OBJECTIVE: To investigate the effects of S100A8 and S100A9 on proliferation in nasopharyngeal carcinoma cells and the regulatory effects of PI3K/Akt signaling pathway. METHODS: Nasopharyngeal carcinoma cells (CNE1) were cultured and randomly divided into three groups: control group, S100A8/S100A9 overexpression group, and siRNA S100A8/S100A9 group. CCK-8 method was used to detect the effect of S100A8 and S100A9 on the viability of nasopharyngeal carcinoma cells. The effects of S100A8 and S100A9 on the colony forming ability of nasopharyngeal carcinoma cells were detected by colony forming assay. The effects of S100A8 and S100A9 on the proliferation of nasopharyngeal carcinoma cells were detected by EdU staining. The mRNA levels of PI3K and Akt were detected by RT-PCR. The expression levels of PI3K and Akt in NPC cells were detected by Western blot. Wortmannin, an inhibitor of PI3K/Akt pathway, was used to inhibit the activation of PI3K/Akt pathway. RESULTS: Compared with the control group, the cell viability, the number of plate clones, the positive rate of EdU staining, and the mRNA and protein levels of PI3K and Akt were increased in the overexpression group. Compared with the control group, the cell viability, the number of plate clones, the positive rate of EdU staining, and the mRNA and protein levels of PI3K and Akt were decreased in the siRNA group. After inhibiting the activation of PI3K/Akt pathway, the viability of NPC cells in the overexpression group decreased significantly at 48 h and 72 h, while that in the siRNA group increased significantly. CONCLUSION: SiRNA S100A8 and S100A9 could inhibit the proliferation of nasopharyngeal carcinoma cells, and the underlying mechanism may be related to the inhibition of PI3K/Akt signaling pathway.
OBJECTIVE: To investigate the effects of S100A8 and S100A9 on proliferation in nasopharyngeal carcinoma cells and the regulatory effects of PI3K/Akt signaling pathway. METHODS: Nasopharyngeal carcinoma cells (CNE1) were cultured and randomly divided into three groups: control group, S100A8/S100A9 overexpression group, and siRNA S100A8/S100A9 group. CCK-8 method was used to detect the effect of S100A8 and S100A9 on the viability of nasopharyngeal carcinoma cells. The effects of S100A8 and S100A9 on the colony forming ability of nasopharyngeal carcinoma cells were detected by colony forming assay. The effects of S100A8 and S100A9 on the proliferation of nasopharyngeal carcinoma cells were detected by EdU staining. The mRNA levels of PI3K and Akt were detected by RT-PCR. The expression levels of PI3K and Akt in NPC cells were detected by Western blot. Wortmannin, an inhibitor of PI3K/Akt pathway, was used to inhibit the activation of PI3K/Akt pathway. RESULTS: Compared with the control group, the cell viability, the number of plate clones, the positive rate of EdU staining, and the mRNA and protein levels of PI3K and Akt were increased in the overexpression group. Compared with the control group, the cell viability, the number of plate clones, the positive rate of EdU staining, and the mRNA and protein levels of PI3K and Akt were decreased in the siRNA group. After inhibiting the activation of PI3K/Akt pathway, the viability of NPC cells in the overexpression group decreased significantly at 48 h and 72 h, while that in the siRNA group increased significantly. CONCLUSION: SiRNA S100A8 and S100A9 could inhibit the proliferation of nasopharyngeal carcinoma cells, and the underlying mechanism may be related to the inhibition of PI3K/Akt signaling pathway.
Nasopharyngeal carcinoma (NPC) is a malignant tumor originating from the nasopharyngeal epithelial tissues, with such biological characteristics as direct infiltration and lymphatic metastasis, but its pathogenesis is still not very clear. Similar to other tumors, NPC is closely associated with environment, gene, and physicochemical factors [1-3]. The treatment for early NPC is dominated by radiotherapy, while radiotherapy, chemotherapy, or molecular targeted therapy is usually employed for patients with advanced NPC. However, the treatment effects are not very satisfactory, and the toxic and side effects seriously affect the patient's quality of life [4]. Hence, searching for efficacious molecular targets of clinical treatment is of important significance for improving the quality of life and extending the survival time of the patients, and it is a scientific problem needs to be solved.Recent studies have manifested that the abnormal proliferation of NPC cells plays crucial roles in the occurrence and development of NPC, while the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) signaling pathway has vital regulatory effects on the cell proliferation, differentiation, and apoptosis [5, 6]. Besides, large quantities of studies have demonstrated that the activation of the PI3K/Akt signaling pathway has a close correlation with tumorigenesis. After receiving signals, PI3K binds to receptors on the cell membrane to activate Akt which then translocates to the cell membrane and acquires catalytic activity, thus regulating downstream effector proteins [7]. The activity of PI3K and Akt is increased in NPC tissues, and the high expression levels of PI3K and Akt are related to the prognosis [8].S100A8 and S100A9 proteins belong to the S100 family, and S100 proteins, first discovered in brain tissues, are a category of small calcium-binding proteins encoded by chromosome 1. S100A8 and S100A9 can form a dimer, namely, S100A8/S100A9 complex, in an interdependent manner, so as to perform their biological functions [9, 10]. It was manifested in a study that S100A8 and S100A9 can participate in the occurrence of inflammation as chemokines, further stimulating the release of inflammatory factors such as interleukin-1β, interleukin-6, and tumor necrosis factor-α [11]. In addition, researchers have discovered that the expressions of S100A8 and S100A9 in the blood of NPC patients are obviously higher than those in normal people, and S100A8 probably promotes the cell proliferation by activating Akt to interfere in the cell cycle [12]. Therefore, the findings suggest that targeted inhibition on the protein levels of S100A8 and S100A9 may be a new therapeutic approach of preventing and treating NPC.
2. Reagents, Instruments, and Cells
2.1. Reagents
The reagents are the following: penicillin/streptomycin (P/S), fetal bovine serum (FBS) and Roswell Park Memorial Institute- (RPMI-) 1640 medium (Gibco, USA), S100A8 and S100A9 proteins (Abnova, USA), 96-well culture plate and culture dish (Corning, USA), small interfering ribonucleic acid (siRNA) S100A8/S100A9 (Shanghai Genechem Co., Ltd.), 5-ethynyl-2′-deoxyuridine (EdU) staining solution (Beijing Solarbio Science & Technology Co., Ltd.), PI3K and Akt primers (GENEWIZ), PI3K and Akt primary antibodies (Abcam, USA), fluorescein isothiocyanate- (FITC-) labeled IgG secondary antibodies (Jackson, USA), and SuperScript IV first-strand synthesis system (Thermo Fisher, USA).
2.2. Instruments
The instruments are the following: microplate reader (Shanghai Flash Spectrum Biotechnology Co., Ltd.), polymerase chain reaction (PCR) instrument and electrophoresis apparatus (Bio-Rad, USA), gel imager (Malvern, UK), and membrane scanner and CO2 incubator (Thermo Fisher, USA).
2.3. Cells
NPC cell line CNE1 (Shanghai Xin Yu Biotech Co., Ltd.) was used in the present experiments, and the complete medium was composed of 1% P/S +10% FBS + RPMI-1640 medium. When the cell fusion reached 80%, the cells were subcultured and then randomly divided into three groups. The cells in the S100A8/S100A9 overexpression group (overexpression group) were incubated with 1 μg/mL S100A8/S100A9 (1 : 1) complex solution, those in the siRNA/S100A9 group (siRNA group) were transfected with siRNA S100A8/S100A9 solution, and those in the control group received no other treatments. For transfection process, 1 day before cell transfection, the nasopharyngeal carcinoma cells in the logarithmic growth phase were planted on a 24-well plate according to 2 × 104 cells/well. The medium was selected as 1640 medium (containing 10% fetal bovine serum). When the cells are transfected, the nasopharyngeal carcinoma cell has a confluency of about 55%. After discarding the medium, rinse with PBS solution. After two times, add 300 μL OPTI-MEM medium to each well, and then place it in a constant temperature incubator to continue incubating. Dilute lipofectamine2000 with OPTI-MEM medium to make the final volume 5 μL, and let it stand for 10 min at room temperature. Add 1 μL of 20 nM siRNA and 0.5 plasmid to each well, then add OPTI-MEM medium to make the final volume up to 50 μL, let it stand for 5 min at room temperature, compound lipofectamine2000 diluent and siRNA diluent, and let stand for 5 min at room temperature. Add lipofectamine2000 and siRNA composite dilution to each well, gently shake the 24-well plate to mix it, then place it in a constant temperature incubator for 5 hours, discard the original medium, and replace it with a serum-containing complete medium.
3. Methods
3.1. Detection of Impacts of S100A8 and S100A9 on NPC Cell Viability via Cell Counting Kit-8 (CCK-8) Assay
The CCK-8 is an alternative of MTT assay for the detection of cell proliferation, survival, and toxicity. The three groups of cells were seeded into the 96-well plate at a density of 3 × 103 cells/well, with triplicate wells for each group. After adherence overnight, 10 μL of CCK-8 solution was added into each well according to the instructions, with air bubbles avoided, followed by culture again for 3 h. Finally, the absorbance at 450 nm was measured using the microplate reader.
3.2. Detection of Impacts of S100A8 and S100A9 on Colony-Formation Ability of NPC Cells via Plate Colony Assay
The cells in logarithmic growth phase were inoculated into a 6-well plate (1 × 103 cells/well) again, and the cell growth was observed every day. 14 d later, when obviously macroscopic clones were formed, the cells were fixed with 4% paraformaldehyde for 20 min and reacted with Giemsa staining solution for 15 min. Subsequently, the staining solution was slowly washed away in running water, and the cells were air-dried. Finally, the clones with over 10 cells were counted under a microscope, and the colony-forming efficiency was calculated.
3.3. Detection of Impacts of S100A8 and S100A9 on Proliferative Ability of NPC Cells via EdU Staining
As a thymidine analogue, EdU can be incorporated into duplicating DNA molecules during the cell proliferation to detect the cell proliferation. After fixation, the cells were permeabilized in 0.05% Triton X-100, and the EdU staining solution was diluted into 50 μM EdU working solution using the complete medium. Then, the cells were incubated in the dark for 30 min, washed with PBS for 3 times (5 min each time), and added dropwise with antifluorescence quencher, followed by observation of staining under the microscope.
3.4. Detection of Impacts of S100A8 and S100A9 on Messenger RNA (mRNA) Levels of PI3K and Akt in NPC Cells via Reverse Transcription- (RT-) PCR
The cells in each group were added with TRIzol lysis buffer to extract the total RNA which was synthesized into cDNA according to the instructions. Next, 1 μL of 50 μM Oligo primer, 1 μL of 10 nM dNTP Mix, and 1 μL of total RNA were added with DEPC-treated water to reach a total volume of 10 μL. After mixing, the solution was heated at 65°C for 5 min and ice bathed for 1 min. Later, PCR amplification was performed with 1 μL of forward primer and 1 μL of reverse primer (Table 1) for 30 cycles. Then, gel electrophoresis was conducted, and the PCR bands obtained were recorded using the ImageJ software.
Table 1
Information of primers.
List
Fprimer
Rprimer
S100A8
ATGCCGTCTACAGGGATGAC
ACTGAGGACACTCGGTCTCTA
S100A9
TTTGCTCCCCTTAATCCAGCC
CCTGGCAATTAGGGCAGTCG
β-Actin
GGCTGTATTCCCCTCCATCG
CCAGTTGGTAACAATGCCATGT
3.5. Detection of Impacts of S100A8 and S100A9 on Protein Expression Levels of PI3K and Akt in NPC Cells via Western Blotting
The total proteins were extracted from each group of cells using RIPA reagent, and their concentration was determined by BCA method. The total protein samples (30 μg) were loaded and separated through 10% SDS-PAGE. After that, the proteins were transferred onto a PVDF membrane using a wet transfer apparatus (Bio-Rad), sealed in 5% skim milk powder for 1 h, and then incubated with PI3K and Akt primary antibodies overnight, followed by washing with TBST solution for 3 times (5 min each time) and incubation with FITC-labeled secondary antibodies for 1 h. Finally, the band images were obtained on the membrane scanner.
3.6. Statistical Analysis
All the experiments were repeated for at least 3 times. The SPSS 21.0 software was employed for independent samples t-test, and one-way analysis of variance was adopted for comparisons among multiple groups. p < 0.05 suggested that the difference was statistically significant.
4. Results
4.1. SiRNA S100A8/S100A9 Could Inhibit the Viability of NPC Cells
According to the results of CCK-8 assay (Figure 1), the viability of NPC cells was improved markedly at 48 and 72 h in the overexpression group (∗p < 0.05, ∗p < 0.05) but decreased notably in the siRNA group (#p < 0.05, #p < 0.05) compared with that in the control group, suggesting that siRNA S100A8/S100A9 can inhibit the viability of NPC cells.
4.2. SiRNA S100A8/S100A9 Could Repress the Plate Colony Formation of NPC Cells
The results of plate colony formation assay (Figure 2(a)) showed that at 14 d, the overexpression group exhibited a larger number of NPC cell clones (∗p < 0.05), while the siRNA group displayed a remarkably smaller number of NPC cell clones (#p < 0.05) compared with the control group (Figure 2(b)), implying that siRNA S100A8/S100A9 can repress the plate colony formation of NPC cells.
Figure 2
Impacts of S100A8 and S100A9 on the number of NPC cell clones. (a) Figure of plate colony formation assay. (b) Statistical chart of NPC cell clones (∗p < 0.05, #p < 0.05).
4.3. SiRNA S100A8/S100A9 Could Suppress the Proliferation of NPC Cells
It was manifested in the results of EdU staining (Figure 3(a)) at 14 d; the NPC cell proliferation rate was raised evidently in the overexpression group (∗p < 0.05), but it was reduced in the siRNA group (#p < 0.05) in comparison with that in the control group (Figure 3(b)), indicating that siRNA S100A8/S100A9 can suppress the proliferation of NPC cells.
Figure 3
Impacts of S100A8 and S100A9 on proliferation of NPC cells. (a) Figure of EdU staining (20x). (b) Statistical chart of NPC cell proliferation rate (∗p < 0.05, #p < 0.05).
4.4. SiRNA S100A8/S100A9 Could Inhibit the mRNA Levels of PI3K and Akt in NPC Cells
The RT-PCR bands (Figure 4(a)) revealed that the mRNA levels of PI3K and Akt in NPC cells rose markedly in the overexpression group (∗p < 0.05, ∗p < 0.05) but declined obviously in the siRNA group (#p < 0.05, #p < 0.05) compared with those in the control group (Figure 4(b)), illustrating that siRNA S100A8/S100A9 can inhibit the levels of PI3K and Akt in the PI3K/Akt signaling pathway.
Figure 4
Comparisons of mRNA levels of PI3K and Akt via RT-PCR. (a) RT-PCR bands. (b) Statistical chart of bands (∗p < 0.05, #p < 0.05).
4.5. SiRNA S100A8/S100A9 Could Repress the Protein Levels of PI3K and Akt in NPC Cells
According to the Western blotting bands (Figure 5(a)), the protein levels of PI3K and Akt in NPC cells were remarkably higher in the overexpression group (∗p < 0.05, ∗p < 0.05), while they were notably lower in the siRNA group (#p < 0.05, #p < 0.05) than those in the control group (Figure 5(b)), suggesting that siRNA S100A8/S100A9 can repress the protein levels of PI3K and Akt in the PI3K/Akt signaling pathway.
Figure 5
Comparisons of protein levels of PI3K and Akt via Western blotting. (a) Western blotting bands. (b) Statistical chart of bands (∗p < 0.05, #p < 0.05).
4.6. The Effect of S100A8/S100A9 on the Proliferation of Nasopharyngeal Carcinoma Cells after Inhibiting the PI3K/Akt Pathway
The PI3K/Akt pathway inhibitor Wortmannin was used to inhibit PI3K/Akt pathway activation. The CCK-8 test results showed that the CCK-8 results are shown in Figure 6. Compared with the control group, the cell viability of nasopharyngeal carcinoma cells in the overexpression group was significantly reduced at 48 h and 72 h (∗p < 0.05, ∗p < 0.05), and the cell viability of nasopharyngeal carcinoma cells in the siRNA group was significantly increased (#p < 0.05, #p < 0.05), indicating that the ability of S100A8/S100A9 to promote the proliferation of nasopharyngeal carcinoma cells is weakened after inhibiting PI3K/Akt pathway activation.
NPC, a special head and neck carcinoma, manifests prominent differences in geographic and ethnic distribution. It can be easily neglected or missed in the early stage due to occlude position, so that nearly 70% of the patients are in the intermediate and advanced stage when definitely diagnosed [13]. The NPC patients mainly have such pathological manifestations as blood in the sputum, nasal obstruction, and auditory symptoms, and they are vulnerable to metastasis because of abundant lymphatic system in the nasopharynx, mostly manifested as lymph node enlargement [14]. Some studies have discovered that the occurrence of NPC is a complex process involving multiple factors, links, and signaling pathways. Therefore, deeply understanding and exploring the pathogenesis of NPC and seeking for new treatment protocols and targets have become the hotspots of research.Researchers have found that PI3K serves as an important regulator of the occurrence and development of tumors and participates in numerous physiological and pathological processes in cells and organisms [15]. Moreover, as a downstream target of PI3K, Akt can phosphorylate and then persistently activate the Thr308 and Ser473 loci, further controlling the expression of effect targets in the nucleus. Studies in recent years have revealed that the PI3K/Akt signaling pathway is abnormally activated in a variety of tumors, including lung cancer, liver cancer, and NPC certainly [16, 17]. The PI3K/Akt signaling pathway is activated, which can promote the growth, proliferation, and invasion of tumor cells by influencing the activation state of a variety of downstream effector molecules. Similarly, the study of Guo et al. proved that the PI3K/Akt signaling pathway plays crucial roles in the progression and metastasis of NPC with genetic variation in the patients [18]. Therefore, finding the targets or inhibitors capable of repressing the activation of the PI3K/Akt signaling pathway may bring new hope for the treatment of NPC. Researchers discovered through further investigations that the expression of S100A8/S100A9 protein is increased obviously in the serum or tumor tissues of tumor patients. Besides, the results of in vitro experiments confirmed that after S100A8/S100A9 is highly expressed, the proliferative, migratory, and invasive abilities of melanoma and non-small-cell lung cancer cells are enhanced prominently [19]. According to a research report, the expression levels of S100A8 and S100A9 in 60 cases of lung cancer tissues and normal lung tissues from different subtypes of lung cancer patients were detected, and it was shown that they are elevated markedly in the lung cancer tissues [20]. However, the influences of S100A8/S100A9 on the proliferation of NPC cells are rarely reported.In the present experiments, therefore, the viability of the three groups of NPC cells was detected using CCK-8 assay first. It was manifested that S100A8 and S100A9 could improve the NPC cell viability notably (Figure 1). At 48 h after transfection of NPC cells with siRNA S100A8/S100A9 by means of RNA interference technology, the viability of NPC cells was inhibited significantly. Next, plate colony formation assay was adopted to determine the impacts of S100A8 and S100A9 on the colony-formation ability of NPC cells. The results indicated that siRNA S100A8/S100A9 could repress the formation of NPC cell clones remarkably, and the number of clones was decreased notably (Figure 2(b)). Subsequently, the regulatory effects of S100A8 and S100A9 on the proliferative ability of NPC cells were examined via EdU staining, and it was manifested that there was an evidently reduced number of red fluorescent cells in the siRNA group and a distinctly raised number of red fluorescent cells in the overexpression group (Figure 3(a)), also demonstrating that siRNA S100A8/S100A9 can repress the proliferation of NPC cells apparently. Finally, the expression levels of PI3K and Akt in the PI3K/Akt signaling pathway were measured to further explore the regulatory mechanism of S100A8 and S100A9. According to the results (Figures 4(a) and 5(a)), compared with the control group, siRNA S100A8/S100A9 can significantly inhibit the expression of PI3K and Akt in nasopharyngeal carcinoma cells. The PI3K/Akt pathway inhibitor Wortmannin inhibits PI3K/Akt pathway activation. Compared with the control group, the cells of nasopharyngeal carcinoma cells in the overexpression group showed a significant decrease in viability at 48 h and 72 h, indicating that the ability of S100A8/S100A9 to promote the proliferation of nasopharyngeal carcinoma cells was weakened after inhibiting PI3K/Akt pathway activation. The above results suggest that the potential mechanism of S100A8/S100A9 to inhibit the proliferation of nasopharyngeal carcinoma cells may be related to the inhibition of PI3K/Akt signaling pathway.In conclusion, with the influences of S100A8 and S100A9 on the proliferation of NPC cells as the breakthrough point in this research, the experimental results can provide a favorable experimental basis for the development and application of S100A8 and S100A9 as the molecular targets in resisting NPC.