Literature DB >> 34519039

A small Rho GTPase OsRacB is required for pollen germination in rice.

Yangfan Xu1, Wenguo Cai1, Xiaofei Chen1, Mingjiao Chen1, Wanqi Liang1.   

Abstract

Plant Rho small GTPases (Rop/Rac) are versatile molecular switches regulating many plant developmental processes. Particularly, their important functions in regulating pollen development have been demonstrated in Arabidopsis. A group of conserved Rop/Rac activators RopGEFs were recently reported to regulate rice (Oryza sativa) pollen tube germination, indicating that rice and Arabidopsis may have a conserved Rop/Rac mediated signaling pathway in regulating pollen tube growth. However, the Rop/Rac activated by the rice pollen specific RopGEFs remains to be identified. Here we demonstrated a Rop/Rac gene, OsRacB, co-expressed with the mature pollen expressed OsRopGEF2/3/6/8. The knockout mutants were normal in anther and pollen development but defective in the pollen grain germination, suggesting a specific and non-redundant role of OsRacB in the mature pollen. We further demonstrated that OsRacB is directly activated by the pollen specific expressing OsRopGEFs in vitro. Together with the previous study, we establish a RopGEF-Rop/Rac regulon which plays essential roles in rice pollen grain germination. Our data encourage further identification of the upstream and downstream players of RopGEF-Rop/Rac signaling in pollen germination and have agricultural implications for breeding robust seed yielding cultivars.
© 2021 The Authors. Development, Growth & Differentiation published by John Wiley & Sons Australia, Ltd on behalf of Japanese Society of Developmental Biologists.

Entities:  

Keywords:  Rho small GTPases; pollen germination; rice

Mesh:

Substances:

Year:  2021        PMID: 34519039      PMCID: PMC9292018          DOI: 10.1111/dgd.12752

Source DB:  PubMed          Journal:  Dev Growth Differ        ISSN: 0012-1592            Impact factor:   3.063


INTRODUCTION

Double fertilization is a crucial process in flowering plant sexual reproduction, which consists of multiple sophisticated steps. Pollen grains hydrate and germinate shortly after the mature pollen grains adhere to and is recognized by the compatible stigma; and thereafter pollen tubes penetrate through the pistil to deliver two immotile sperm cells into the ovules where the double fertilization occurs. Therefore, robust pollen germination and pollen tube growth are essential for successful fertilization and thus seed production in flowering plants. In recent decades, our understanding of the molecular mechanisms implicated in the regulation of the above process has greatly advanced with the genetic and biochemical studies in the dicot model species Arabidopsis. It is established that coordinated vesicular transport, highly dynamic cytoskeleton, cell wall deposition and remodeling, ROP GTPase (Rho‐like small GTPase proteins)‐based signaling, reactive oxygen species (ROS) and calcium signaling are crucial for pollen germination and pollen tube growth (Guan et al., 2013). Nevertheless, the molecular mechanisms underlying pollen tube germination and growth in monocot crops such as rice (Oryza sativa) are yet largely unknown. Rho‐type GTPases of plants, commonly nominated as Racs in rice and ROPs in Arabidopsis, belong to the Rho/Ras small guanosine triphosphatases (GTPases) superfamily. ROP/Racs serve as molecular switches to regulate multiple fundamental cellular processes in plants, including defense, cell polarity establishment, cell wall patterning and hormone response (Feiguelman et al., 2018). Like the heterotrimeric G proteins (large G proteins), the monomeric ROP/Rac proteins switch their on‐or‐off states by cycling between a GTP bound (active) state and a GDP bound (inactive) state (Nielsen, 2020). Guanine nucleotide exchange factors (GEFs) activate ROP/Rac by catalyzing the exchange of GDP and GTP. Upon activation, the GTP‐bound ROP/Racs interact with their downstream effectors to signal cellular responses, such as calcium oscillation, actin remodeling and reactive oxygen species burst (Uhrig & Hülskamp, 2006; Zhou et al., 2015). Active ROP/Rac returns to its resting state through its weak intrinsic GTPase activity for GTP hydrolysis or an efficient deactivation by GTPase‐activating protein (GAP). Fourteen ROP genes are found in the Arabidopsis genome (Christensen et al., 2003; Li et al., 1998). Among them, three closely related Arabidopsis ROP genes (ROP1, ROP3, and ROP5) are highly expressed in the mature pollen and play important roles in pollen tube growth. GTP‐bound active ROP proteins are specifically localized to the apical plasma membrane of pollen tube to define its apical growing domain and regulate polar exocytosis (Li et al., 2018a; 2018b; Luo et al., 2017). In a feedback, exocytosis regulates the maintenance of ROP proteins on pollen tube apexes. Therefore, ROP proteins, their regulators and associated cellular processes maintain a self‐organizing region for the pollen tube tip growth (Li, Luo, et al., 2018; Luo et al., 2017). Oriented pollen tube growth is dependent on the regulation of this self‐organizing center by the female gametophyte derived attracting peptides. In Arabidopsis, pollen‐preferentially expressed ROP activator RopGEF8/9/12/13 modify the ROP activity in response to the ovule‐derived small peptides (Gu et al., 2006; Takeuchi & Higashiyama, 2016; Zhang & McCormick, 2007). These studies demonstrated that the ROP activity interchanges in Arabidopsis pollen tube is required for the pollen tube tip growth as well as pollen tube guidance. Nevertheless, not until very recently the ROP/Rac activity cycle was shown to be involved in rice pollen tube growth. Kim et al. demonstrated that two highly conserved OsRopGEF genes play specific roles in regulating pollen germination and pollen tube growth (Kim et al., 2020). Their results suggested a conserved role of rice ROP/Racs in mediated signaling as in Arabidopsis, though more detailed studies of that in rice were required to support this assumption. Here, we report that a rice mature pollen specifically expressing Rac gene, OsRacB, has a specific role in pollen germination. The loss‐of‐function mutants displayed normal anther and pollen development but defective pollen germination, leading to complete male sterility. In alignment with the previous study on rice pollen germination regulating OsRopGEF, we identified OsRacB as a direct effector of OsRopGEF2/3/6. Our results together with previous findings provide essential information on how the rice pollen germination and pollen tube growth is regulated at a molecular level.

RESULTS

Co‐expression of OsRacB with OsRopGEF2/3/6/8 in late anther development stages

Genes preferentially expressed in the mature anther and pollen are presumed to be functionally associated with pollen tube germination and growth (Ling et al., 2015; Moon et al., 2018). At the late anther developmental stages, pollen grains progressively mature with accumulation of reserve materials and energy prepared for pollen grain germination and pollen tube growth. Recently, Kim et al. (2020) have illustrated that the pollen tube regulators OsRopGEF2/3/6/8 are specifically expressed at the late anther development stages. We speculate that at least one of the targets of these RopGEFs, i.e. Rop/Rac, may have a similar expression pattern. Noticeably, previous in silico expression study indicated that OsRac6, more commonly known as OsRacB, is the only member that is highly expressed in mature pollen (Kim et al., 2020), implicating OsRacB as the potential downstream target of OsRopGEF2/3/6/8. To test this hypothesis, we first confirmed the gene expression of the OsRopGEF2/3/6/8 and OsRacB genes in our experimental conditions, and an OsRacB paralog, OsRacD, was used as a nonspecific expression gene control. Consistent with the previous report, the expression of OsRopGEF2/3/6/8 was not detectable or at a low level during early anther development stages (Kim et al., 2020). Subsequently, their expression increased dramatically at stage 13 (Figure 1). A very similar expression pattern was also observed for OsRacB. In contrast, OsRacD had nonspecific and low expression at all anther developmental stages (Figure 1). These results prompted us to further explore the role of OsRacB in pollen germination and pollen tube growth.
FIGURE 1

OsRacB co‐expresses with OsGEF2/3/6/8 at late anther developmental stage. qRT‐PCR analysis of the expression of OsRacB, OsRacD and pollen specific OsGEFs in anthers at various developmental stages. Rice ubiquitin gene (OsUBQ, LOC_Os03g13170) was used as an internal control. X‐axis represents different anther developmental stages. Each gene expression was normalized in relative with OsUBQ; N.D., not detectable, neglectable expression. Error bars indicate SD of three biological replicates

OsRacB co‐expresses with OsGEF2/3/6/8 at late anther developmental stage. qRT‐PCR analysis of the expression of OsRacB, OsRacD and pollen specific OsGEFs in anthers at various developmental stages. Rice ubiquitin gene (OsUBQ, LOC_Os03g13170) was used as an internal control. X‐axis represents different anther developmental stages. Each gene expression was normalized in relative with OsUBQ; N.D., not detectable, neglectable expression. Error bars indicate SD of three biological replicates

OsRacB is essential for rice reproduction

Previous study has shown that Osropgef2/8 double mutant displayed reduced pollen germination and partial male sterility. To verify whether the mutation in OsRacB causes similar phenotype, two target sites in the first and second exon of OsRacB gene coding sequences were edited by CRISPR/Cas9 genome editing tool (Figure S1; Xie et al., 2015). The chosen targets were aimed at disrupting the conserved N‐terminal domain of Rho GTPase in OsRacB (Christensen et al., 2003). A catalytic G‐domain, which contained five G‐box motifs (G1–G5), was on the N‐terminal of OsRacB, and it was necessary for nucleotide binding, GTP hydrolysis, and Mg2+ binding (Feiguelman et al., 2018). Five homozygous or biallelic mutants were obtained (Figure S1). These mutants contained mutations that caused frame‐shift and introduced stop codon before the G‐domain in Osracb‐1/‐3/‐4, while Osracb‐2/‐5 only contained the G‐box motifs G1 and G2, and thus represented knock‐out alleles of OsRacB. Osracb mutants were indistinguishable from wild‐type plants at vegetative growth stage (Figure 2a, data not shown), indicating that OsRacB may be not essential for the vegetative growth. Nevertheless, OsRacB is clearly important for rice reproduction as almost no seeds were obtained from the Osracb mutants (Figure 2b and S2). This coincides with the mature pollen preferred expression pattern of OsRacB. Our detailed phenotype observations suggest that the Osracb mutants had normal panicle, spikelet, anther development as wild‐type (Figure 2c–g). Additionally, no difference of pollen grain morphology and pollen viability between Osracb mutants and wild‐type was seen (Figure 2h–k). Taken together, the Osracb mutants did not exhibit defects before seed setting, which is similar to the Osropgef2/8 double mutant.
FIGURE 2

Osracb‐1 exhibits normal pollen maturation but is completely sterile. (a) Whole plants at the heading stage. Scale bar: 10 cm. (b) Panicles at the mature stage. Scale bar: 2 cm. (c) Panicles at the flowering stage. Scale bar: 2 cm. (d, e) Mature spikelets before anthesis. Scale bars: 1 mm. (f, g) Mature spikelets after removing the palea and lemma. Scale bars: 1 mm. (h, i) Scanning electron microscopy image of pollen grains at anther development stage 13. Scale bars: 5 µm. (j, k) Iodine potassium iodide (I2‐KI) staining of pollen grains at anther development stage 13. Scale bars: 50 µm

Osracb‐1 exhibits normal pollen maturation but is completely sterile. (a) Whole plants at the heading stage. Scale bar: 10 cm. (b) Panicles at the mature stage. Scale bar: 2 cm. (c) Panicles at the flowering stage. Scale bar: 2 cm. (d, e) Mature spikelets before anthesis. Scale bars: 1 mm. (f, g) Mature spikelets after removing the palea and lemma. Scale bars: 1 mm. (h, i) Scanning electron microscopy image of pollen grains at anther development stage 13. Scale bars: 5 µm. (j, k) Iodine potassium iodide (I2‐KI) staining of pollen grains at anther development stage 13. Scale bars: 50 µm

OsRacB mutations affect pollen germination and pollen tube growth

To distinguish whether the seed abortion in Osracb mutants was a result of the impairment of stamens or pistils, the male and female fertility of the Osracb mutant was tested by reciprocal crossings between Osracb and wild‐type (WT, O. sativa subsp. Japonica cv. 9522). In parallel, a previously characterized male sterile mutant thermo‐sensitive sterile 10 (tms10) was used as a maternal parent as a control for crossing efficiency (Yu et al., 2017). As all five alleles displayed similar phenotypes, we used Osracb‐1 in the following assays. Osracb‐1 and tms10 displayed comparable seed setting rates when they were pollinated with wild‐type pollen grains, respectively. On the contrary, wild‐type plants set no seed when pollinated with Osracb‐1 pollen grains (Figure 3a,b), indicating that loss function of OsRacB affects male but not female reproduction.
FIGURE 3

OsRacB mutation affects pollen tube germination. (a, b) Panicles (a) and seed setting rates (b) of the female parents of crosses between tms10 (♀) × WT (♂), WT (♀) ×Osracb‐1(♂) and Osracb‐1 (♀) × WT (♂). Scale bar: 2 cm. (c, d) In vitro pollen germination assay (c) and the germination rates (d) of WT and Osracb‐1 in the solid pollen media. Scale bar: 100 µm. (e) In vivo pollen‐germination assays of WT and Osracb‐1. Arrow heads indicate the pollen tube. Scale bar: 500 µm. Phenotypes in (a–e) were observed at least three times independently with similar results

OsRacB mutation affects pollen tube germination. (a, b) Panicles (a) and seed setting rates (b) of the female parents of crosses between tms10 (♀) × WT (♂), WT (♀) ×Osracb‐1(♂) and Osracb‐1 (♀) × WT (♂). Scale bar: 2 cm. (c, d) In vitro pollen germination assay (c) and the germination rates (d) of WT and Osracb‐1 in the solid pollen media. Scale bar: 100 µm. (e) In vivo pollen‐germination assays of WT and Osracb‐1. Arrow heads indicate the pollen tube. Scale bar: 500 µm. Phenotypes in (a–e) were observed at least three times independently with similar results Given the normal pollen grain viability of Osracb‐1, we assume that the mutants are defective in the fertilization process. We therefore compared the pollen germination efficiency of Osracb‐1 and WT. Under our in vitro pollen germination condition, the germination rate of wild‐type pollen grains was 78.8%. On the contrary, only 3.9% of Osracb‐1 pollen grains germinated even though the pollen hydration was not affected (Figure 3c,d). Consistently, no germination of Osracb‐1 pollen grains on the stigma was observed (Figure 3e). The Osracb‐1 single mutant phenocopies Osropgef2/8 double mutants suggests that OsRacB might work in the same pathway with OsRopGEF2/8.

OsRacB is directly activated by OsRopGEF2/3/6 in vitro

Generally, RopGEF proteins physically interact with ROP/Rac proteins and catalyze the otherwise slow GDP dissociation for subsequent GTP binding (Berken et al., 2005). To identify which OsRopGEFs may interact with OsRacB, we performed a yeast‐two‐hybrid assay. Furthermore, a constitutively active form of OsRacB (CA‐OsRacB) containing a G15V mutation and a dominant‐negative form of OsRacB (DN‐OsRacB) containing a T20N mutation were also tested, as previous studies have shown that GEFs may preferentially interact with different forms of GTPases (Gu et al., 2006; Shinohara et al., 2002; Yamaguchi et al., 2012). Our results indicated that wild‐type OsRacB interacted with OsRopGEF3/8 but not OsRopGEF2/6 in yeast, while CA‐/DN‐OsRacB only associated to OsRopGEF8 (Figure 4a). We further detected the interaction through a pull‐down assay. Using GST‐fused CA‐/DN‐/wild‐type OsRacB as baits, 6×His‐tagged OsRopGEF2/3/6/8 were detected in the precipitated protein complexes by His antibody. As shown in Figure 4b, the recombinant GST fusion proteins OsRacB‐GST, including CA‐/DN‐/wild‐type forms, precipitated with RopGEF2/3/6/8‐6xHis. Interestingly, OsRopGEF8 was more inclined to bind with DN‐OsRacB, while OsRopGEF2/3/6 did not show any difference in the interaction with CA‐/DN‐/wild‐type‐OsRacB. Subsequently, the guanine exchange activity of OsRopGEF2/3/6/8 towards OsRacB was tested using a fluorescence spectroscopy–based assay (Eshraghi et al., 2020; Singh et al., 2017). This assay is based on the spectroscopic difference between bound and unbound N‐MAR‐GTP, a fluorescent analog to the guanine nucleotide. In our experiment, once bound to OsRacB, the emission intensity of the fluorophore would increase dramatically. The results showed that the intrinsic guanine nucleotide exchange rate of OsRacB increased with elevated OsRacB concentration (Figure S3a). The guanine nucleotide exchange rates can be dramatically enhanced by the presence of OsRopGEF2/3/6/8 in a concentration dependent manner (Figure 4c–f). Our experiments also showed that OsRopGEF3 has a stronger activation activity towards OsRacB comparing with the other tested OsRopGEF.
FIGURE 4

OsRacB is directly activated by OsRopGEF2/3/6 in vitro. (a) Yeast‐two‐hybrid with CA‐/DN‐/wild‐type OsRacB and OsRopGEF2/3/6/8. OsRacBs was cloned into pGADT7, and OsRopGEF2/3/6/8 were cloned into pGBKT7 (BK); Yeast medium: Yeast Synthetic Drop‐out Medium without tryptophan and leucine (‐W/‐L) or without tryptophan, leucine, and histidine (‐W/‐L/‐H). (b) OsRopGEFs‐OsRacBs pull‐down assay. (c‐f) The guanine nucleotide exchange activity of OsRacB was enhanced by OsRopGEF2/3/6/8. 1 µM OsRacB was added to the exchange reaction buffer at 0 s, and multiple concentration (0.1/0.5/1 µM) of OsRopGEFs were added after five readings respectively (OsRacB alone as control groups). Standardized RFU: standardized Relative fluorescence was calculated in relative to its corresponding non‐RopGEF mock and in relative to the florescence at the starting point (0 s)

OsRacB is directly activated by OsRopGEF2/3/6 in vitro. (a) Yeast‐two‐hybrid with CA‐/DN‐/wild‐type OsRacB and OsRopGEF2/3/6/8. OsRacBs was cloned into pGADT7, and OsRopGEF2/3/6/8 were cloned into pGBKT7 (BK); Yeast medium: Yeast Synthetic Drop‐out Medium without tryptophan and leucine (‐W/‐L) or without tryptophan, leucine, and histidine (‐W/‐L/‐H). (b) OsRopGEFs‐OsRacBs pull‐down assay. (c‐f) The guanine nucleotide exchange activity of OsRacB was enhanced by OsRopGEF2/3/6/8. 1 µM OsRacB was added to the exchange reaction buffer at 0 s, and multiple concentration (0.1/0.5/1 µM) of OsRopGEFs were added after five readings respectively (OsRacB alone as control groups). Standardized RFU: standardized Relative fluorescence was calculated in relative to its corresponding non‐RopGEF mock and in relative to the florescence at the starting point (0 s) Taken together, our results demonstrated that OsRacB acts downstream of OsRopGEFs as a specific regulator of pollen germination.

DISCUSSION

Our present work provides evidence that OsRacB functions downstream of the previously reported rice pollen specific RopGEFs to regulate pollen germination. Our results reveal that OsRacB co‐expressed with OsRopGEF2/3/6/8 in the mature anther. The knock‐out Osracb mutants phenocopy the Osropgef2/8 double mutant, exhibiting reduced pollen germination and seed setting. Further study through Y2H, pull‐down and activation assay showed OsRacB is activated by OsRopGEF2/3/6/8 in vitro. It seems that the function of RopGEF‐Racs regulon in pollen germination and growth is conserved in monocot and dicots. In Arabidopsis, different RopGEF and ROP/Racs have been shown to regulate pollen hydration, pollen germination, pollen tube growth and directed growth towards to ovules (Chen et al., 2013; Liu et al., 2021; Luo et al., 2017). A paradigm of Rop GTPase activity cycle mediated pollen‐pistil communication was established in Arabidopsis. The ovule derived cysteine‐rich polypeptides AtLUREs act as attractants for pollen growth (Okuda et al., 2009). They directly trigger Pollen‐specific Receptor‐like Kinases (PRKs), which subsequently activate RopGEFs (Chang et al., 2013; Takeuchi & Higashiyama, 2016; Zhang & McCormick, 2007). The gated ROP GTPase activity by RopGEFs is important for the pollen tube tip growth rate and direction. Our data instead suggested that the activation of OsRacB by RopGEFs is specifically required for pollen germination upon rice pollen grain hydration. Unlike the pollen tube growth guidance, very little is known about how RopGEF‐Racs are involved in the pollen germination (Chen et al., 2013). The establishment of this RopGEFs‐RacB axis would facilitate further investigating its upstream regulators and downstream effectors in this process. As pollen tube growth is essential for rice seeds production, revealing these regulators together with knowledge of the abundant rice genetic variations such as the 3K rice project (Rice Genome Project, 2014; Zhao et al., 2018) would enhance our opportunity to breed new rice cultivars with improved pollen vigor and robustness. So far, the function of the seven rice ROP/Racs genes remains largely unrevealed. Besides OsRacB, OsRac3 and OsRac5 are also expressed in anther albeit not limited to the later stages (Kim et al., 2020). The complete sterility of Osracb suggests that OsRacB plays an essential and non‐redundant role in pollen germination. OsRac3 and OsRac5 may be important for the post‐germination growth as their Arabidopsis orthologs. Previous work demonstrated that OsRacB also participated in regulating plant pathogen resistance and salt tolerance (Jung et al., 2006; Luo et al., 2006). Particularly, the barley (Hordeum vulgare) orthologue HvRacB was shown to negatively regulate barley abiotic stress tolerance (McCollum et al., 2020; Schultheiss et al., 2003, 2005). Similarly, OsRac1 a renowned rice disease resistance regulating gene was recently shown to moonlight as a grain size regulator (Ono et al., 2001; Suharsono et al., 2002; Zhang et al., 2019). In these various biological processes, the functional diversity of ROP/Racs may simply attribute to the same underling molecular mechanism such as ROS production and cytoskeleton organization, etc. The elucidation of the functional specificity of ROP/Rac requires thorough comparisons of their spatiotemporal expression patterns and associations with the activators and effectors. In an earlier study, it has been shown that ROPs were directly activated by RopGEFs, and the first RopGEF in Arabidopsis was identified by a yeast two‐hybrid screen using DN‐ROP4 (D121N) as the bait (Berken et al., 2005). Our study also demonstrated that OsRopGEF2/3/6/8 directly interacts with OsRacB in the pull‐down assay, and the guanine exchange reaction suggested their function in activation of OsRacB. Nevertheless, our results from Y2H assay informed that OsRopGEF2/3/6/8 have different affinity to OsRacB. OsRopGEF8 interacted with CA, DN and the wild‐type forms of OsRacB, and OsRopGEF3 only interacted with wild‐type OsRacB. However, OsRopGEF2/6, which have been shown to activate OsRacB in guanine exchange reaction, did not interact with OsRacB in Y2H assay. It is speculated that the activities of OsRopGEF2/6 toward OsRacB may not rely on a strong and tight proteins association. Or the actual interactions between ROPs and GEFs would be hindered by the conditions in yeast, such as nuclear localization, and so on. Interestingly, OsRopGEF8 showed higher affinity to DN‐OsRacB, which differs from other OsRopGEFs, indicating OsRopGEF8 may be easy to bind GDP‐RacB and release the GDP in vivo. The recombinant OsRopGEF proteins showed multiple bands of different apparent molecular sizes on the SDS‐PAGE gel except OsRopGEF3. Similar multiple bands were seen for Arabidopsis RopGEF proteins prepared from E. coli and infiltrated tobacco (Chang et al., 2013; Li et al., 2018a; 2018b; Zhao et al., 2015). Thus, the multiple bands are likely resulted from a yet unknown modification of the proteins rather than artifacts during proteins preparation. Our data showed that OsRacB interacted roughly equally to the two OsRopGEF2 bands of different sizes while it preferred the larger OsRopGEF8, suggesting a biological meaning of the unknown RopGEF modification. The nature of the modification and the significance of their association with RopGEF needs further investigation. The binding propensity may be the reason for the result that OsRopGEF8 showed lower activity in GEF activity assay compared with OsRopGEF2/3/6 at the same concentration. In the previous study, OsRopGEF2/8 were shown to act redundantly to regulate pollen germination (Kim et al., 2020). Since Osracb mutants are nearly completely male sterile while the Osropgef2/8 double mutants maintain low fertility. Other pollen specific OsRopGEFs, OsRopGEF3/6, may undertake the role as OsRacB activators to regulate pollen germination in vivo.

MATERIALS AND METHODS

Plant materials and growth conditions

Rice materials including wild‐type (Oryza sativa subsp. Japonica cv. 9522) and CRISPR/Cas9 edited lines were grown in the paddy field at Shanghai Jiao Tong University (Shanghai, China) during the natural growing season (from June to September). For the targeted editing of OsRacB, CRISPR/Cas9 construction with sgRNA (5′‐CATAAAGTGCGTCACCGTCG‐3′; 5′‐CAACTTCAGTGCCAACGTCG‐3′) was used for targeting the first and second exon of the OsRacB (LOC_Os02g02840) according to Xie et al. (2015). Primers are listed in Table S1. Agrobacterium‐mediated transformation of the rice callus and regeneration of rice plants were used for OsRacB gene edit lines.

Characterization of the mutant phenotype

Morphological images of the whole rice plants and the inflorescences after flowering and fruiting were photographed with a Canon digital camera. The spikelets, the opened flowers and the dehiscent anthers were captured by a Leica stereoscopy (M205A). For pollen viability assay, wild‐type and Osracb anthers were soaked in iodine sodium iodine (I2‐KI) staining solution (8% KI, 1% I2) and crushed with tweezers to release pollen grains, the staining was immediately imaged with the microscopy (Nikon ECLIPSE 80i with Nikon DS‐Ri1 digital camera). To observe the pollen morphology, wild‐type and Osracb flowers were firstly fixed in FAA solution (5% formaldehyde [originally in 37% solution provided], 5% acetic acid, 63% ethanol, 27% H2O) for 2 h, and then flowers were successively dehydrated with 70%–100% ethanol with 10% increase in ethanol each step. Subsequently, the samples were dried with an automated critical point dryer (Leica EM CPD300) and glued to a copper table with conductive adhesive with anthers crushed with tweezers to release the pollen grains. The released pollen grains were coated with gold using a vacuum coater (Leica EM SCD050) later. Finally, the pollen grains were photographed with a scanning electron microscope (HITACHI S‐3400N II).

In vitro pollen‐germination assays

To observe the in vitro pollen germination, on the day of pollen dispersal and filaments elongation, wild‐type and Osracb pollen grains were collected by gently shaking panicles into the solid germination medium (0.8%–1% Agar, 4% PEG‐4000, 18% Sucrose, 1 mM MgSO4, 1 mM Ca(NO3)2, 0.01% H3BO3, pH = 6.4), and cultured in the dark oven at 28°C for 1 h. The germinating was imaged with microscopy (Nikon ECLIPSE 80i). Pollen‐germination assays were repeated three times independently, for each repeat at least three flowers and more than 200 pollen grains in five sights were counted.

Aniline blue staining of pollen tubes in vivo

To observe the pollen‐tube in vivo, Aniline blue staining of pollen tubes in vivo was conducted as previously reported (Zhang et al., 2020). Briefly, about 6 hours after pollination, the pistils of wild‐type and Osracb were cut and fixed with Carnoy's solution (glacial acetic acid: ethanol = 1:3) for 4 h, and then pistils were washed with 70%, 60%, 40%, 20% ethanol and distilled water successively. Subsequently, the pistils were softened with 8 M NaOH at room temperature overnight, then washed with distilled water, and stained in 0.1% aniline blue dye (in 0.1 M K2HPO4, pH 8.5) at room temperature for 4–6 h in the dark. Fluorescent images were captured by an Eclipse Ni‐E microscope (Nikon) under UV light.

Gene expression analysis

For gene expression analysis, rice anthers developmental stages were judged from the anther morphology according to Zhang et al. (2011). The anthers were collected and extracted RNA with a TRIzol RNA extraction kit (TIANGEN Biotech) according to manufacturer’s instructions. Subsequently, approximately the same amount of RNA was used for cDNAs with FastKing RT Kit (TIANGEN Biotech). qPCR primers were as listed in Table S1. QuantiNova SYBR Green PCR Kit (TIANGEN Biotech) was used for quantitative PCR (qPCR). qPCR cycling conditions are as follows: 95°C for 30 s for pre‐incubation, 95°C for 5 s and 60°C for 30 s were used for two‐step amplification, and total 50 cycles. The highly stable expression gene rice Ubiquitin (UBQ, LOC_Os03g13170) was used as an internal control (Li et al., 2014; Pabuayon et al., 2016). To determine the significant expression changes of four RopGEF genes and OsRacB in different stages, we performed qPCR analysis with three independent biological replicates. Relative transcript levels and fold change were calculated by the 2−ΔΔCt methods, respectively.

Protein expression and purification

The dominant‐negative (T20N) and constitutively active (G15V) OsRacB were generated by site‐directed mutagenesis, according to previous research (Li et al., 1999). CA‐/DN‐/wild‐type OsRacB and OsRopGEF2/3/6/8 were cloned into pGEX‐4T‐1 and pET‐32a(+) with a one‐step cloning kit (ClonExpress® II, Vazyme), and wild‐type OsRacB was also cloned into pET28a(+) (primers are listed in Table S1). The confirmed plasmids were then transformed into E. coli (Escherichia coli) cells Rosetta (DE3). The cells were then inoculated into 500 ml of LB with corresponding antibiotics at 37°C until OD600 = 0.7. The cell culture was then cooled to 18°C before isopropyl‐β‐D‐thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mM, and cells were incubated for an additional 12 h at 18°C to induce the expression of the tagged proteins: CA‐/DN‐/wild‐type OsRacB‐GST (Glutathione S‐Transferase), OsRacB‐6xHis (polyhistidine) and OsRopGEFs‐6xHis (polyhistidine). Cells were harvested by centrifugation at 4000 g for 20 min and stored at −80°C. The CA‐/DN‐/wild‐type OsRacB‐GST, OsRacB‐6xHis and OsRopGEFs‐6xHis tagged protein was purified using Glutathione HiCap Matrix or nickel‐nitrilotriacetic acid (Ni‐NTA) agarose (Qiagen), respectively, under native conditions according to the manufacturer's instructions.

Protein interaction assay

For the Y2H assay, the coding sequences of CA‐/DN‐/wild‐type OsRacB protein were cloned into pGADT7 and OsRopGEF2/3/6/8 into pGBKT7, then transformed into the yeast (Saccharomyces cerevisiae) strain AH109. The Y2H assays were performed according to the manufacturer's user manual (Clontech). Briefly, the transformed yeast cells were selected on synthetic dropout (SD/‐Leu/‐Trp) nutrient media, and the interaction was tested on the synthetic dropout medium plate (SD/‐Leu/‐Trp/‐His). Primers used in this assay are shown in Table S1. The procedures for the pull‐down assay were modified from a previous report (Li et al., 2018a; 2018b). Approximately 2 µg of purified recombinant bait proteins (CA‐/DN‐/wild‐type OsRacB‐GST or GST) were incubated with 2 µg of prey protein (OsRopGEF2/3/6/8‐6xHis) in 2 ml binding buffer (50 mM Tris‐HCl, pH 7.5, 100 mM NaCl, and 0.6% [v/v] Triton X‐100) at 4°C for 2.5 h. Following the addition of glutathione sepharose 4B beads (GE Healthcare), the samples were further incubated for 1 h. After washing with binding buffer, the precipitated proteins were eluted by heating the beads in 2× SDS loading buffer at 95°C for 10 min and then separated on a 10% (w/v) SDS‐PAGE gel by electrophoresis, and transferred to nitrocellulose membranes (BioTraceTM, Pall Laboratory). The proteins were analyzed by immunoblotting with anti‐GST (Abcam, ab19256) and anti‐His (ab237339) primary antibodies. The chemiluminescence of the membrane was subsequently developed with Omni‐ECL™ (Epizyme, SQ202L) and imaged with ChemiDocTM MP (BioRad).

Guanine nucleotide exchange assay

The guanine nucleotide exchange activity of different concentrations of OsRacB, and the effect of RopGEF2/3/6/8 on the activity of OsRacB were monitored using a RhoGEF Exchange Assay Biochem Kit (Cytoskeleton, Cat. # BK100) according to the manufacturer's protocol. The fluorescence intensity was detected by a multimode microplate reader (Tecan, Spark). OsRacB‐6xHis and OsRopGEF2/3/6/8‐6xHis were expressed in E. coli as described above, OsRopGEF2/3/6/8. Briefly, 2.5 µl OsRacB was added to 7.5 µl of 2×exchange reaction buffer [40 mM Tris pH 7.5, 100 mM NaCl, 20 mM MgCl2, 1.5 µM N‐MAR‐GTP (BK100, Cytoskeleton)] in black 384‐well plates. Plates were then read immediately (excitation, 485 nm ± 20 nm; emission, 535 nm ± 20 nm; gain, 65). After five readings (1 reading per 30 s), 5 µl OsRopGEF2/3/6/8 or ddH2O was added to the wells, with an immediate resumption of the reading (60 readings for a total of 30 min). Three independent assays were performed. Fold‐change relative fluorescence was normalized to the fluorescence at the starting point (0 s); standardized relative fluorescence was calculated in relative to its corresponding non‐RopGEF mock and in relative to the florescence at the starting point (0 s).

CONFLICT OF INTEREST

The authors declare no competing interests.

AUTHOR CONTRIBUTIONS

Conceived by: W. C. and W. L. F. X. and W. C. did the major analysis and experiments. F. X and W. C. and W. L. wrote the manuscript. All authors read and approved the final manuscript. Supplementary Material Click here for additional data file.
  44 in total

1.  RopGEF2 is involved in ABA-suppression of seed germination and post-germination growth of Arabidopsis.

Authors:  Shujuan Zhao; Yuxuan Wu; Yuqing He; Yarui Wang; Jun Xiao; Lin Li; Yanping Wang; Xi Chen; Wei Xiong; Yan Wu
Journal:  Plant J       Date:  2015-11-11       Impact factor: 6.417

Review 2.  The Small GTPase Superfamily in Plants: A Conserved Regulatory Module with Novel Functions.

Authors:  Erik Nielsen
Journal:  Annu Rev Plant Biol       Date:  2020-04-29       Impact factor: 26.379

3.  Tip-localized receptors control pollen tube growth and LURE sensing in Arabidopsis.

Authors:  Hidenori Takeuchi; Tetsuya Higashiyama
Journal:  Nature       Date:  2016-03-10       Impact factor: 49.962

4.  p115 RhoGEF activates the Rac1 GTPase signaling cascade in MCP1 chemokine-induced vascular smooth muscle cell migration and proliferation.

Authors:  Nikhlesh K Singh; Jagadeesh Janjanam; Gadiparthi N Rao
Journal:  J Biol Chem       Date:  2017-06-27       Impact factor: 5.157

5.  Rice GTPase OsRacB: potential accessory factor in plant salt-stress signaling.

Authors:  Min Luo; Su-Hai Gu; Shu-Hui Zhao; Fang Zhang; Nai-Hu Wu
Journal:  Acta Biochim Biophys Sin (Shanghai)       Date:  2006-06       Impact factor: 3.848

6.  SWAP-70 is a guanine-nucleotide-exchange factor that mediates signalling of membrane ruffling.

Authors:  Masahiro Shinohara; Yoh Terada; Akihiro Iwamatsu; Azusa Shinohara; Naoki Mochizuki; Maiko Higuchi; Yukiko Gotoh; Sayoko Ihara; Satoshi Nagata; Hiroshi Itoh; Yasuhisa Fukui; Rolf Jessberger
Journal:  Nature       Date:  2002-04-18       Impact factor: 49.962

7.  Pan-genome analysis highlights the extent of genomic variation in cultivated and wild rice.

Authors:  Qiang Zhao; Qi Feng; Hengyun Lu; Yan Li; Ahong Wang; Qilin Tian; Qilin Zhan; Yiqi Lu; Lei Zhang; Tao Huang; Yongchun Wang; Danlin Fan; Yan Zhao; Ziqun Wang; Congcong Zhou; Jiaying Chen; Chuanrang Zhu; Wenjun Li; Qijun Weng; Qun Xu; Zi-Xuan Wang; Xinghua Wei; Bin Han; Xuehui Huang
Journal:  Nat Genet       Date:  2018-01-15       Impact factor: 38.330

8.  Functional analysis of barley RAC/ROP G-protein family members in susceptibility to the powdery mildew fungus.

Authors:  Holger Schultheiss; Cornelia Dechert; Karl-Heinz Kogel; Ralph Hückelhoven
Journal:  Plant J       Date:  2003-12       Impact factor: 6.417

9.  Reference genes for accurate gene expression analyses across different tissues, developmental stages and genotypes in rice for drought tolerance.

Authors:  Isaiah M Pabuayon; Naoki Yamamoto; Jennylyn L Trinidad; Toshisangba Longkumer; Manish L Raorane; Ajay Kohli
Journal:  Rice (N Y)       Date:  2016-07-18       Impact factor: 4.783

10.  The REN4 rheostat dynamically coordinates the apical and lateral domains of Arabidopsis pollen tubes.

Authors:  Hui Li; Nan Luo; Weidong Wang; Zengyu Liu; Jisheng Chen; Liangtao Zhao; Li Tan; Chunyan Wang; Yuan Qin; Chao Li; Tongda Xu; Zhenbiao Yang
Journal:  Nat Commun       Date:  2018-07-03       Impact factor: 14.919

View more
  1 in total

1.  A small Rho GTPase OsRacB is required for pollen germination in rice.

Authors:  Yangfan Xu; Wenguo Cai; Xiaofei Chen; Mingjiao Chen; Wanqi Liang
Journal:  Dev Growth Differ       Date:  2021-10-05       Impact factor: 3.063

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.