Literature DB >> 34699017

First molecular evidence of border disease virus in wild boars in Turkey.

Hasbi Sait Saltik1, Mehmet Kale2, Kamil Atli2.   

Abstract

Molecular studies on viral diseases in wildlife are limited in Turkey. Pestiviruses infect domestic animals such as pig, cattle, sheep, goats and many other wild ungulates. Cross-species transmission of pestiviruses between wildlife and domestic livestock is a subject of recent concern where wild ungulates are in close contact with domestic ruminants. The International Committee on Virus Taxonomy (ICTV) has named the genus Pestivirus, which belongs to the Flaviviridae family, using the format Pestivirus A, Pestivirus B, Pestivirus C, and so on. Pestivirus A-D replaces Bovine viral diarrhea virus-1 (BVDV-1), Bovine viral diarrhea virus-2 (BVDV-2), Classical swine fever virus (CSFV) and Border disease virus (BDV) respectively. During the 2013-2014 hunting season, a total of 40 samples were collected from wild boars (Sus scrofa ferus) in the area of Western Mediterranean Turkey. In the samples, nucleic acids were investigated for pestivirus, Aujeszky's disease virus, Borna disease virus, coronavirus, mastadenovirus and rotavirus. RT-PCR was performed using primary sets to detect specific partial gene region specific to each virus. Sequence analysis was performed on a positive sample. Phylogenetic analysis revealed that the positive sample, TR/Burdur/13/Boar3, belonged to BDV genotype 1 (Pestivirus D). The first molecular findings of BDV in wild boars in Turkey are reported in this study. This study highlights the importance of further research into diseases that might be transmitted from wild boars to ruminants in Turkey.
© 2021. The Author(s), under exclusive licence to Springer Nature B.V.

Entities:  

Keywords:  PCR; Pestivirus; Sequence; Sus scrofa ferus; Wildlife

Mesh:

Year:  2021        PMID: 34699017      PMCID: PMC8546789          DOI: 10.1007/s11259-021-09852-w

Source DB:  PubMed          Journal:  Vet Res Commun        ISSN: 0165-7380            Impact factor:   2.459


Introduction

Pestiviruses are responsible for widespread diseases with significant impact on animal production and economical losses. These viruses infect a wide range of ungulate species, such as sheep, cattle, pigs and other wild ruminants. Cross-species transmission of pestiviruses between wildlife and domestic livestock is a subject of recent concern and serological positivity has been reported where wild boars are in close contact with domestic ruminants (Caruso et al. 2017; Larska 2015; Righi et al. 2021; Wolff et al. 2016; Hasircioglu et al. 2017). Border disease virus (BDV) is one of the important pathogens of small ruminants and principally recognized as cause of congenital disease and reproductive disorders in sheep and goats. Small ruminants are now being bred in increasing numbers in many regions of Turkey because it is an agriculture and husbandry country and the economic losses in the livestock industry need to be limited. Therefore, Turkey requires early detection and thorough screening of viral diseases that threaten herd health and well-being, such as BDV. The economic impact of BDV is not always evident since it can harm the host species without causing any clinical symptoms (Righi et al. 2021). BDV belongs to the genus Pestivirus, family Flaviviridae, which comprises four major species, namely bovine viral diarrhea virus type 1 (BVDV-1), type 2 (BVDV-2), classical swine fever virus (CSFV), and BDV, and a growing number of additional putative Pestivirus species from various domestic and wild animals. The unclassified Pestiviruses such as Pestivirus H, atypical ruminant pestivirus, or HoBi-like, Pestivirus E, Pronghorn antelope pestivirus, Pestivirus F, Bungowannah virus, Pestivirus K, atypical porcine pestivirus, Pestivirus I, Aydin-like pestivirus, and Pestivirus G or Giraffe 1 have also been identified in various species (King et al. 2012; King et al. 2018). Recently, a new emerging ovine pestivirus (OVPV), was found to be genetically and antigenically closely related to CSFV in Italy (Casciari et al. 2020). Pestiviruses are classified according to their nucleotide sequence similarity, serological relationship, and host origins (Vilček and Nettleton 2006). BDV is an enveloped, positive sense, single-stranded, approximately 12.5 kb length RNA genome. This genome contains a single open reading frame (ORF) of the BDV genome encodes 4 structural proteins, the capsid (C) and three envelope glycoproteins (Erns, E1, and E2), and 7 to 8 non-structural proteins (Npro, p7, NS2–3, NS4A, NS4B, NS5A, and NS5B), which are flanked by 5′ and 3′ large untranslated regions (UTRs) (Deng and Brock 1992; Meyers and Thiel 1996). The 5′ 5′-UTR region consisted of 400 nucleotides is known as highly conserved part of the pestivirus genome. Among them, Npro, E2 and 5′-UTR are the most preferred regions for genetic characterization (Becher et al. 1999; Becher et al. 2012; Oguzoglu et al. 2009). Based on the studies targeted the gene regions and it was stated that BDV was divided into 8 phylogenetic groups (Giammarioli et al. 2011; Peletto et al. 2016; Righi et al. 2021). Based on serological studies, it is evident that wild boars are sporadically exposed to BVDV and BDV infections (Albayrak et al. 2013; Loeffen et al. 2009; Oscar et al. 2010; Sedlak et al. 2008; Weber et al. 2016). So far, few molecular studies were published presence of BVDV in wild boars (Milićević et al. 2018; Porto et al. 2021). Pestivirus, Aujeszky disease virus, Borna disease virus, coronavirus, mastadenovirus, and rotavirus have all been linked to wild boars, according to studies (Ruiz-Fons et al. 2007; Kaden et al. 2009; Milićević et al. 2018; Kumthip et al. 2019). However, it is uncertain if wild boar may serve as a primary reservoir for these viruses. Wild boar (S. scrofa) is one of the widest-ranging mammals in the world for its remarkable adaptability to a diversity of habitats and high reproduction rate. Increasing population density of of the wild boar means not only more host for disease transmission, but also higher rates of contact between hosts across the world (Ruiz-Fons et al. 2007). Wild boars, which live in groups of varying sizes in nature, are often known to be females that roam with their offspring. It is difficult to prevent direct/indirect contact of these wild boar groups with small ruminant herds, in common pastures. Because of these factors, viral agents have been able to transmit from wild boars to domestic animals, and vice-versa. Domestic animals bred on pastures provide a source of the virus for wildlife, which can then easily serve as a route of disease transmission between hosts, due to their high sensitivity (Weber et al. 2016). Studies on the viral agents mentioned above in wild boars are quite poor compared to CSFV and African swine fever virus (ASFV). The data generated in this article suggest a possible importance of wild boars in the epidemiology of viral infections between host species. We emphasized that contact between infected and susceptible animals can lead to pestivirus transmission on the basis of our molecular findings in wild boars. Therefore, the occurrence of infectious disease in wildlife emphasizes the need to study the pathogens shared by wildlife and domestic species. The present study shows the first molecular evidence of BDV in wild boars.

Materials and methods

Sampling

Twenty two adult females and 18 adult males wild boars were hunted, and originated from 3 hunting grounds (Altinyayla, Tefenni, and Yeşilova) which have the suitable geographical conditions that close to agricultural area, located in the Western Mediterranean of Turkey (Burdur province) (Fig. 1). Sampling was carried out during the main hunting period (September–December) in 2013–2014. Blood samples were taken from pleural and abdominal cavities, and were transferred into tubes with anticoagulant (EDTA). Internal organs (liver, spleen and lung) were biopsied from these 40 wild boars. All samples were chilled in ice in the styropor carriers and transported immediately to the laboratory on the same day. We followed standard protocols under sterile conditions to minimise the potential of contamination. We autoclaved the dissection kit and, after each disruption, forceps and surgical scissors were dipped in ethanol (70%) and flame-sterilised. The organ samples resuspended in 3 cc PBS (Phosphate Buffer Saline) and homogenised by vortex. The homogenates were centrifuged at 3000×g for 10 min. Supernatants were transferred into sterile tubes. Supernatants and whole blood samples were harvested from each of the 40 wild boars, and stored at −80 °C until analysis.
Fig. 1

Sampling areas

Sampling areas

Nucleic acid extraction and PCR technique

Total RNA was extracted from 400 μl of the organ supernatant by using Phenol-Chloroform extraction following the protocol described by Chomczynski and Sacchi (2006). The RNA isolated was dissolved in 20 ml of RNase-free nanopure water and used for cDNA synthesis. Extracted RNA was reverse transcribed to cDNA with a first strand cDNA synthesis kit (Fermentas, Germany). For RT-PCR, 2 μL of the first strand cDNA synthesis reaction mixture was used as template. RNase-free nanopure water was used for negative, and extraction of a commercial BVDV vaccine were used for positive controls for RT-PCR. Specific PCR was performed for the pan-pestivirus with the primers 324 and 326 (Table 1) for the 5′-UTR gene region of the virus in accordance with the conditions used in the study by Vilček et al. (1994). Targeted 5′-UTR was amplified from each cDNA samples using forward and reverse oligonucleotides that specific for all of pestiviruses produced a 288 bp fragment. PCR reactions were performed in a final volume of 27 μl with following conditions: an initial denaturation at 96 °C for 6 min, followed by 35 cycles at 94 °C for 1 min, 56 °C for 1 min, and 72 °C for 2 min, a final 10 min extension at 72 °C. Aliquots of 5 μl of PCR products applied to the gel, and detected in 1% agarose gel electrophoresis. The gel stained with ethidium bromide, examined under UV light for specific size bands.In the negative controls, no product was amplified.
Table 1

Sequence of oligonucleotide primers, targets and expected PCR product sizes

PrimerSequence (5′ to 3′)Genomic regionProduct (bp)
Forward*ATGCCCTTAGTAGGACTAGCA5′-UTR288
Reverse*TCAACTCCATGTGCCATGTAC

*Specific primers 324/326

Sequence of oligonucleotide primers, targets and expected PCR product sizes *Specific primers 324/326

Sequence analysis

Primers were used based on amino acid sequence of pestivirus sequences. The PCR products of four positive samples were cleaned up using a commercial kit (GenElute™ PCR Clean-Up, Sigma-Aldrich, USA). However, only one of them was obtained clearly. The purified PCR fragment was sequenced via Genetic Analysis System DNA Sequencer (Beckman Coulter CEQ-8000 Analyzer). Similarity and identity rates regarding the sequences has been calculated in MatGAT 2.0 (Campanella et al. 2003).

Phylogenetic analysis of BDV 5′-UTR gene

Phylogeny was performed for pestivirus genotyping based on analysis of the 5′-UTR. Similarity searches were performed with nucleotide sequences deposited in GenBank using the Basic Local Alignment Search Tool (BLAST). Phylogenetic trees were constructed in Molecular Evolutionary Genetics Analysis (MEGA X) software based on the Maximum Likelihood method with bootstrap analysis of 1000 replicates by using the Kimura 2-parameter model (Kimura 1980; Kumar et al. 2018).

Results

In the frame of the survey conducted by our team, molecular analyses were used to detect a number of viral pathogens in wild boars. All animals were negative for different pestiviruses (except BDV), Aujeszky’s disease virus, Borna disease virus, coronavirus, mastadenovirus and rotavirus. Our study was based on the investigation of 40 wild boars sampled during the 2013–2014 hunting season in Burdur province (West Mediterranean Turkey). In order to explore the circulation of virus in the investigated geographical setting, a blood sample and pool of organs from each individual wild boar collected (n = 40) were screened molecularly. Pestivirus genome was detected in 1 of 40 samples (2.5%). Our positive sample was subjected to sequencing and phylogenetic analysis to determine its genetic diversity and similarity with other pestivirus groups. This analysis involved in total 56 nucleotide sequences. Four lineages were formed after a phylogenetic analysis of all sequences. By sequence analysis, one wild boar strain, TR/Burdur/13/Boar3 (GenBank accession number: MW269533) shared 53.2–79.6% identity and 41.1–67.8% similarity with the reference sequences obtained from GenBank (Table 2). The comparison of TR/Burdur/13/Boar3 with the sequences obtained from the GenBank revealed that it was included in the BDV genotype 1 (Pestivirus D). The other sequences were distinctly clustered under different groups (Fig. 2). The analysis revealed that the identified BDV isolate clustered with members of the BDV genotype 1. Phylogenetic analysis based on 5′-UTR showed that TR/Burdur/13/Boar3 strain shared 79.6% identity and 67.8% similarity with the Moredun-ncp strain.
Table 2

Nucleotide identity and similarity of the reference and study strains based on 5′-UTR gene

AcessionIsolate/StrainTR/Burdur/13/Boar3
NoNamesSimilarityIdentity
U650234–243 Moredun ncp67,8%79,6%
DQ3501654–244 Lyon266,6%79,3%
U650284–243 A187066,6%79,2%
U650454–243 T1789/167,8%79,2%
U650224–243 Moredun cp65,4%78,9%
EU8879534–2,431,118,21267,4%78,9%
U650504–243 V3196/167,8%78,9%
EU8879545–2,431,376,52765,4%78,5%
U650444–243 Q1673/266,6%78,5%
U650394–243 L99166,6%78,5%
U650634–2,448,320-22NZ66,2%78,2%
AF037405122–376 X818 Clover Lane64,2%77,7%
U650374–243 JH281665,4%77,7%
U650644–2,438,320–31 NZ65,4%76,9%
U650344–243 D1586/263,0%76,9%
U650474–243 V141461,9%76,1%
LR8237435–244 MRI623859,5%75,7%
D508167–254 Ch1Es(CCL73)58,8%73,9%
KF925348132–379 Gifhorn61,9%72,6%
KR35048326–279 99/MIB/201453,5%71,8%
KC53378531–284 CSFV-UP-BR-757-0954,1%71,8%
EF69399492-F-711956,9%71,6%
KJ19733431–284 CSFV-BR-DAR-039/200952,9%71,4%
KC53379826–279 CSFV-UP-BR-126-1054,1%71,4%
L4243226–279 V62251,7%71,4%
KT23910518–271 Parambi52,9%71,4%
J04358123–376 Alfort/Tuebingen51,7%71,4%
KJ19732930–283 CSFV-MH-PUN-183/200952,9%71,0%
GQ902941124–377 Paderborn52,9%71,0%
MG770617102–355 Ovine/IT/1756/1751,1%71,0%
U45478104–357 Glentorf50,5%70,7%
KF918753128–374 Aveyron51,1%69,9%
KM408491121–365 Burdur/05-TR55,2%69,3%
AM900848TO/121/0451,1%68,3%
GU2708771–376 H2121 Chamois-148,8%68,0%
AF144618138–383 reindeer-1 V60-Krefeld55,9%67,5%
AM4184273–252 BDV/Aydin/04-TR52,8%66,6%
KX573913Italy-58,98752,3%65,6%
EU567079Hisar49,4%64,8%
JQ7991411–288 M3118242,5%63,6%
EU159700Shihezi 14844,8%62,5%
M31182NADL44,8%62,3%
DQ0889951–374 Singer_Arg44,8%62,3%
KC75738310JJ-SKR42,5%61,7%
AF298069L44,8%61,3%
AB359930Shitara/02/0642,5%60,6%
MH395753TR/AFYONKARAHISAR-201742,5%60,4%
AJ318624IT99–716444,8%60,2%
AF5263811–329 ZM-9543,1%60,2%
AB359931IS25CP/0141,3%59,0%
LM994674SI/207/1240,6%59,0%
M96687Osloss42,5%58,9%
EU716149TR-2007-A-1493MS40,9%57,3%
GU120248BJ070239,7%57,1%
MH673456TY872341,1%53,2%
Fig. 2

Phylogenetic tree based on 5′-UTR gene. Our sequence was labeled with red colour (MW269533). Evolutionary analyses were conducted in MEGA X (Kumar et al. 2018). The evolutionary history was inferred by using the Maximum Likelihood method and Kimura 2-parameter model (Kimura 1980). The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein 1985)

Nucleotide identity and similarity of the reference and study strains based on 5′-UTR gene Phylogenetic tree based on 5′-UTR gene. Our sequence was labeled with red colour (MW269533). Evolutionary analyses were conducted in MEGA X (Kumar et al. 2018). The evolutionary history was inferred by using the Maximum Likelihood method and Kimura 2-parameter model (Kimura 1980). The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein 1985)

Discussion

An etiological diagnosis is needed to detect infectious agents in order to control the spread of infectious diseases. Additionally, disease surveillance of wild animals allows to detect the presence of pathogens that circulate among wildlife and domestic animals. Today it is important to identify quickly potential risks for pets and livestock and to ascertain the zoonotic risks for humans in contact with animals. This study provides data on the presence of BDV genotype 1 (Pestivirus D) in a wild boar hunted in Burdur province (Turkey) where domestic ruminant are in contact with wildlife. This is the first molecular evidence of BDV in wild boar in Turkey and this data suggest a possible importance of boars in the epidemiology of ruminant pestiviruses. Thus, the aim of the current study was to determine the exposure of wild boars, in Turkey to selected pathogens included 6 viruses: pestivirus, Aujeszky’s disease virus, Borna disease virus, coronavirus, mastadenovirus and rotavirus. However none of the 40 wild boars was positive for these viral agents but only the one for pestivirus. The incidence of pestivirus infections owing to antigenically related viruses such as CSFV, BVDV and BDV, has increased in wild boars, thus posing a potential concern for infections in livestock (Milićević et al. 2018; Postel et al. 2015). BDV is usually noticed when it causes growth retardation or increasing reproductive and fertility problems in the herd. However, these symptoms can often be confused with symptoms caused by other pathogens. Molecular methods and phylogenetic analyses are used to eliminate these confusions and, establish epidemiological patterns by tracing the virus to interspecies transmission (Righi et al. 2021). Therefore, the 5’UTR was sequenced from this positive sample to detect the pestivirus group to which it belongs. In this study, it was aimed to investigate the incidence of the pathogens and disease patterns in wild boars. It is known that pestiviruses can cross-species in Artiodactyla. Several studies have shown pestiviruses are not strictly host specific but may infect many species (Nettleton 1990; Becher et al. 1997; Postel et al. 2015). Wild boars, one of the widest-ranging mamals in the world, are thought to be reservoirs for a number of pathogens (Meng et al. 2009). Wild boars are increasing their interaction with humans and domestic animals as a result of changing climate and socio-cultural conditions across the world (Gibbs 1997). Furthermore, as the number of wild boar populations grows and their geographic range expands throughout the world, wild boar-domestic animal/human interaction becoming more widespread. In nature, the risk of developing viral diseases is higher under conditions where the immunity of wild boars is suppressed due to infection, stress, etc. (Ruiz-Fons et al. 2007). Diseases spread easily in common areas such as water supply and pastures because wild boar-livestock interactions are difficult to manage. Many authors have already emphasized the significance of these interactions between wild and domestic animals (Marco et al. 2009; Passler et al. 2009; Porto et al. 2021). According to a study reported by Casaubon et al. (2012), it was suggested that wildlife is an incidental spillover host and not a reservoir, despite regular occurrence of interactions between wild ruminants and potentially infected livestock. Other studies, on the other hand, show that wild boars act as a reservoir for a variety of ruminant infectious agents (Meng et al. 2009; Hahn et al. 2010). Wild boars are likely to spread these infectious viral particles in common areas. People living in the Mediterranean Region of Turkey, where sampling of wild boars were carried out, have been breeding small ruminants for years. Therefore this region of Turkey, has the special name like “small ruminant region”. The increased use of pastures and forests for breeding purposes have improved the possibilities of contact between wild boars and domestic animals. Several groups of pestiviruses included in the Pestivirus genus, family Flaviviridae, have been negatively affecting the livestock economy worldwide for decades, as they cause infertility, abnormal/still birth, abortion, low yields and persistent infected (PI) offspring in ruminants (Nettleton 1990). However, the effects of BDV infection, which has 5–50% averages seroprevalence (Nettleton et al. 1998), are largely ignored in small ruminants livestocks in Turkey. Although some serological studies carried out reveal that there is a relationship between wild boar and ruminant pestiviruses, the number of the studies are still quite limited (Loeffen et al. 2009; Sedlak et al. 2008; Roic et al. 2007). On the other hand, it should be considered that pestiviruses can also have an independent cycle in wildlife (Frölich et al. 2005). This study emphasizes the importance of further research into infections that can be transmitted from wild boars to ruminants in Turkey. Genetic and antigenic characterization obtained by wild boars samples collected in this study were compared with other strains of pestivirus. The presence of BDV strain found in wild boar was revealed with phylogenetic analysis based on the 5’UTR gene region. With subsequent analyses of nucleotides, it was seen that the highest identity is more than 79% between TR/Burdur/13/Boar3 and Moredun-ncp, Lyon2, A1870, and T1789/1 strains. On the other hand, the highest similarity of over 67% was detected between our strain and Moredun-ncp, T1789, 1,118,212 and V3196/1 strains. Interestingly, the Lyon2 strain was reported to be of goat origin and the 1,118,212 strain of cattle and sheep origin. In pasture, the increasing interaction of wild boars with livestock, along with the large number of pathogens shared is a growing risk for cross-species transmission (Becher et al. 2003; Ridpath 2015). It also was underlined that the viral agent’s evolutionary history in wild boars should be studied in more detail. To monitor the interaction of BDV with wildlife and livestock, further research in Turkey are needed, as well as complete characterization of the viral gene. We report here the first identification of BDV, the causative agent of small ruminants, in the Western Mediterranean region of Turkey, in wild boars. The likelihood of BDV direct/indirect transmission between small ruminants and wild boars has grown due to changes in human settlement to suburban areas, increasing usage of lands for agricultural purposes, and increased hunting activities. These circumstances support a recent research of BVDV detection in wild boars, which was emphasized for livestock in the extensive grazing system (Porto et al. 2021; Weber et al. 2016). This study reports the first molecular evidence of BDV in wild boars in Turkey, but the small number of samples and complex epidemiological context that characterize the co-circulation of pestiviruses among sensitive hosts cannot be overlooked and will need to be further investigated locally. The data generated in this article suggest a possible importance of wild boar in the epidemiology of ruminant pestiviruses. Furthermore, it will be important to conduct more extensive surveys to obtain a better picture regarding the distribution of BDV strains in wildlife and determine the transmission routes to clarify the epidemiological pattern. In conclusion, wild ungulates and small ruminants could be sharing BDV due to the similarity of the strains. This fact can lead to need of inclusion of wild boars in BDV control programs since boars can circulate in common regions and come in contact with ruminant herds. Based on previous experiences with pestivirus management in livestock, as well as the possibility of importing new or re-emerging diseases into Turkey, periodical surveillance should cover the entire country.
  23 in total

1.  Variation of Aujeszky's disease viruses in wild swine in USA.

Authors:  Edwin C Hahn; Bahaa Fadl-Alla; Carol A Lichtensteiger
Journal:  Vet Microbiol       Date:  2010-02-11       Impact factor: 3.293

2.  CONFIDENCE LIMITS ON PHYLOGENIES: AN APPROACH USING THE BOOTSTRAP.

Authors:  Joseph Felsenstein
Journal:  Evolution       Date:  1985-07       Impact factor: 3.694

3.  Phylogenetic analysis of pestiviruses from domestic and wild ruminants.

Authors:  P Becher; M Orlich; A D Shannon; G Horner; M König; H J Thiel
Journal:  J Gen Virol       Date:  1997-06       Impact factor: 3.891

4.  Complete genome sequence of a novel pestivirus from sheep.

Authors:  Paul Becher; Stefanie Schmeiser; Tuba Cigdem Oguzoglu; Alexander Postel
Journal:  J Virol       Date:  2012-10       Impact factor: 5.103

5.  The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: twenty-something years on.

Authors:  Piotr Chomczynski; Nicoletta Sacchi
Journal:  Nat Protoc       Date:  2006       Impact factor: 13.491

6.  Genetic and antigenic typing of border disease virus (BDV) isolates from Italy reveals the existence of a novel BDV group.

Authors:  Monica Giammarioli; Severina Anna La Rocca; Falko Steinbach; Cristina Casciari; Gian Mario De Mia
Journal:  Vet Microbiol       Date:  2010-07-06       Impact factor: 3.293

7.  Genetic diversity of pestiviruses: identification of novel groups and implications for classification.

Authors:  P Becher; M Orlich; A Kosmidou; M König; M Baroth; H J Thiel
Journal:  Virology       Date:  1999-09-15       Impact factor: 3.616

8.  Genetic and antigenic characterization of novel pestivirus genotypes: implications for classification.

Authors:  Paul Becher; Ramiro Avalos Ramirez; Michaela Orlich; Sibilina Cedillo Rosales; Matthias König; Matthias Schweizer; Hanspeter Stalder; Horst Schirrmeier; Heinz-Jürgen Thiel
Journal:  Virology       Date:  2003-06-20       Impact factor: 3.616

9.  Molecular cloning and nucleotide sequence of a pestivirus genome, noncytopathic bovine viral diarrhea virus strain SD-1.

Authors:  R Deng; K V Brock
Journal:  Virology       Date:  1992-12       Impact factor: 3.616

10.  Bovine viral diarrhea virus in free-ranging wild ruminants in Switzerland: low prevalence of infection despite regular interactions with domestic livestock.

Authors:  Julien Casaubon; Hans-Rudolf Vogt; Hanspeter Stalder; Corinne Hug; Marie-Pierre Ryser-Degiorgis
Journal:  BMC Vet Res       Date:  2012-10-29       Impact factor: 2.741

View more
  1 in total

Review 1.  Non-structural proteins of bovine viral diarrhea virus.

Authors:  Shanshan Chi; Si Chen; Weijuan Jia; Yunjiang He; Linzhu Ren; Xueli Wang
Journal:  Virus Genes       Date:  2022-05-25       Impact factor: 2.198

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.