Literature DB >> 34510794

Detection of Campylobacter jejuni diversity by clustered regularly interspaced short palindromic repeats (CRISPR) from an animal farm.

Hung-Yueh Yeh1, Amal Awad1,2, Michael J Rothrock3.   

Abstract

BACKGROUND: Campylobacter jejuni is the leading bacterial pathogen that causes foodborne illness worldwide. Because of genetic diversity and sophisticated growth requirements of C. jejuni, several genotyping methods have been investigated to classify this bacterium during the outbreaks. One of such method is to use clustered regularly interspaced short palindromic repeats (CRISPR).
OBJECTIVES: The goal of this study was to explore the diversity of C. jejuni isolates with CRISPR from an animal farm.
METHODS: Seventy-seven C. jejuni isolates from an animal farm were used in this study. The day-old broilers were reared with other poultry and farm animals, including layer hens, guinea hens, dairy goats and sheep. A small swine herd was also present on an adjacent, but separate plot of land. Isolation and identification of C. jejuni were performed according to the standard procedures. The CRISPR type 1 was PCR amplified from genomic DNA, and the amplicons were sequenced by the Sanger dideoxy method. The direct repeats (DRs) and spacers of the CRISPR sequences were identified using the CRISPRFinder.
RESULTS: The CRISPR sequences were detected in all 77 isolates. One type of DRs was identified in these 77 isolates. The lengths of the CRISPR locus ranged from 100 to 560 nucleotides, whereas the number of spacers ranged from one to eight. The distributions of the numbers of CRISPR spacers from different sources seemed to be random. Overall, 17 out of 77 (22%) C. jejuni isolates had two and five spacers, whereas 14 out of 77 (18%) isolates had three spaces in their genomes. By further analysis of spacer sequences, a total of 266 spacer sequences were identified in 77 C. jejuni isolates. By comparison with known published spacer sequences, we observed that 49 sequences were unique in this study. The CRISPR sequence combination of Nos. 16, 19, 48 and 57 was found among a total of 15 C. jejuni isolates containing various multi-locus sequence typing (MLST) types (ST-50, ST-607, ST-2231 and ST-5602). No. 57 spacer sequence was unique from this study, whereas the other three (Nos. 16, 19 and 48) sequences were found in previous reports. Combination of Nos. 5, 9, 15, 30 and 45 was associated with ST-353. To compare the CRISPR genotyping with other methods, the MLST was selected due to its high discriminatory power to differentiate isolates. Based on calculation of the Simpson's index of diversity, a combination of both methods had higher Simpson's index value than those for CRISPR or MLST, respectively.
CONCLUSIONS: Our results suggest that the MLST from C. jejuni isolates can be discriminated based on the CRISPR unique spacer sequences and the numbers of spacers. In the future, investigation on the CRISPR resolution for C. jejuni identification in outbreaks is needed. A database that integrates both MLST sequences and CRISPR sequences and is searchable is greatly in demand for tracking outbreaks and evolution of this bacterium.
© 2021 The Authors. Veterinary Medicine and Science published by John Wiley & Sons Ltd.

Entities:  

Keywords:  CRISPR; Campylobacter jejuni; clustered regularly interspaced short palindromic repeats

Mesh:

Year:  2021        PMID: 34510794      PMCID: PMC8604122          DOI: 10.1002/vms3.622

Source DB:  PubMed          Journal:  Vet Med Sci        ISSN: 2053-1095


INTRODUCTION

Clustered regularly interspaced short palindromic repeats (CRISPR) was first described by Ishino et al. (1987) that the highly unusual repetitive sequences of 29 nucleotides (as direct repeats [DRs]) were regularly spaced with 32 nucleotides (as spacers) during their study on the Escherichia coli iap gene. Since then, this similar pattern has been found in genomes of many archaea and prokaryotes (Ishino et al., 2018). The striking characteristics of the CRISPR pattern are as follows: (1) DRs interspaced with various numbers of unique, non‐repetitive sequences (so‐called spacers), (2) a leader sequence at the one side of the locus acting as a promoter and (3) various numbers of the cas family genes (CRISPR‐associated genes) (Grissa et al., 2009; Ishino et al., 2018). The CRISPR–Cas systems in prokaryotes and archaea play important roles in defence of infecting bacteriophages and plasmids (Barrangou and Horvath, 2009; de Cardenas et al., 2015; Louwen et al., 2014). Also, these systems may act as virulence factors during bacterial pathogenesis (Ahmed et al., 2018; Hille et al., 2018). Recently, the CRISPR has been used for genotyping foodborne pathogen Salmonella to track outbreaks and evolution (e.g., Shariat and Dudley, 2014; Cox et al., 2019). Campylobacter jejuni, a Gram‐negative bacterium (Ryan et al., 2004; Ursing et al., 1994), is the leading foodborne pathogen worldwide (Kirk et al., 2015; Tack et al., 2019). It is estimated that this bacterium causes about 1.3 million cases of human campylobacteriosis in the U.S. annually (Crim et al., 2015; Scallan et al., 2011). The reservoirs of C. jejuni are found in guts of many animals where this bacterium is regarded as a member of gut microbiomes (Hermans et al., 2012; European Food Safety Authority, 2010). Therefore, control of this bacterium is extremely difficult (Lin, 2009; Sahin et al., 2015). In addition, because of the genetic diversity and sophisticated growth condition of C. jejuni, detection and identification of this bacterium with classic culture methods are problematic (On et al., 2003). Many genotyping methods for this bacterium have been investigated to solve these problems. One such method is CRISPR (de Cárdenas et al., 2015; Kovanen et al., 2014; Louwen et al., 2013). In this short communication, we applied the CRISPR typing to explore the diversity of C. jejuni isolates from an animal farm in 2016.

MATERIALS AND METHODS

Bacterial cultures and genomic DNA isolation

Seventy‐seven C. jejuni isolates from 2016 and an animal farm were used in this study and are listed in Table S1 (Rothrock et al., 2019). Briefly, the farm was about 3 acres in size. The day‐old broilers were transported to the farm, where other poultry and farm animals were also reared, including layer hens, guinea hens, dairy goats and sheep. A small swine herd was also present on an adjacent, but separate plot of land (Rothrock et al., 2019). Fresh fecal samples were collected from the pen area. At the same time, any fecal samples from other animal species surrounding the broiler area on the farm were also collected. Cecal samples were collected after exsanguination. Rinsates were generated by rinsing the carcasses with 100 ml of 10 mM phosphate‐buffered saline in sterile individual bags. All samples were placed on ice at the farm and transported to the laboratory. In the laboratory, isolation and identification of C. jejuni were performed according to the standard procedures. Bacterial cultures stored in 15% glycerol at –80°C were revived in Müeller–Hinton agar plates at 42°C for 48 h under microaerobic conditions as described previously (Hiett et al., 2008; Yeh et al., 2013). Genomic DNA was isolated using a DNeasy Blood and Tissue kit (Qiagen Inc., Germantown, MD, USA) according to the manufacturer's instructions. The quality and quantity of genomic DNA were determined by agarose gel electrophoresis and a spectrophotometer (DS‐11 FX spectrophotometer; DeNovix Inc., Wilmington, DE, USA), respectively. The DNA in 10 mM Tris–HCl (pH 8.0) was stored at –80°C.

PCR amplification of C. jejuni CRISPR and sequencing

The PCR primers and conditions for amplification of the C. jejuni CRISPRs were described previously (Price et al. 2007). The amplicons were purified with a DNA Clean & Concentrator‐5™ kit (Zymo Research, Irvine, CA, USA). The purity of the PCR products was examined with agarose gel electrophoresis. The purified amplicons were sent for DNA sequencing at the USDA ARS Genomics and Bioinformatics Research Unit (Stoneville, MS, USA), where Big Dye terminator chemistry on an ABI 3100 Genetic Analyzer (Thermo Scientific, Foster City, CA, USA) was used. Sequence chromatograms were edited for quality. The same primer pairs for amplification and sequencing were as follows (Price et al. 2007): CRISPR‐F 5′‐GCAACCTCCTTTTAGTGGAGTAATTAG‐3′ and CRISPR‐R 5′‐AAGCGGTTTTAGGGGATTGTAAC‐3′.

Analysis of CRISPR sequences

CRISPR sequences were submitted to the CRISPR Web Server and were identified using the CRISPRFinder program (Grissa et al., 2007; https://crispr.i2bc.paris‐saclay.fr/). Simpson's index of diversity was calculated based on the Hunter and Gaston equation to determine the discriminatory power of genotyping methods (Carriço et al. 2006). The sequences were deposited in GenBank, and the accession numbers are MT199732–MT199808 (Table S1).

RESULTS AND DISCUSSION

Seventy‐seven PCR amplified products with various sizes were obtained and subjected for sequencing by Big Dye terminator chemistry on an ABI 3100 Genetic Analyzer. The sequences were then submitted to the CRISPRs web server (Grissa et al., 2007) to locate DRs and spacer sequences from the isolates. Grissa et al. (2007) defined the sequences consisting of at least three motifs and at least two exactly identical DRs are regarded as ‘confirmed’ CRISPR, whereas the remaining is considered as ‘questionable’ CRISPR. Our results show that all 77 isolates had either confirmed or questionable CRISPRs with various lengths (Table S1). The DRs varied in lengths, but had a consensus sequence: 5′‐ATTTTACCATAAAGAAATTTAAAAAGGGACTAAAA‐3′. It seems to be common that one end at the DR was not totally conserved (de Cárdenas et al., 2015). A total of 266 spacer sequences were detected in 77 isolates. The numbers of spacers of each isolate range from one spacer to eight spacers (Table S1). By analysing these spacer sequences with the MUSCLE alignment program (Edgar, 2004), we observed 67 different spacer sequences in 77 C. jejuni isolates (Table 1). Further comparing the current space sequences with those from previous reports from poultry sources, such as cecal content and neck skin of broilers, laying hens from organic farms and sewage water (de Cárdenas et al., 2015; Kovanen et al., 2014; Louwen et al., 2013), shows that 18 out of 67 space sequences were identified previously, whereas 49 sequences were unique to isolates from this study. Among 67 space sequences, four sequences (Nos. 16, 19, 48 and 57) were found in the same 15 isolates (Table 1). The sequence Nos. 16, 19 and 48 (Table 1) were identified in the previous report (de Cárdenas et al., 2015), but No. 57 sequence was first identified in this study. The distributions of the numbers of CRISPR spacers from different sources seemed to be random. Overall, 17 out of 77 (22%) C. jejuni isolates had two and five spacers, whereas 14 out of 77 (18%) isolates had three spaces in their genomes (Figure 1). Because the spacer sequences are often the indicators of the phage invasion, high polymorphic nature of the CRISPR sequences in the C. jejuni genomes is expected.
TABLE 1

Spacer alleles of Campylobacter jejuni isolates in this study

No.Spacer sequence (5′‐ > 3′)IsolatesReference
1TACATTTACTTAAGTCTTTAAACTCAGGGTK2‐34This study
2TATAGAATGGAGCATTTAGAAGAAGATATI10‐31A, I10‐33AThis study
3(CT)GAGTTACCAAGATTAAAACTTCCTATGAB5‐13, J1‐13A, J1‐16, J2‐1A, J2‐13C, J2‐5A, JE2‐2A, JE2‐4Ade Cárdenas et al. (2015)
4CAATAATGGAGAACATTTTGATAGAGGCAGGATE5‐36This study
5ATAATGGCTAAATATTTCATGAGAATGGAE5‐22A, E5‐23A, E5‐35, E5‐38, E5‐42A, E5‐44A, J2‐36de Cárdenas et al. (2015)
6CAATAATGGCTAAATATTTCATGAGAATGGAK1‐4A, K2‐15, K2‐22, K2‐23This study
7ACTAAAGCACCATTGTATTTTACAATTAAAI10‐31A, I10‐33AThis study
8TAGTAGCTAAGAATAAAATAAGAAACACTGGJ2‐45AThis study
9TTAGAGTATAGAGTAAATAAGAAAGAAACE5‐22A, E5‐23A, E5‐35, E5‐38, E5‐42A, E5‐44A, J2‐36This study
10CACCAGGAGTTTGAGGAAATAAGAAAGAGTCE5‐36This study
11TCTATATCAGAATATGTCGAAAATGAATTAB5‐12, B5‐17, B5‐19, B5‐22A, B5‐34, B5‐39, J2‐40This study
12TCTTAATCTCTTCACATTTTCTTTTGAGTATI10‐1AThis study
13TAAAAAGTATTATAAGTTCAGCGTTTAATTL2‐12This study
14CAGCTACTAATGAAAATGAAACAATTTTAGAL1‐4A, L1‐5, L1‐7This study
15ATTTTATTCTTAGCCACTATTTCAATCTTE5‐22A, E5‐23A, E5‐35, E5‐38, E5‐42A, E5‐44A, J2‐36de Cárdenas et al. (2015)
16CCAGTGTTTCTTATTTTATTCTTAGCTACTAEP2‐3A, J1‐12, J1‐22A, J1‐25A, J1‐32, J2‐22A, J2‐24A, J2‐32, J2‐35, J2‐44A, JE1‐2A, JE1‐9, K1‐21H, K2‐39, KE1‐2Ade Cárdenas et al. (2015)
17ATTAATCCATATAAATTCCCTACCATCAAE5‐22A, E5‐23A, E5‐35, E5‐38, E5‐42A, E5‐44A, J2‐36This study
18CTATAAATCACCACATGTAGAGAGTGAATCAE5‐36This study
19CTGAAAGGTTATAAATGAAATTAGAAATTATEP2‐3A, J1‐12, J1‐22A, J1‐25A, J1‐32, J2‐22A, J2‐24A, J2‐32, J2‐35, J2‐44A, JE1‐2A, JE1‐9, K1‐21H, K2‐39, KE1‐2Ade Cárdenas et al. (2015)
20TACTGAAGTAAAATAAGTAGTAGAAATTACI10‐31A, I10‐33AThis study
21ACTTATTGCAACTGAAGTAAAAGGAATCGGI10‐31A, I10‐33AThis study
22CTGAAATAACTTCTAAATTCTAATACAATATK1‐4A, K2‐15, K2‐22, K2‐23This study
23CCTATTTGATAATCTTTGAAAATTCTAAI10‐33AThis study
24CGTCAACCTCTAAGCTTTGCGCCATATTGGI10‐15AThis study
25CAAATCAACTTCTAAGCTATCATCAAATTTI10‐31A, I10‐33AThis study
26CTTCTTTTGTCTCATAACCCACTCAACAAAAE5‐32, K2‐3A, K2‐19C, K2‐19E, K2‐33, K2‐37de Cárdenas et al. (2015)
27CTTACTACACAGCCAGTCGTGTATAACGCAK1‐4A, K2‐15, K2‐22, K2‐23This study
28AACCCTAGTGGATTGAAACTCCGCTAGGGCTAATTACTCCACTAAAGGAAGGTTTGCACAAACTAATGTGAAATTGAACTCCGCAAGGGATE5‐44AThis study
29ACCCTAGTGGATTGAAACTCCGCTAGGGCTAATTACTCCACTAAAGGAGGTTGCAAAATACCCTAACACCTCTTAAATCATCGAGCTGCTAK2‐37This study
30ATAAGAGACCACATTTATAGCGTTAAACAE5‐22A, E5‐23A, E5‐35, E5‐38, E5‐42A, E5‐44A, J2‐36This study
31ATAATTTCTAATTTCATTTATAACCTTTCAGJ2‐45AThis study
32(CA)TGAGAACTTAAATAAGTTTATCAAAGATAB5‐13, J1‐13A, J1‐16, J2‐1A, J2‐13C, J2‐5A, JE2‐2A, JE2‐4Ade Cárdenas et al. (2015)
33CATTTGCGTTTGCATTATTAATAACGCTACTK2‐2, K2‐3, KB1‐4A, KB1‐5A, KB1‐7A, KB1‐10A, KE1‐5A, KE2‐5A, KE2‐6A, KE2‐6Dde Cárdenas et al. (2015)
34GAAACCCAGATTAAATGATCGTTTGAGAI10‐15AThis study
35CTTTACAATATTGTAAAAACATAAAAGTGGL2‐12de Cárdenas et al. (2015)
36CTACTTGATTATCATTATACTCTAAAGGTTCB5‐24A, B5‐31de Cárdenas et al. (2015)
37CTTCTGATGTTATAATTACATTAGATAAATCJE1‐1This study
38(CT)AATGCTTTGATTATAAAAATTACATAAAB5‐13, J1‐13A, J1‐16, J2‐1A, J2‐13C, J2‐5A, JE2‐2A, JE2‐4Ade Cárdenas et al. (2015)
39CTTATACTTTGATTATAAAAATTACATAAAGK2‐2, K2‐3, KB1‐4A, KB1‐5A, KB1‐7A, KB1‐10A, KE1‐5A, KE2‐5A, KE2‐6A, KE2‐6DThis study
40CTTATTTATGCGGTGCAAGTCAAGTTGAAACE5‐32, K2‐3A, K2‐19C, K2‐19E, K2‐33This study
41ATTTATGCGGTGCAAGTCAAGTTGAAACK2‐37This study
42TGGTTATTTATTTGGGGCTGATATTGGTTCI10‐31AThis study
43TGGTTATTTATTTGGTGCTGATATTGGTTCI10‐33AThis study
44TCTAAAGCGCTTGCTATTGAAGTTTTATTGI10‐12A, I10‐23A, I10‐24A, IP2‐1A, IP2‐2AThis study
45CTCGTGCTATTGTTTTAGCTCGACGATTTE5‐23A, E5‐35, E5‐38, E5‐42A, E5‐44A, J2‐36, E5‐22ALouwen et al. (2010)
46TAATTCATTTTCGACATATTCTGATATAGAK2‐34This study
47GTTGGAATGCTTAAGCAGGGGTGGAGTGAAGJ2‐45AThis study
48CTTCACTCCACCCCTGCTTAAGCATTCCAACEP2‐3A, J1‐12, J1‐22A, J1‐25A, J1‐32, J2‐22A, J2‐24A, J2‐32, J2‐35, J2‐44A, JE1‐2A, JE1‐9, K1‐21H, K2‐39, KE1‐2Ade Cárdenas et al. (2015)
49CCTGCTAAAGAACATACTGTTAAAGCATCTB5‐12, B5‐17, B5‐19, B5‐22A, B5‐34, B5‐39, J2‐40de Cárdenas et al. (2015)
50TTGCTTCGTTCAATCAAAAACAGGTGCAI10‐15AThis study
51CTTCCCAATCGCAAAGCAATAATCCTTTTAACJ2‐22A, JE1‐2A, JE1‐9de Cárdenas et al. (2015)
52CTTCCCAATCGCAAAGCAAAATCCTTTTAACEP2‐3A, J1‐12, J1‐22A, J1‐25A, J1‐32, J2‐24A, J2‐32, J2‐35, J2‐44A, K1‐21H, K2‐39, KE1‐2ALouwen et al. (2010)
53CTAGCGAAAACAATTTAAATAAAGCAAAATTJE1‐1This study
54GTTAAAAGGATTTTGCTTTGCGATTGGGAAGJ2‐45AThis study
55TGTATAAGCTTGTGCTGTAGTAATTTCAATEP2‐5ALouwen et al. (2010)
56CCAGTGTATTAAAATTGCACGACTTGCTGGEP2‐5AThis study
57CTCTTAATTTCAACAATACTCACTTATTAAATJE1‐9, EP2‐3A, J1‐22A, J1‐25A, J1‐32, J2‐22A, J2‐24A, J2‐32, J2‐35, J2‐44A, JE1‐2A, K1‐21H, K2‐39, KE1‐2A, J1‐12This study
58TATAATACCATTCTTAATTTAAAAGGAGTGB5‐12, B5‐17, B5‐19, B5‐22A, B5‐34, B5‐39, J2‐40de Cárdenas et al. (2015)
59TTATAATACCATTAGCCATTAAAACGGAGTGE5‐36This study
60AGATGCTTTAACAGTATGTTCTTTAGCAGGK2‐34This study
61TTTCCATTTGCATCCACCTCCAATTTTTCTAI10‐31A, I10‐33AThis study
62AAGCTTGTACTTAAATGACATTCATAAAI10‐15AThis study
63AAGCTTGCCCTTAAATGACAATCATAAAI10‐15AThis study
64GTCATTTTTAATCCTTAAGTAAGTAATAATEP2‐5AThis study
65CACTCCTTTTAAATTAAGAATGGTATTATAK2‐34This study
66ACCCTGAGTTTAAAGACTTAAGTAAATGTAB5‐12, B5‐17, B5‐19, B5‐22A, B5‐34, B5‐39, J2‐40This study
67ATTTAATAAGTGGTATTGTTGAAATTAAGAGJ2‐45AThis study
FIGURE 1

Distribution of the numbers of CRISPR spacers in Campylobacter jejuni isolates from a pastured farm in 2016. The x‐axis indicates the numbers of CRISPR spacers. The y‐axis represents the numbers of Campylobacter jejuni isolates

Spacer alleles of Campylobacter jejuni isolates in this study Distribution of the numbers of CRISPR spacers in Campylobacter jejuni isolates from a pastured farm in 2016. The x‐axis indicates the numbers of CRISPR spacers. The y‐axis represents the numbers of Campylobacter jejuni isolates The high‐resolution melting analysis (HRMA) and DNA sequencing have been used in CRISPR studies (Gomes et al., 2016; Price et al., 2007). Because the spacer sequences are often parts of the sequences from plasmids or phages, the DNA sequencing provides more accurate information for building the database for comparison from different laboratories. Gomes et al. (2016) compared the genotyping methods and found the discriminative indices were 0.916 and 0.550, respectively, for the DNA sequencing and HRMA. The multi‐locus sequence typing (MLST) (Dingle et al., 2001) has been the most used for genotyping foodborne bacterial pathogens. In our unpublished observations, we found 13 MLST sequence types (ST) in 66 isolates (Table S1). Among them, ST‐607 and ST‐353 were detected in 17 and 16 isolates, respectively, in this study. Further analysis shows ST‐607 had five CRISPR spacer sequence patterns: six isolates contained Nos. 11, 49, 58 and 66 spacer sequences, seven isolates contained Nos. 3, 32 and 38 sequences, two isolates contained No. 44 sequence, one isolate contained Nos. 37 and 53 sequences and one isolate contained Nos. 16, 19, 48, 52 and 57 sequences (Table S1). It is also observed that ST‐353 had four CRISPR space sequence patterns: six isolates had Nos. 5, 9, 15, 17, 30 and 45 spacer sequences, eight isolates had Nos. 33 and 39 sequences, one isolate had Nos. 4, 10, 18 and 59 sequences and one isolate had Nos. 26 and 40 sequences. Further, the CRISPR types of our current isolates were assigned based on the spacer numbers and sequences, and Simpson's index of diversity was calculated to measure the discriminatory power of these methods. As shown in Table 2, a combination of both methods had the Simpson's index value of 0.953 that is higher than those of 0.922 or 0.849 for CRISPR or MLST, respectively. These results suggest that the MLST can further be discriminated based on CRISPR spacer sequences and the numbers of spacers. Further investigation on the CRISPR molecular variations in and the numbers of spacers to increase the resolution is needed.
TABLE 2

Simpson's index diversity of genotyping methods

MethodNumber of genotypesSimpson's index of diversity a 95% Confidence intervala
MLST130.8490.809 ‐ 0.889
CRISPR210.9220.899 ‐ 0.945
CRISPR + MLST320.9530.934 ‐ 0.971

Both were calculated using the online tool based on the Hunter and Gaston equation.

Simpson's index diversity of genotyping methods Both were calculated using the online tool based on the Hunter and Gaston equation. In summary, C. jejuni isolates from 2016 and an animal farm were subjected to CRISPR type 1 analysis. The CRISPR sequences were identified in all 77 isolates. One type of DR was detected in the CRISPR sequences. The lengths of the CRISPR sequences ranged from 100 to 560 nucleotides. The number of spacers ranged from one to eight. By further analysis of spacer sequences, a total of 266 sequences were identified from 77 C. jejuni isolates. Among them, 67 distinctive sequences were identified. Furthermore, by comparison with known spacer sequences, we observed that 18 from 67 sequences were known previously and 49 sequences were unique in this study. Further analysis shows that the MLST from C. jejuni isolates can be discriminated based on CRISPR spacer sequences and the numbers of spacers. In the future, investigation on the CRISPR resolution for C. jejuni identification in outbreaks is needed. A database that integrates both MLST sequences and CRISPR sequences and is searchable is greatly in demand. During the revision of this manuscript, a study demonstrates the CRISPR–Cas system is prevalent in the fluoroquinolone‐resistant C. jejuni isolates (Adiguzel et al., 2021).

AUTHOR CONTRIBUTIONS

Hung‐Yueh Yeh: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Supervision, Writing‐original draft, Writing‐review & editing. Amal Awad: Formal analysis, Investigation, Methodology. Michael Rothrock: Resources

CONFLICT OF INTEREST

The authors declare no conflict of interest.

PEER REVIEW

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.622 Supporting Information Click here for additional data file.
  30 in total

Review 1.  Novel approaches for Campylobacter control in poultry.

Authors:  Jun Lin
Journal:  Foodborne Pathog Dis       Date:  2009-09       Impact factor: 3.171

2.  A combination of MLST and CRISPR typing reveals dominant Campylobacter jejuni types in organically farmed laying hens.

Authors:  S M Kovanen; R I Kivistö; M Rossi; M-L Hänninen
Journal:  J Appl Microbiol       Date:  2014-04-08       Impact factor: 3.772

3.  Illustration of a common framework for relating multiple typing methods by application to macrolide-resistant Streptococcus pyogenes.

Authors:  J A Carriço; C Silva-Costa; J Melo-Cristino; F R Pinto; H de Lencastre; J S Almeida; M Ramirez
Journal:  J Clin Microbiol       Date:  2006-07       Impact factor: 5.948

Review 4.  History of CRISPR-Cas from Encounter with a Mysterious Repeated Sequence to Genome Editing Technology.

Authors:  Yoshizumi Ishino; Mart Krupovic; Patrick Forterre
Journal:  J Bacteriol       Date:  2018-03-12       Impact factor: 3.490

5.  Construction, expression, purification and antigenicity of recombinant Campylobacter jejuni flagellar proteins.

Authors:  Hung-Yueh Yeh; Kelli L Hiett; John E Line; Brian B Oakley; Bruce S Seal
Journal:  Microbiol Res       Date:  2013-01-09       Impact factor: 5.415

6.  Evaluation of 11 PCR assays for species-level identification of Campylobacter jejuni and Campylobacter coli.

Authors:  Stephen L W On; Penelope J Jordan
Journal:  J Clin Microbiol       Date:  2003-01       Impact factor: 5.948

7.  Genotyping of Campylobacter coli strains isolated in Brazil suggests possible contamination amongst environmental, human, animal and food sources.

Authors:  Carolina N Gomes; Roberto A Souza; Jaqueline Passaglia; Sheila S Duque; Marta I C Medeiros; Juliana P Falcão
Journal:  J Med Microbiol       Date:  2016-01       Impact factor: 2.472

8.  Preliminary Incidence and Trends of Infections with Pathogens Transmitted Commonly Through Food - Foodborne Diseases Active Surveillance Network, 10 U.S. Sites, 2015-2018.

Authors:  Danielle M Tack; Ellyn P Marder; Patricia M Griffin; Paul R Cieslak; John Dunn; Sharon Hurd; Elaine Scallan; Sarah Lathrop; Alison Muse; Patricia Ryan; Kirk Smith; Melissa Tobin-D'Angelo; Duc J Vugia; Kristin G Holt; Beverly J Wolpert; Robert Tauxe; Aimee L Geissler
Journal:  MMWR Morb Mortal Wkly Rep       Date:  2019-04-26       Impact factor: 17.586

9.  CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats.

Authors:  Ibtissem Grissa; Gilles Vergnaud; Christine Pourcel
Journal:  Nucleic Acids Res       Date:  2007-05-30       Impact factor: 16.971

10.  Distribution of CRISPR Types in Fluoroquinolone-Resistant Campylobacter jejuni Isolates.

Authors:  Mehmet Cemal Adiguzel; Debora Brito Goulart; Zuowei Wu; Jinji Pang; Seyda Cengiz; Qijing Zhang; Orhan Sahin
Journal:  Pathogens       Date:  2021-03-16
View more
  1 in total

1.  Detection of Campylobacter jejuni diversity by clustered regularly interspaced short palindromic repeats (CRISPR) from an animal farm.

Authors:  Hung-Yueh Yeh; Amal Awad; Michael J Rothrock
Journal:  Vet Med Sci       Date:  2021-09-12
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.