+) in angiogenesis and subsequent future therapeutic application in tissue regeneration. However, the data represented in this manuscript is only based on in vitro study and assessment of individualistic and synergistic effect of copper (Cu2+) and cobalt (Co2+) in angiogenesis. It could have been better if the in vitro tested dosage of copper (Cu2+) and cobalt (Co2+) is tested in a tissue regeneration model using synthetic grafts.

Although the data related separate dosage effect of copper (Cu2+) and cobalt (Co2+) in angiogenesis would be useful for the scientific community but synergistic effect did not show any significant improvement. Thus, a mechanistic data of the insignificant combinatorial role of copper (Cu2+) and cobalt (Co2+) in angiogenesis could have been interesting and that could add the missing novel insights in this existing story.

We would like to thank the reviewer for revising the manuscript and for the valuable feedback given.

We agree with the reviewer that the tested dosage of copper and cobalt would have been better by using synthetic grafts. However, to this purpose, a previous knowledge about the correct doses that need to be delivered over time is necessary to design a proper scaffold that enhances the angiogenic response. As previously mentioned and referenced in the manuscript (lines 63-66), studies using copper or cobalt ions in their scaffolds do not provide enough data for that, usually reporting the doses delivered and angiogenesis response at the end of the experiment as a cumulative release or in a single time point. Therefore, we considered that providing this data over short period of time (hours) and longer time points (days) is crucial when a scaffold to deliver these ions for angiogenesis purposes wants to be developed. So from our results, synthetic grafts delivering those ions can be more properly designed.

Regarding the lack of synergy with the combination of both ions, we agree with the reviewer that we did not add a possible explanation of why that might occur and we added new information regarding this. We found that both copper and cobalt can interact with each other with the presence of some α-aminoacids, specifically α-histidine (see reference below).

Lukasiewicz A, Wozniak I. Interaction between the metals in cobalt(II)-copper(II), cobalt(II)-chromium(III) and iron(II)-chromium(III) cation pairs in the presence of α-amino acids and acetat anion in queous solutions. J Chem Soc chemmical Commun. 1989;(5):288–9.

Aminoacids, including alpha-histidine, are included in the cell culture media formulation as they are essential nutrients for cell survival (see reference below).

Salazar A, Keusgen M, Von Hagen J. Amino acids in the cultivation of mammalian cells. Amino Acids.2016;48(5):1161–71.

Therefore, a possible explanation is that copper and cobalt might interact with histidine forming a complex that inhibits the cobalt and copper individual effect. That would mean that they cannot inhibit, for example, the enzymes that hydroxylate HIF-1α and inhibit its translocation into the nucleus (cobalt effect) or favor the interaction of HIF-1a to the hypoxic response element (HRE) (copper effect). Therefore, no increase or enhancement of angiogenesis would be observed.

All this information has been added in the discussion of the paper (line 504-516):

“As we observed differences when both ions were cultured individually, these results point to the likelihood that both ions are mutually inhibiting or interacting with each other when being together. A possible hypothesis is that copper and cobalt might interact with some components of the cell culture media forming new complexes. In this regard, it is described in the literature that copper and cobalt can interact with each other with the presence of histidine, forming a new complex Co-Cu-His (42). As aminoacids, being histidine one of them, are added in the cell culture media formulations as essential nutrients (43), the possibility of forming the complex Co-Cu-His is possible. This would eventually explain why there is no increase in the angiogenesis response, as copper and cobalt might not be found freely to be able to enhance the HIF-1α binding to HRE (copper) and to inhibit the HIF-1α degradation (cobalt). However, future research is needed to test this hypothesis regarding the lack of synergy when both ions are combined together.”

MINOR COMMENTS

1. All fluorescence images should be marked as stained accordingly. Like actin filament (Green) / phalloidin (Green) and DAPI (Blue).

The reviewer is correct that the staining was not properly marked. We added more detail in figure captions of Figure 1, Figure 2 and Figure 7: “(actin filament staining (green); nucleus (blue)”.

2. Page 21, Line 432 & 433 “Stähli et al. reported a decreased HUVEC viability when 433 cultured with concentrations equivalent to 7, 21 and 63 μM compared to control (29).” Formatting should be corrected as per journal requirement.

We thank the reviewer for bringing up the citation style in this phrase. We noticed the same incorrect citation in another line and both have been corrected (line 430 and line 435).

Submitted filename: Response to reviewers (1).docx

Click here for additional data file.

13 Oct 2021

Assessing the potential role of copper and cobalt in stimulating angiogenesis for tissue regeneration

PONE-D-21-25451R1

Dear Dr. Perez,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Selvaraj Vimalraj

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

-

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

Reviewer #2: The revised manuscript by Bosch-Rué et al. has addressed all my queries and suggestions to improve the manuscript.

I have no further comments.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

18 Oct 2021

PONE-D-21-25451R1

Assessing the potential role of copper and cobalt in stimulating angiogenesis for tissue regeneration

Dear Dr. Perez:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Selvaraj Vimalraj

Academic Editor

PLOS ONE