PIWI silencing mechanism involving the retrotransposon nimbus orchestrates resistance to infection with Schistosoma mansoni in the snail vector, Biomphalaria glabrata.

BACKGROUND: Schistosomiasis remains widespread in many regions despite efforts at its elimination. By examining changes in the transcriptome at the host-pathogen interface in the snail Biomphalaria glabrata and the blood fluke Schistosoma mansoni, we previously demonstrated that an early stress response in juvenile snails, manifested by induction of heat shock protein 70 (Hsp 70) and Hsp 90 and of the reverse transcriptase (RT) domain of the B. glabrata non-LTR- retrotransposon, nimbus, were critical for B. glabrata susceptibility to S. mansoni. Subsequently, juvenile B. glabrata BS-90 snails, resistant to S. mansoni at 25°C become susceptible by the F2 generation when maintained at 32°C, indicating an epigenetic response. METHODOLOGY/PRINCIPAL
FINDINGS: To better understand this plasticity in susceptibility of the BS-90 snail, mRNA sequences were examined from S. mansoni exposed juvenile BS-90 snails cultured either at 25°C (non-permissive temperature) or 32°C (permissive). Comparative analysis of transcriptomes from snails cultured at the non-permissive and permissive temperatures revealed that whereas stress related transcripts dominated the transcriptome of susceptible BS-90 juvenile snails at 32°C, transcripts encoding proteins with a role in epigenetics, such as PIWI (BgPiwi), chromobox protein homolog 1 (BgCBx1), histone acetyltransferase (BgHAT), histone deacetylase (BgHDAC) and metallotransferase (BgMT) were highly expressed in those cultured at 25°C. To identify robust candidate transcripts that will underscore the anti-schistosome phenotype in B. glabrata, further validation of the differential expression of the above transcripts was performed by using the resistant BS-90 (25°C) and the BBO2 susceptible snail stock whose genome has now been sequenced and represents an invaluable resource for molecular studies in B. glabrata. A role for BgPiwi in B. glabrata susceptibility to S. mansoni, was further examined by using siRNA corresponding to the BgPiwi encoding transcript to suppress expression of BgPiwi, rendering the resistant BS-90 juvenile snail susceptible to infection at 25°C. Given transposon silencing activity of PIWI as a facet of its role as guardian of the integrity of the genome, we examined the expression of the nimbus RT encoding transcript at 120 min after infection of resistant BS90 piwi-siRNA treated snails. We observed that nimbus RT was upregulated, indicating that modulation of the transcription of the nimbus RT was associated with susceptibility to S. mansoni in BgPiwi-siRNA treated BS-90 snails. Furthermore, treatment of susceptible BBO2 snails with the RT inhibitor lamivudine, before exposure to S. mansoni, blocked S. mansoni infection concurrent with downregulation of the nimbus RT transcript and upregulation of the BgPiwi encoding transcript in the lamivudine-treated, schistosome-exposed susceptible snails. CONCLUSIONS AND SIGNIFICANCE: These findings support a role for the interplay of BgPiwi and nimbus in the epigenetic modulation of plasticity of resistance/susceptibility in the snail-schistosome relationship.

Introduction

The freshwater snail, Biomphalaria glabrata, is an obligate intermediate host of the trematode, Schistosoma mansoni, the causative agent of the neglected tropical disease (NTD) schistosomiasis in neotropical regions. At least 600 million people, mainly in sub-Saharan Africa, are at risk for schistosomiasis, a number that remains excessively high, despite efforts to control transmission of the disease [1]. This disease causes widespread chronic morbidity and male and female infertility. Specifically, infections caused by the species, Schistosoma haematobium may result in bladder cancer and female genital schistosomiasis. The latter exacerbates transmission of sexually transmitted diseases including HIV (AIDS) [2].

The disease burden from schistosomiasis is probably underestimated, and it has been suggested that the number of infected individuals exceeds 400 million [3]. On the other hand, there are other estimations that claim 230 million people worldwide are infected with S. mansoni [1]. These numbers are often underestimated due to the inability of current diagnostic methods to detect light infections [4]. There are few defenses against schistosomiasis, mainly because the residents of infected areas lack sufficient infrastructure to properly combat this disease [3]. An integrated control approach, implementing mass chemotherapy and molluscicides has made a difference in breaking the complex life cycle of the parasite but without new effective drugs and vaccines to prevent re-infection in treated areas, the cycle of repeated infection is the norm, thereby making the longterm control of schistosomiasis elusive [5,6]. Because of recent projections made by the World Health Organization to eliminate schistosomiasis by 2025 and coupled with recent concerns of the spread of the disease into Mediterranean countries of Europe, alternative approaches focusing mainly on blocking the development of the parasite in the snail host are aggressively sought [7-9].

Molecular mechanism(s) involved in shaping the relationship between the parasite and its obligate intermediate snail host, Biomphalaria glabrata, remains largely unknown. However, information that will assist in clarifying some of the mechanisms of host/parasite interactions is steadily being amassed. Reference genome sequences for all three organisms (human, schistosome and snail) pertinent to transmission of schistosomiasis are now available [10-12]. Additionally, genes that underlie resistance and susceptibility phenotypes in B. glabrata to S. mansoni infection are being identified [13-15], as are transcripts encoding larval (miracidia) parasite proteins that are expressed at the snail/parasite interphase [16,17]. Both snail and parasite determinants are involved in a complex and dynamic innate defence system that either rejects or sustains the successful development of the intra-molluscan stages of the parasite [13,15].

Previously, we demonstrated that juvenile B. glabrata, that are either resistant or susceptible to S. mansoni, display a differential stress response after early exposure to wild type but not to irradiated S. mansoni miracidia. The stress response observed in the susceptible juvenile snail was manifested by the early induction of transcripts encoding heat shock proteins (Hsp) 70, Hsp90 and the reverse transcriptase (RT) domain of the B. glabrata non-LTR-retrotransposon, nimbus [18]. Furthermore, the non-random relocalization of the Hsp70 gene loci in interphase nuclei preceded transcription of the corresponding Hsp70 transcript in the susceptible but not in the resistant snail, indicating that in-coming schistosomes possess the ability to orchestrate in a rapid and systemic fashion, the genome remodeling of juvenile susceptible snails soon after infection [19]. We also demonstrated that resistance in the juvenile BS-90 snail stock was a temperature dependent trait. Thus, when cultured at room temperature (25°C), juvenile BS-90 snails remained consistently resistant to infection. However, when cultured at 32°C for several generations (FI to F3), the progeny juvenile snails were phenotypically susceptible [20], indicating a plastic epigenetic control over resistance.

Other studies that have used adult (>7 mm in diameter) snails instead of juveniles have suggested that ability to alter the resistance of the BS-90 to infection at elevated temperature might be a strain-specific trait [21]. In recent studies, resistant BS-90 snails were found to be susceptible when exposed to S. mansoni as neonates [22]. In general, adult snails are less susceptible to infection [23]. Furthermore, in some stocks of B. glabrata, for example the 93375 strain, the juveniles are susceptible but become resistant to the same strain of S. mansoni as young adults (at the onset of fecundity), and once egg laying ceases and amoebocyte accumulations disappear in the pericardial wall, revert to the susceptible phenotype [23,24].

To further investigate the molecular basis of susceptibility plasticity, notably in the BS-90 snail, we have undertaken a comparative analysis of the transcriptomes of juvenile BS-90 snails cultured for several generations at either permissive (32°C) or non-permissive (25°C) temperatures, aiming to obtain candidates for pathway(s) that lead either to resistance or susceptibility. This investigation and the findings are detailed below.

Materials & methods

Snails

The BS-90 snail isolated from Salvador, Brazil, is a wild-type pigmented snail that is resistant to both Old and New World strains of S. mansoni (NMRI strain) either as a juvenile or as an adult snail at 25°C [25,26]. The NMRI snail is an albino susceptible snail that was derived from a cross between the wildtype Puerto Rican snail and a highly susceptible Brazilian albino snail [27]. The BB02 snail is a susceptible pigmented wildtype snail from Brazil whose genomic DNA sequence was recently reported [10]. The susceptible snails (NMRI and BBO2) are highly susceptible as juveniles but the degree of susceptibility, especially in the NMRI stock, is variable as an adult snail [28].

Snail husbandry and S. mansoni infections

BS-90 stocks were cultured at 32°C as described [20]. Exposures of BS-90 snails cultured at 32°C to miracidia were performed using juvenile progeny, F1- F2, <4 mm in diameter that were bred at the elevated temperature. Briefly, BS-90 snails were cultured either at 25°C or 32°C in freshly made artificial pond water (www.afbr-bri.com) and fed ad libitum with either romaine lettuce or snail gel food [29]. Juvenile snails or egg clutches were transferred from 25°C to 32°C and maintained in groups of 3 or 4 in fresh water (100 ml) in beakers maintained in a water bath at 32°C. The temperature inside the water bath was monitored daily to maintain 32°C for the duration of the experiment. The snails were cleaned weekly making sure that pre-warmed (32°C) water was used to clean the snails. Detritus including dead snails and decayed lettuce leaves were removed daily. The egg clutches from these snails (produced at 32°C) were collected and their progeny were maintained at 32°C until they had grown to 3 to 4 mm in diameter (juvenile snails) before exposure to miracidia at 25°C. The juvenile BS-90 snails, 3 to 4 mm in diameter, were maintained for two generations at either 32°C or 25°C and RNA prepared from 0 and two-hour infected F2 progeny as described [20]. Snails were exposed individually to the 10 to 12 miracidia in wells of a 12-well tissue culture plate (Greiner Bio-One, North Carolina, USA) at room temperature. Miracidia were hatched from eggs recovered from the livers of mice which had been infected with S. mansoni (NMRI strain) for seven weeks [30].

Exposed snails (not used for RNA) were maintained at 25°C and examined for cercarial shedding from four to 10 weeks later. Susceptible BBO2 and NMRI B. glabrata snails utilized in this study were exposed as juveniles (described above) to freshly hatched miracidia. To determine patency (cercarial shedding), individual snails were immersed in one ml nuclease-free water in 12-well plates and directly exposed to a light source for 30 to 60 minutes at room temperature, after which snails were removed from the wells. Cercariae released from individual snails were counted after adding a few drops of Lugol’s iodine solution to each well. After shedding, snails that were patent were euthanized by immersion in 95% ethanol; non-shedding snails were incubated for up to 10 weeks at 25°C and checked weekly for patency.

RNA sequencing, assembly, and annotation

Total RNA was isolated by RNAzol (Molecular Research Center, Inc. Cincinnati, OH) from resistant (25°C) and susceptible (32°C) BS-90 snails. BS-90 snail transcriptomes were generated from polyA+ RNA isolated from pooled intact 2 hr exposed juvenile snails maintained either at the non-permissive temperature (25°C), or at the permissive temperature (32°C), on an Illumina HiSeq 100. Following RNAseq Illumina sequencing, de novo assembly of the transcriptome was performed using Trinity. Functional annotation of the contigs was performed with Trinotate that included Gene Ontology assignments when possible, Pfam domain identification, transmembrane region predictions (TmHMM), and signal peptide predictions (signalP). Differential expression (DE) analyses were performed by using DESeq and identified differentially expressed contigs between BS-90 snails from 32°C and 25°C. The analyses of these contigs revealed the presence of known specific genes coding for several stress related and other transcripts (Table 1).

Table 1

Differential expression of downregulated (green) and upregulated (red) transcripts from RNA-seq data of B. glabrata BS-90 snail stocks cultured either at permissive (32°C) or non-permissive (25°C) temperature.

Assembled transcript ID	Fold change	Gene product/identity
Up-regulated
comp687935_c0	77	Heatshock70kDaproteinPPF203
comp680371_c0	77	HeatshockproteinhomologECU03_0520
comp833304_c0	72.8	ChaperoneproteinDnaK
comp729179_c0	51.7	Heatshock70kDaprotein4
comp53294_c0	40.9	Heatshock70kDaprotein
comp116707_c0	40.2	Heatshockprotein83
comp174809_c1	21.6	Alpha‐crystallinBchain
comp22367_c0	12.6	Heatshockprotein90homolog
comp567369_c0	8	Ferric‐chelatereductase1
comp173740_c0	6.4	Heatshock70kDaprotein
comp396056_c0	6.1	Apoptosis2inhibitor
comp175527_c0	5.3	Heatshockprotein70B2
comp248752_c0	5.1	Heatshockprotein68
comp122866_c0	5.0	Heatshockproteinbeta‐1
comp144872_c0	5.0	Alpha‐crystallinBchain
comp181825_c1	4.8	Histone‐lysineN‐methyltransferase,H3lysine‐79specific
comp319764_c0	3	UniversalstressproteinRv2026c/MT2085
Down-regulated
comp129067_c0	-2.6	HeatshockproteinHsp‐16.2
comp185349_c3	-2.8	ProteinarginineN‐methyltransferase1
comp173107_c0	-2.8	Monocarboxylatetransporter9
comp43678_c0	-2.9	HistoneRNAhairpin‐bindingprotein
comp142687_c0	-3.1	Mitogen‐activatedproteinkinasekinasekinase3
comp100349_c0	-3.0	Histonedeacetylase1
comp86764_c0	-3.1	Piwi‐likeprotein1
comp146653_c0	-3.3	CathepsinB
comp143747_c0	-3.9	ApoptosisregulatorBAX
comp375043_c0	-3.5	Calcium‐regulatedheatstableprotein1
comp126708_c0	-3.6	FAS‐associatedfactor1
comp169361_c0	-4.3	Macrophagemannosereceptor1
comp153455_c0	-4.4	Histonedeacetylase2
comp54296_c0	-4.5	ChaperoneproteinClpB
comp43231_c0	-5.3	Chromoboxproteinhomolog1
comp887090_c0	-6.1	Tudordomain‐containingprotein12
comp182899_c1	-7.0	Peroxiredoxin‐4
comp66580_c0	-7.4	ProteinarginineN‐methyltransferase1
comp920619_c0	-8.1	Interferon‐relateddevelopmentalregulator1
comp178355_c0	-9.6	HistoneacetyltransferaseKAT6B
comp599_c0	-9.6	MAU2chromatidcohesionfactorhomolog

DE analysis was carried out using DEseq on Trinity assembled de novo transcripts and > than 2000 genes were identified. Representative up and down regulated transcripts in resistant (25°C) versus susceptible (32°C) juvenile BS-90 snails were annotated subsequently by using the assembled B. glabrata BBO2 susceptible stocks sequenced genome in Vector Base and NCBI as reference [10]. To select robust candidate transcripts that underscore either S. mansoni resistance or susceptibility phenotypes, wild type susceptible reference BBO2 and resistant snail BS-90 stocks were used to perform real time qPCR to validate differential expression of selected transcripts. A standard BLASTp was performed to further validate the annotation of the 897 amino acid sequence of BgPiwi (Accession No XP_013089248.1) followed by a SMART BLAST to explore the phylogeny of the B. glabrata homolog to other PIWI encoding transcripts in the public domain. The complete RNA-seq data sets showing the transcriptome profiles of changes observed in schistosome juvenile BS90 snails at either permissive (32°C) or non-permissive (25°C) temperatures are provided as FASTQ files in the SRA database within NCBI with Bioproject ID PRJNA687288.

Phylogenetic tree construction

The BgPiwi homologs identified using SMART Basic Local Alignment Search Tool (BLAST) were aligned using CLUSTAL with a BLOSUM matrix without any manual editing of the multiple sequence alignment (MSA). The MSA was passed to a maximum-likelihood search with phyloML using a SPR tree search from a Neighbour-Joining starter and a 100-replicate bootstrap.

Two step qPCR

Differential expression of the selected transcripts identified from the single pass RNA-seq dataset generated from resistant (25°C) and susceptible (32°C) juvenile BS-90 snails were (as mentioned above) further validated in representative resistant BS-90 and susceptible BBO2 snail stocks. Real time qPCR was also performed by the lab maintained susceptible NMRI snail to determine whether transcription patterns, up versus down, were reproducible. Experiments were performed using multiple individual snail samples (> 10) for each of the snail stocks, and independently (3 to 5 biological replicates) by different investigators with triplicate samples for each time point. Total RNA was isolated from juvenile snails that were either unexposed (0 hour) or exposed to S. mansoni for 30 min, 1, 2, 4 and 16 hours at 25°C as described [31]. cDNA was prepared from the total RNA after residual contaminating genomic DNA was removed by treatment of the RNA with RNase-free DNase (RQI Promega WI) before performing the qPCR assays [25]. Quantitative PCR was performed with forward and reverse gene specific primers corresponding to the selected transcripts normalized against the expression of the myoglobin as a reference, as previously described [31]. Oligonucleotide primers (forward and reverse, Table 2) were designed for selected transcripts identified from the annotated sequences of RNA-seq datasets from 2hr S. mansoni exposed BS-90 snails cultured at either permissive (32°C) or non-permissive temperatures (25°C). The amino acid sequences corresponding to the coding DNA sequence (CDS) of the following transcripts: PIWI like protein (BgPiwi), chromobox protein homolog 1 (BgCBx1), methyltransferase (BgMT), Histone Acetyl Transferase (BgHAT) and histone deacetylase (BgHDAC) were utilized to interrogate the reference B. glabrata (BBO2 stock) genome in GenBank by using BLAST in NCBI. Amino acid sequences of B. glabrata CDS showing significant (E value = <10−4 and with >25% amino acid sequence identity) homology to other transcripts were converted to the nucleotide sequences and gene specific primers were designed using primer BLAST in NCBI. Forward (F) and reverse primers (R) for qPCR analysis were obtained from Eurofins Genomics (Louisville, KY) after the exclusion of sequences for S. mansoni to avoid any possible amplification of parasite RNA during qPCR analysis.

Table 2

Selected transcripts, accession numbers, and corresponding F and R primers utilized for qPCR.

	Description	Sequence	Accession Number
1.	BgPiwi	5’:TTGCAAAATGGGCGGTGAAG	XP_013081375
		3’: TGACGAACTGACTGGCTCAC
2.	BgHDAC	5’:CCACATAAGGCCACAGCAGA	XP_013075422.1
		3’: TAGTACTTGCCCTTGCCTGC
3.	BgCBX1h-1	5’: CAACGTGCATTTAAGGCGGA	XP_013064838.1
		3’: CACTGCTGTCTGTAGCACCT
4.	BgHAT	5’: CGGCGGCATTTATCTTGGTG	XP_013062341.1
		3’: TGTCAATGTGGCGTCGAAGA
5.	BgMT	5’: CATAGTCCGGTTGGTGCAGA	XP_013081375
		3’:GCAGTTGGTAGCAGCAAGAGA
6.	nimbusRT	5’:GCTCCATTAAACCGAACAGAC	EF413179
		3’:CCCCGTAGATCATTGCTAAC

Two-step qPCR was utilized to quantitatively assess expression of the selected transcripts using 500 ng of cDNA as template. SYBR Green PCR Master Mix kit (Applied Biosystems, Thermo Fisher Scientific, Woolston Warrington, UK), with 15 μM of forward and reverse primers were used to evaluate the temporal expression of PIWI (BgPiwi), Chromobox protein homolog 1 (BgCBx1), HDAC (BgHDAC), HAT (BgHAT) and methyl transferase (BgMT). Each sample was run in triplicate and reactions normalized against the constitutively expressed myoglobin reference gene in a 7300-thermal cycler (Applied Biosystems). Primers were designed from the CDS of the selected transcripts and optimized for qPCR as described previously [31]. Relative quantitative expression of the genes of interest between resistant and susceptible snails was evaluated by the ΔΔCt method. The resulting fold change in expression of the genes of interest normalized against the signal for myoglobin were calculated by using the formula [32],

The variance of each of the data groups was determined using F-test. Also, Shapiro-Wilk test and Kolmogorov-Smirnov test were used to test for normality and lognormality. Differences between the groups were assessed using Student’s t test, Welch’s t test and 2-way analysis of variance (ANOVA) wherever relevant by comparing the differential expression (delta-Ct value) of the transcripts among treatment and control groups. A p-value of <0.05 was considered to be statistically significant, with level of significance denoted as follows, ****, p ≤ 0.0001, ***, p ≤ 0.001, **, p ≤ 0.01, *, p ≤ 0.05, and ns, p > 0.05.

BgPiwi transcript silencing by dsRNA and siRNA

To investigate the functional role of BgPiwi expression in B. glabrata susceptibility to schistosome infection, the transcription of BgPiwi was silenced by soaking juvenile BS-90 snails in either dsRNA-, or siRNA- complexed with PEI [33]. Double–stranded (ds)RNA corresponding to BgPiwi was synthesized by using an in vitro transcription kit with a purified BgPiwi PCR product containing T7 sequences (sense and antisense) as template according to the manufacturer’s instructions (MEGAscriptT7, ThermoFisher Scientific Inc.) [34]. Off-target silencing of the transcript encoding BgPiwi in the resistant BS-90 snail was evaluated by soaking snails in universal mock siRNA- PEI complexes as control (MISSION siRNA Universal negative control#1). Knock-down of the BgPiwi transcript in the resistant BS-90 snail (cultured at 25°C) was done as follows; juvenile snails were placed in 1.0 ml nuclease-free dH2O containing either 300 ng dsRNA: 1.0 μg PEI nanoparticle complexes or 775 ng siRNA: 1.0 μg PEI nanoparticle complexes. The complexes were prepared as follows: in a 1.5 ml capacity microcentrifuge tube, 1 μg of PEI (Sigma Aldrich), branched with average molecular weight 25000, in 500 μl nuclease-free H2O was added slowly, drop-wise, to two different siRNAs (Sigma Millipore) (start on target sequence CDS position 2393bp- sense: GAACCAUUGUGGAUCAAAU/anti-sense: AUUUGAUCCACAAUGGUUC; (start on target sequence at CDS position 2403bp sense: GGAUCAAAUAAUUACGAA/anti-sense: UUUCGUAAUUAUUUGAUCC) diluted in 500 μl before mixing vigorously for 10 seconds at room temperature. Both duplex siRNAs/PEI nanoparticles corresponding to the BgPiwi transcript were utilized simultaneously in a single tube. Samples of siRNA/PEI complexes (total of 1.0 ml in microcentrifuge tubes) were incubated at room temperature for 20 minutes before placing individual juvenile snails in the mixtures. Holes were punched in lids of the closed microcentrifuge tubes containing snails in siRNA/PEI complexes before incubating overnight at room temperature. Control tubes, incubated in parallel, contained the following samples, a) BgPiwi siRNAs without PEI, b) PEI only without BgPiwi siRNAs and c) Mission Universal mock siRNA/PEI complexes (Sigma Millipore). RNA was isolated as described above from washed transfected snails before utilizing for qPCR as described above. For each assay, quantitative expressions of BgPiwi and nimbus RT transcripts (normalized against myoglobin expression) were evaluated with and without S. mansoni infection by qPCR using forward and reverse primers corresponding to either transcript. Transfected snails (with and without infection) that were not investigated by RNA-based assays were maintained in at 25°C as above and monitored for cercarial shedding at 4, 6, or 10 weeks later. The silencing of BgPiwi with dsRNA/PEI was evaluated in three, and with siRNA/PEI, in five biological replicates, respectively.

Treatment of susceptible BBO2 snails with reverse transcriptase inhibitor, lamivudine

Given that the central role of PIWI involves silencing of endogenous mobile elements, such as nimbus, a non-LTR retrotransposon in the genome of B. glabrata [10,35], we examined the modulation of expression of the transcript encoding the RT domain of nimbus in the following categories of susceptible BBO2 snails—a) normal snails, b) snails treated overnight at room temperature with lamivudine at 100 ng/ml (Sigma Aldrich, St. Louis, MO) and c) BS-90 resistant snails treated with siRNA corresponding to BgPiwi/PEI complexes, as described above. Snails in these categories (a to c) were either unexposed (0) or exposed (individually) to 10 miracidia for 120 min at 25°C. Before exposure, individual snails incubated in either lamivudine or BgPiwi siRNA/PEI complexes were washed twice with water before transferring to 2.0 ml water in 6-well tissue culture plates to which freshly hatched miracidia (isolated from 7 weeks infected mouse liver homogenate) was added and maintained for 120 min at room temperature. Exposed and unexposed snails from either lamivudine-treated susceptible BBO2 or BS-90 siRNA BgPiwi/PEI- treated snails were either frozen immediately at -80°C in RNAzol until required for RNA isolation or, if not used for RNA preparation immediately, transferred into 500 ml beakers containing aerated tap water and maintained as described above at room temperature and evaluated for cercarial shedding at week 4, 6 and 10 post-exposure. For comparison, susceptible snails were also either pre-treated as described above, or after two weeks post-parasite exposure, with another RT inhibitor BPPA (Santa Cruz Biotechnology Inc., CA) that specifically inhibits the catalytic RT domain of human telomerase (hTERT).

Examining genome organization, relocation of the PIWI locus, in susceptible and resistant snails following exposure to S. mansoni miracidia

Fluorescence in situ hybridisation (FISH) was performed using a probe derived from B. glabrata Bacterial Artificial Chromosome (BAC) libraries for the PIWI locus. The DNA probe was labelled by nick translation (BioNick Invitrogen, UK) as described [36,37] and incubating for 45–50 mins. The probe was precipitated with 1μg of labelled BAC DNA) [36], 80 μg of B. glabrata genomic DNA and 9 μg of herring sperm DNA. These components were dissolved in 48 μL of hybridisation mix at room temperature overnight, this amount can be used for up to four slides. Preparation and fixation of samples followed the protocol described previously [19]. Snail shells were crushed using a microscope slide and the ovotestes excised using needle-nose forceps. Each ovotestis was placed in a microcentrifuge tube containing 0.05 M KCl, macerated using a tissue grinder (Axygen, UK) and incubated in solution for 30 min at room temperature. Samples were then centrifuged at 200g for 5 min and supernatant discarded. Methanol:acetic acid [3:1, v/v] was added dropwise, with agitation, to the samples. Once 0.5 mL of fixative was added, the samples were incubated at room temperature for 10 min before centrifuging again and discarding the supernatant, this fixation step was repeated twice with the final fix volume being 100 μL. Slides were also prepared by misting the slide with water vapour and then dropping 20 μL of a sample from a height onto the slide and allowing the slide to dry on a slide drier. The slides were aged by placing into a 70°C oven for 60 min then were taken through a dehydration series of 70%, 90% and 100% ethanol, spending 5 min in each solution. Slides were dried and warmed up to 37°C on a slide dryer alongside 22x22 coverslips in preparation for probe addition. Probe denaturation was performed at 75°C for 5 min and then allowed to reanneal for 20 min at 37°C before use. Hybridisation of samples and probe was performed using the Top Brite automatic slide hybridiser (Resnova, Italy). Eleven μL of probe was applied to a coverslip and the slide with the sample brought to the coverslip and the coverslip sealed to the slide using rubber cement (Weldtite). The Top Brite was set for 2 min at 37°C, then 2 min at 75°C, and then 30 min at 37°C. Once the slides had been returned to 37°C, they were transferred to a humidified chamber at 37°C for 72 hours. Post- hybridisation, the rubber cement was removed, and coverslips allowed to detach in the first wash. The washes were performed at 42°C in 2x SSC three times for 5 min each. A blocking solution, made of 4% BSA (Sigma Aldrich, UK) in 2x SSC, was prepared. After slides were removed from the third wash the excess solution was drained and 100 μL of blocking solution was added and the slides covered with parafilm. Slides were maintained in a humidified chamber at room temperature for 30 min. Streptavidin-Cy3 was diluted 1:200 in 1% BSA in 2x SSC. After the blocking solution was removed, 100 μl of streptavidin-Cy3 solution was placed on each slide, covered in parafilm and incubated in a humidified chamber at 37°C for 30 min. After the streptavidin-Cy3 incubation the slides were washed sequentially in 2x SSC for 5 min, 1x PBS + 0.1% Tween 20 (Sigma Aldrich) for 1 min, and 1x PBS for 1 min. Lastly, the slides were rinsed in sterile water before counterstaining with 4’,6-diamidino-2-phenylindole (DAPI) in mountant (H1200, Vectorshield).

Image analysis

Images of nuclei were captured either with an Olympus BX41 fluorescence microscope with a greyscale digital camera (Digital Scientific, UK) and the Smart Capture 3 software (Digital Scientific, UK) or a Leica DM4000 using a Leica DFC365 FC camera and the Leica Application Suite (LAS) imaging software. At least 50 nuclei were imaged for each condition and processed via erosion script analysis [38,39] to assess gene loci positioning by using greyscale images and measuring the intensity of DAPI and fluorescence in situ hybridization (FISH) signal, using the DAPI to outline the nuclei to create five shells of equal area so that the intensity of the DAPI and FISH signal can be measured and the FISH signal normalised for position by dividing by the DAPI signal, averaged for the 50 images. Unpaired, equal variance, Student’s t tests were performed to ascertain significant differences in gene loci positioning within the different shells.

Results

Transcripts encoding PIWI (BgPiwi), HDAC (BgHDAC), chromobox protein homolog 1(BgCBx1), histone acetyl transferase (BgHAT) and metallotransferase (BgMT) are differentially regulated in resistant BS-90 and susceptible BBO2 snails

To confirm and validate results of differential expression (DE) obtained from the denovo single-pass sequencing of RNA isolated from S. mansoni exposed juvenile BS-90 F2 snails, which were cultured either at non-permissive (25°C), or permissive (32°C), temperatures, we investigated the expression of selected transcripts that have a role in epigenetics by two-step qPCR performed with RNA isolated from several different individual juvenile B. glabrata snails that were either resistant (BS-90 cultured at 25°C) or susceptible (BBO2 and BS-90 cultured at 32°C) to S. mansoni infection. Since the objective of this study was to identify robust candidate transcripts that underscore either B. glabrata resistance or susceptibility to S. mansoni, we chose to confirm the DE regulation of the transcripts identified between permissive (32°C) and non-permissive (25°C) BS-90 snails from the RNA-seq data set by using wildtype representative resistant (BS-90) and susceptible (BBO2) snails. This choice was also made because a reference genome sequence exists for the BBO2 stock, making it an invaluable resource for all follow up molecular studies on the B. glabrata snail. The investigation of temporal (0, 30 min, 1, 2, 4, and 16 hours) expression of BgPiwi in either juvenile resistant BS-90 (25°C) or juvenile susceptible BBO2 following exposure to S. mansoni by qPCR showed that the transcript encoding the B. glabrata PIWI-like protein (Isoform 1 Accession number XP_013081375) was upregulated between 30 min and 2 hour (2- to 7-fold) post-exposure in the resistant BS-90 but not in the susceptible BBO2 snail (Fig 1). Fig 2 shows the temporal expression of the transcript encoding BgHDAC (Accession XP_0130754221.1). Results likewise showed upregulation of this transcript (1.8-fold) in the juvenile resistant BS-90 but not in the juvenile susceptible (BBO2) snails 2 hours after S. mansoni exposure. Similarly, as shown in Figs 3–5, results demonstrated that transcripts encoding, the chromobox protein homolog 1 (Fig 3, BgCBx1), histone acetyl transferase (Fig 4, BgHAT) and metallotransferase (Fig 5, BgMT) were also upregulated in BS-90 resistant but not the susceptible BBO2 snails following S. mansoni infection. Inductions of up to 13- and 10-fold for transcripts encoding the chromobox protein homolog 1 and MT, respectively (between 2 and 4 hours post exposure) were observed in exposed juvenile resistant BS-90 but not their exposed juvenile BBO2 susceptible counterparts.

Fig 1

qPCR analysis of RNA from resistant BS-90 (blue histogram) or susceptible BBO2 (gray histograms) juvenile snails unexposed (0) or exposed for increasing intervals (30 seconds to 16 hours) to S. mansoni miracidia.

Histograms show expression of the BgPiwi encoding transcript in snails at each time point from five biological replicates. Note the increase in fold change in the resistant BS-90 compared to the susceptible BBO2 snails after parasite infection. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterisks on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

Fig 2

qPCR analysis of RNA from either resistant BS-90 (blue histogram) or susceptible BBO2 (gray histograms) juvenile snails unexposed (0) or exposed for increasing intervals (30 seconds to 16 hours) to S. mansoni miracidia.

Histograms show expression of the BgHDAC encoding transcript in snails at each time point from five biological replicates. Note the increase in fold change in the resistant BS-90 compared to the susceptible BBO2 snails after parasite infection. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterisks on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

Fig 3

qPCR analysis of RNA from either resistant BS-90 (blue histogram) or susceptible BBO2 (gray histograms) juvenile snails unexposed (0) or exposed for increasing intervals (30 seconds to 16 hours) S. mansoni miracidia.

Histograms show expression of the BgCBx encoding transcript in snails at each time point from five biological replicates. Note the increase in fold change in the resistant BS-90 compared to the susceptible BBO2 snails after parasite infection. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterisks on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

Fig 5

qPCR analysis of RNA from either resistant BS-90 (blue histogram) or susceptible BBO2 (gray histograms) juvenile snails unexposed (0) or exposed for increasing intervals (30 seconds to 16 hours) to S. mansoni miracidia.

Histograms show expression of the BgMT encoding transcript in snails at each time point from five biological replicates. Note the increase in fold change in the resistant BS-90 compared to the susceptible BBO2 snails after parasite infection. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterisks on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

Fig 4

qPCR analysis of RNA from either resistant BS-90 (blue histogram) or susceptible BBO2 (gray histograms) juvenile snails unexposed (0) or exposed for increasing intervals (30 seconds to 16 hours) to S. mansoni miracidia.

Histograms show expression of the BgHAT encoding transcript in snails at each time point from five biological replicates. Note the increase in fold change in the resistant BS-90 compared to the susceptible BBO2 snails after parasite infection. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterisks on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

A graphical flow chart summarizing the experimental design and results is shown in Fig 6.

Fig 6

Graphical flow chart illustration of the results and experimental design.

Juvenile snails were used in the study and were exposed to S. mansoni miracidia as described on MATERIALS and METHODS.

The protein sequence of BgPiwi is highly conserved

A standard BLASTp was performed to further validate the annotation of the 897 amino acid sequence of BgPiwi (Accession No XP_013089248.1) that was identified from the RNA-seq data set. This was followed by a SMART BLAST to explore the phylogeny of the B. glabrata homolog to other PIWI encoding transcripts in the public databases. Results revealed that the BgPiwi encoding transcript represents a single copy gene in the B. glabrata genome that is translated into two protein isoforms, 1and 2. All data presented herein deals only with the differential regulation of the transcript encoding protein isoform1 and not 2. Results of multiple sequence alignment of the BgPiwi isoform1 amino acid sequence to those from other organisms showed that the snail protein is highly conserved with significant matches to the vertebrate (human, mouse, zebra fish) orthologs compared to invertebrate PIWI proteins in Drosophila melanogaster and Caenorhabditis elegans (Table 3).

Table 3

The amino acid sequence of BgPiwi isoform 1 is conserved in comparison to those from other organisms.

	Query Cover	E-value	Percent Identity	Accession
piwi-like protein 1 (Danio rerio)	93%	0.0	42.14%	NP_899181.1
piwi-like protein 1, isoform 1 (Homo sapiens)	93%	0.0	42.97%	NP_004755.2
piwi-like protein 1 (Mus musculus)	92%	0.0	42.28%	NP_067286.1
argonaute 3, isoform D (Drosophila melanogaster)	85%	0.0	39.11%	NP_001036627.2
piwi-like protein (Caenorhabditis elegans)	86%	4e-162	33.79%	NP_492121.1

Indeed, a phylogenetic tree conducted by the neighbor -joining method, confirmed that the B. glabrata protein was more closely related to C. elegans than to D. melanogaster (S1 Fig).

siRNA corresponding to BgPiwi knocks down expression of the PIWI encoding transcript rendering resistant BS-90 snails susceptible

Since the findings revealed that the transcript encoding BgPiwi was upregulated in juvenile resistant BS-90 snails after S. mansoni infection, we proceeded to examine the modulation of this (BgPiwi) transcript in the resistant (25°C) and the susceptible juvenile (32°C) BS-90 snails, with and without S. mansoni infection. The findings presented in Fig 7 demonstrates that unlike resistant BS90 snails, cultured at 25°C, where the expression of the BgPiwi was upregulated following (2 hour) S. mansoni infection; in contrast, in susceptible juvenile BS-90 snails cultured at 32°C, the expression of the BgPiwi transcript was downregulated as was shown above in the S. mansoni exposed BBO2 susceptible snail (Fig 1). Based on these data and given the known role of PIWI in silencing endogenous retrotransposable elements and previous results that revealed expression (upregulation) of the RT domain of nimbus occurs in juvenile susceptible but not resistant snails in response to S. mansoni, the functional role of PIWI in the epigenetics of B. glabrata/S. mansoni susceptibility was investigated by silencing the expression of the transcript encoding BgPiwi with corresponding siRNAs. As shown in Fig 8, investigation of the expression of the transcript encoding BgPiwi in siRNA/PEI transfected snails with (2 hours) and without (0 hours) S. mansoni exposure showed the knock-down of the BgPiwi encoding transcript in snails transfected with siRNAs corresponding to BgPiwi, but not to the universal mock siRNA. Use of BgPiwi dsRNA/PEI complexes instead of siRNA/PEI complexes to transfect BS-90 snails, similarly, produced the knock-down of the PIWI encoding transcript as observed with using siRNAs. To determine the biological effect of silencing BgPiwi in relation to S. mansoni infection in BgPiwi siRNA/PEI transfected BS90 snails, schistosome exposed transfected, untransfected snails, and Universal mock siRNA/PEI transfected snails were left at room temperature and evaluated at 4- and 6-weeks post-exposure (S2 and S3 Figs).

Fig 7

qPCR analysis of RNA from either non permissive (25°C) resistant BS-90 (blue histogram) or permissive (32°C) susceptible BS-90 (gray histograms) juvenile snails unexposed (normal) or exposed for 2hr to S. mansoni miracidia.

Histograms show expression of the BgPiwi encoding transcript in these snails residing at different temperatures. Note the significant induction (8-fold change) in 25°C non-permissive BS-90 snails compared the down regulation of the transcript in permissive BS-90 snails residing at 32°C after parasite infection. Fold change was determined as described in MATERIALS and METHODS. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterixis on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

Fig 8

qPCR analysis of RNA from resistant BS-90 juvenile snails unexposed (gray) or exposed (blue) for 2hr to S. mansoni miracidia.

Histograms show expression of the BgPiwi encoding transcript in normal BS-90 snails (control) or those transfected with BgPiwi siRNA. Note induction of the BgPiwi encoding transcript occurs in S. mansoni exposed control BS-90 snails and the knock down of the transcript in BS-90 (exposed and unexposed) snails transfected with BgPiwi siRNA. In BS-90 snails transfected with mock UNIsiRNA, note the upregulation of the BgPiwi encoding transcript in exposed snails similar to induction observed in control exposed snails. Fold change was determined as described in MATERIALS and METHODS. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterixis on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

Knock-down of PIWI encoding transcript with siBgPiwi/PEI complexes concurrently upregulates the nimbus RT in transfected BS90 snails

Because PIWI suppresses the expression of retrotransposable elements, such as the B. glabrata non-LTR retrotransposable element nimbus, the transcription of the RT domain of this element was investigated in either unexposed (0) or S. mansoni (2 hour) exposed BS-90 snails that were transfected with either BgPiwi siRNA or mock universal siRNA. The same cDNA templates utilized in the qPCR assays shown in Fig 8 were utilized in the analysis of the expression of nimbus RT (Fig 9). Using gene specific primers corresponding to the RT domain of nimbus, results showed that in untransfected BS-90 snails that were unexposed (0) to S. mansoni, that similar to resistant BS-90 transfected with mock siRNA (UnisiRNA/PEI), the expression of nimbus RT remained low upon infection of the normal resistant BS-90 snails as previously demonstrated [18]. Furthermore, in BS-90 snails transfected with BgPiwi siRNA before exposure, the nimbus RT encoding transcript was upregulated while BgPiwi transcript was silenced as expected.

Fig 9

qPCR analysis of RNA from resistant BS-90 juvenile snails unexposed (gray) or exposed (blue) for 2hr to S. mansoni miracidia.

Histograms show expression of the nimbusRT encoding transcript in normal BS-90 snails (control) or those transfected with BgPiwi siRNA. Note the down regulation of the nimbusRT encoding transcript in S. mansoni exposed control BS-90 snails and the upregulation of nimbusRT transcript in BS-90 (exposed and unexposed) snails transfected with BgPiwi siRNA where transcript encoding BgPiwi has been knocked-down (shown in Fig 2B). In BS-90 snails transfected with mock UNIsiRNA, note the down regulation of the nimbusRT encoding transcript in exposed snails similar to that observed in control exposed snails. Fold change was determined as described in MATERIALS and METHODS. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterixis on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

Lamivudine RT inhibitor treatment of susceptible BBO2 snails differentially regulates transcription of nimbus RT and BgPiwi

To further examine the interplay between the expression of BgPiwi and nimbus RT encoding transcripts in relation to S. mansoni infection of B. glabrata. The susceptible juvenile BBO2 snail was treated with the RT inhibitor, lamivudine, as described in MATERIALS and METHODS prior to exposure to S. mansoni. As shown in Figs 10 and 11, qPCR analysis of the same cDNA template prepared from BBO2 susceptible snails that were either treated or untreated with different concentrations (100 ng/ml and 200 ng/ml) of lamivudine before exposure (for 2 hours) or not exposed (0 hour) to S. mansoni were performed by utilizing primers corresponding to the BgPiwi (Fig 10) or nimbus RT (Fig 11) encoding transcripts. Fig 10 shows the expression of BgPiwi remained relatively unchanged with drug treatment while that of nimbus RT (Fig 11) was downregulated with Lamivudine. Both concentrations of lamivudine, either 100 or 200 ng/ml, used to treat BBO2 snails prior to exposure suppressed the expression of the nimbus RT encoding transcript in lamivudine–treated snails.

Fig 10

qPCR analysis of RNA from susceptible BBO2 juvenile snails unexposed (gray) or exposed (blue) for 2hr to S. mansoni miracidia.

Histograms show expression of the BgPiwi encoding transcript in normal BBO2 snails (0) or those treated with RT inhibitor Lamivudine (100 ng/ml or 200ng/m1). Note the down regulation of the BgPiwi encoding transcript in exposed control (0) snails and lamivudine treated snails (exposed and unexposed) snails. Fold change was determined as described in MATERIALS and METHODS. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterixis on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

Fig 11

qPCR analysis of RNA from susceptible BBO2 juvenile snails unexposed (gray) or exposed (blue) for 2hr to S. mansoni miracidia.

Histograms show expression of the nimbusRT encoding transcript in normal BBO2 snails (0) or those treated with RT inhibitor, lamivudine (100 ng/ml or 200 ng/m1). Note the upregulation of the nimbusRT encoding transcript in exposed control (0) snails and down regulation of this transcript in lamivudine-treated snails (exposed and unexposed) snails. Fold change was determined as described in MATERIALS and METHODS. Significant expression normalized against expression of the myoglobin encoding transcript was measured by 2-way ANOVA and is indicated by number of asterisks on each histogram where ****, indicates the most significant value p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, ns p > 0.05.

Lamivudine blocks schistosome infection of BBO2 snails

Because the silencing of the BgPiwi encoding transcript rendered the resistant BS-90 snail susceptible, concurrent with the down- and up-regulation of the BgPiwi encoding transcript and nimbus RT encoding transcripts, respectively, and since follow-up qPCR analysis using the same cDNA templates showed that nimbus RT was knocked down by lamivudine treatment of the susceptible BBO2 snail, the effect of this drug on the ability of the susceptible snail to sustain a viable infection was examined (Fig 6). As shown in Figs 12 and 13, where juvenile BBO2 snails were treated with 100 ng/ml of lamivudine either before or two weeks after exposure to S. mansoni miracidia, snails failed to shed cercariae when treated with lamivudine prior to exposure (Fig 12). However, snails treated with BPPA (anthraquinone diacetate), another RT inhibitor that specifically blocks the reverse transcriptase activity of the human homolog of telomerase (hTERT) in B. glabrata, shed cercariae when treated before exposure but not when treated at 14 days post S. mansoni miracidia exposure (Fig 13). In contrast to these results, the same delayed treatment regimen with lamivudine (2 weeks post- exposure) failed to block infection. The BBO2 snails failed to shed cercariae at 10 weeks post exposure only when pre- treated with lamivudine prior to exposure. These results showed that early induction of nimbus RT in the snail host following schistosome infection is important for parasite survival.

Fig 12

To determine the effect of lamivudine in relation to S. mansoni infection of susceptible BBO2 snails, snails were treated before exposure with 100 ng/ml of the RT inhibitor, maintained at room temperature, and evaluated for up to 6 weeks post-exposure.

Note that the BBO2 snails treated before infection with lamivudine failed to shed cercariae at 6 weeks post-exposure to S. mansoni unlike in untreated (control) snails. Also note that BBO2 snails treated with the hTERT RT inhibitor BBPA before exposure, unlike Lamivudine shed cercariae at 6 weeks post-exposure.

Fig 13

The effect of treating BBO2 susceptible snails with 100 ng/ml of lamivudine at 14 days post -exposure to S. mansoni was compared to the effect of treating susceptible BBO2 snails before exposure with 100 ng/ml of BPPA as described in MATERIALS and METHODS and left at room temperature and evaluated for up to 6 weeks post- exposure.

Note that the BBO2 snails treated before S. mansoni exposure with 100 ng BPPA failed to shed cercariae at 6- weeks post- exposure unlike in untreated (control) snails. Also note that BBO2 snails treated with lamivudine at 14 days after infection shed cercariae at 6 weeks post-exposure.

Relocalization of the PIWI gene locus occurs in resistant B. glabrata snails upon infection

We had demonstrated that co-culture of snail Bge cells with live parasite [34,36], and infection of whole snails with live parasite, both lead to non-random gene loci relocation within the interphase nuclei of the host snail cells, correlated with gene up-regulation [13,19,40], with notable differences in gene movement between susceptible and resistant snails. We have been able to demonstrate again that gene loci change their non-random nuclear location with changes in gene expression. A FISH probe containing the sequences for B. glabrata PIWI was employed to delineate the nuclear position of the piwi gene loci in three snail strains, BS-90 (resistant) and the two susceptible strains, BB02 and NMRI (Fig 14A–14F). The nuclear positioning of the gene loci were analyzed using the erosion analysis script for gene and chromosome positioning, we have used previously for different species [41-43] and can be assigned to a peripheral (Fig 14A), intermediate (Fig 14B) or internal (Fig 14C) location in cell nuclei. Notably, the PIWI gene signal is in different nuclear compartments for the resistant and susceptible snails. Indeed, in BS-90 (Fig 14D), the gene loci are found towards the nuclear interior and upon infection there is a relocation towards the nuclear periphery at 30 minutes after infection (Fig 7D), which coincides with the increase in PIWI transcripts (Fig 1). By two hours, the gene loci are relocating back to the nuclear interior (Fig 14D).

Fig 14

Nuclei, in blue, as they are stained with DAPI, were isolated from snail strains BS90, BB02 and NIMR ovo-testis and subjected to 2D-fluorescence in situ hybridisation (FISH) with fluorescein labelled probes for the transposable element, piwi (green).

Panel A displays a peripheral nuclear location, panel B an intermediate nuclear location and panel C a location at the nuclear interior for the two gene loci. Scale bar = 5 μm. Using a bespoke nuclear positioning script that creates five concentric shells of equal area, shells 1–5, with shell 1 being the nuclear periphery and shell 5 the nuclear center, the percentage of fluorescent green gene signal is measured in each shell for over 50 nuclei and divided by the percentage of blue fluorescence signals for the DNA content (DAPI) in each shell for normalization. The data are averaged and plotted as bar charts with standard error of the mean (SEM) as error bars. These graphs are displayed in panels D-F, showing the distribution of the normalized piwi gene signals from the nuclear periphery (shell 1) to the nuclear interior (shell 5), 30 mins, 2 hours and 4 hours after an infection with Schistosoma mansoni at 0 hours. Panel D displays data from BS90 snails, panel E data from BB02 snails and panel F from NMRI snails.

The two susceptible snail strains of BB02 (Fig 14E) and NMRI (Fig 14F) display a similar gene loci location for PIWI, an intermediate location, different from the resistant BS-90 strain (Fig 14D). Furthermore, the PIWI gene locus does not change location until 4 hours post-infection, where in both snail strains, the gene locus is in the nuclear interior, a location has been correlated with down-regulation of expression in BS-90, and in BB02 (Fig 1). Together, these findings further support the notion that the parasite is able to influence genome behavior within its host for its own advantage in an epigenetic mechanism, through functional spatial positioning.

Discussion

Significant progress has been made in recent years towards elucidating the molecular basis of S. mansoni resistance/susceptibility in the intermediate snail vector B. glabrata. From these studies, it has become clear that the snail and schistosome relationship is complex and highly variable [13,20,44]. This study was undertaken to determine the role of epigenetics in shaping the relationship between the snail and the schistosome. The genetics of this interaction is well known and several molecular determinants that underlie the innate defense anti-schistosome response in B. glabrata have been identified as have sequences that are linked in the snail genome to resistance [14,21,45]. Epigenetics describes the inheritance of a reversible phenotype that is not influenced by any change in the sequence of DNA. Transgenerational epigenetic inheritance induced by environmental changes have recently reported the role of PIWI and small piRNA in stress-induced genome modifications (see [46]). The impact of viral infection on the siRNA and Argonaute /PIWI pathway has mainly been reported in insects [47,48]. However, little is known regarding genes and proteins involved in this insect Ago-2/RNAi antiviral/stress defense response [49].

Variation in B. glabrata susceptibility to S. mansoni was investigated by examining the regulation of key transcripts that play a role in epigenetics. Our approach was to use representative juvenile snail stocks that are either resistant (BS-90) or susceptible (BBO2) to the NMRI strain of S. mansoni, to examine the temporal regulation of transcripts encoding PIWI (BgPiwi), chromobox protein homolog 1 (BgCBx1), histone acetyl transferase (BgHAT), histone deacetylase (BgHDAC), and metallotransferase (BgMT) in these snail stocks within 30 min to 16hr post- exposure to S. mansoni. The differential expression of these transcripts was initially identified by comparing RNA-seq datasets that were generated from non-permissive juvenile BS-90 snails, cultured at room temperature (25°C), and their permissive counterparts cultured for two generations at 32°C. The snail infections were carried out exclusively with juvenile snails. Thus, to further validate the differential expression of these transcripts, resistant juvenile BS-90 and susceptible juvenile BBO2 snails were exposed to S. mansoni before using real-time qPCR to confirm their modulation pre- and post- exposure to S. mansoni. Transcripts encoding PIWI (BgPiwi), chromobox protein homolog 1 (BgCBx1), histone acetyl transferase (BgHAT), histone deacetylase (BgHDAC) and metallotransferase (BgMT) were upregulated (1.8 to 10-fold) in the resistant (BS-90) snail as compared to their downregulation in the susceptible juvenile snail (BBO2). Upregulation of the majority of these transcripts occurred within the first 30 min of exposure to S. mansoni, peaking at 120 min before subsiding. In earlier reports, we showed that the regulation of the RT domain of the B. glabrata endogenous non-LTR-retrotransposable element, nimbus, was linked to the early differential stress response observed between juvenile resistant and susceptible snails [18]. Accordingly, induction of RT occurred concurrently with the upregulation of the transcript encoding Hsp70 in the susceptible but not the resistant snail after S. mansoni infection. Exposure of B. glabrata to irradiated attenuated miracidia, however, failed to induce these stress-related transcripts in early-infected juvenile susceptible snails [25]. Given those findings and results presented here showing that upregulation of the B. glabrata PIWI encoding transcript, BgPiwi, occurs in resistant BS-90 snails residing at room temperature (where they are resistant) but not in their susceptible counterparts residing at 32°C, we examined the expression of the BgPiwi transcript more closely in relation to the early expression of nimbus RT in susceptible and resistant snails. To reiterate, changes in transcription regulation were evident within 30 minutes of infection. In this regard, these novel findings differ from those described by others where molecular interactions between the snail and schistosomes were examined much later after miracidia penetration at which time the responses we now report might have waned.

The existence of several piRNA sequences in B. glabrata has been described but their role in a PIWI-piRNA mediated anti-parasite defense mechanism in the snail remains elusive [50]. However, to determine whether a PIWI gene-silencing mechanism that involves nimbus RT plays a role in blocking transmission of schistosomes in B. glabrata, we utilized a previously developed PEI-mediated soaking method to deliver two different BgPiwi corresponding duplex siRNAs, simultaneously, into the resistant BS-90 snail, thereby knocking-down the expression of the PIWI encoding transcript. The RNAi suppression of PIWI transcription, rendered these BgPiwi siRNA/PEI transfected resistant BS-90 snails susceptible and thus able to shed cercariae (S2 and S3 Figs). While the transcript encoding BgPiwi was reduced in siRNA/PEI transfected snails, in contrast, the expression of nimbus RT-encoding transcript was upregulated, indicating that a gene silencing mechanism mediated by the interplay of BgPiwi and modulation of the transcription of nimbus RT plays a major role in B. glabrata susceptibility to S. mansoni. To provide further support for these findings, the susceptible BBO2 snail was treated with lamivudine, a known RT inhibitor. Lamivudine is a RT nucleoside analog inhibitor that is used to treat hepatitis B and HIV/ AIDS [51]. Treatment of either susceptible BBO2 or NMRI snails prior to schistosome exposure, consistently, after several biological replicates blocked S. mansoni infection in the snail. By contrast, BPPA, another RT inhibitor that specifically targets the RT activity of telomerase, did not block infection in B. glabrata by S. mansoni when snails were treated before parasite exposure. However, in snails treated at 2 weeks after exposure, BPPA prevented infection unlike what was observed with this treatment regimen with lamivudine. These findings indicated that the mechanism of action of this nimbus/PIWI interplay occurs very early in the S. mansoni and B. glabrata interaction. In ongoing studies, we have shown that an hTERT homolog is absent in the S. mansoni genome with the snail ortholog showing significant identity at the amino acid level to the human enzyme. Interestingly, two PIWI related protein isoforms (1and 2) were found to occur in B. glabrata. The focus of the present study was on B. glabrata PIWI isoform 1 which was found to be highly conserved at the amino acid level to both vertebrate and invertebrate PIWI homologs.

Work is currently underway to determine if using the same siRNA mediated gene silencing strategy as described above will reveal the significance of the other transcripts identified in this study and their functional role in epigenetics of the S. mansoni/B. glabrata relationship. Previously, we showed that hypomethylation of the stress Hsp70 protein locus precedes the early upregulation of the Hsp70 encoding transcript in S. mansoni exposed susceptible (NMRI) but not resistant (BS-90) juvenile snails [52]. The findings here that the transcript encoding MT was upregulated in juvenile BS-90 resistant but not susceptible BBO2 upon early parasite infection snails supports this earlier result [52]. Ideal follow up experiments to further verify the involvement of all the transcripts identified in this study in epigenetics of snail plasticity to S. mansoni susceptibility will be to edit their CDS by a permanent gene mutation such as by CRISPR/Cas9 to knockout their function. These approaches can likely contribute to deciphering epigenetic processes that underlie the susceptibility of the snail to the parasite. Toward this objective, molecular toolkits for gene editing in B. glabrata are being developed. CRISPR gene editing has been used to edit the allograft inflammatory factor gene in the Bge embryonic cell line from B. glabrata [53] and is finding utility in editing the schistosome genome [54,55]. Confirming earlier findings, we show that in intact juvenile resistant and susceptible snails, within a short period post-exposure to S. mansoni, the non-random movement of the PIWI locus within interphase nuclei in relation to its active transcription depending on the susceptibility phenotype of the snail [19]. We have shown for the schistosome mediated relocation of gene loci that movement in interphase nuclei (from peripheral to interior location) occurs early after infection of susceptible, not resistant snails, and precedes transcription of the gene loci in question. A soluble factor(s) within excretory secretory products (ESPs) from the wild -type miracidia that mediates the systemic reorganization of the host genome is yet to be uncovered. Aside from schistosomes, viruses are the only other pathogens that have been shown to also mediate non-random gene relocation. However, schistosomes are the first metazoan parasites that have been shown to possess the ability to manipulate the genome of the host in this profound spatio-epigenetic fashion.

To conclude, although a molecular basis exists for B. glabrata susceptibility to S. mansoni, it remains far from clear what precise pathways/mechanisms are responsible for parasite survival or rejection in the early infected snail. This is the first study to show that epigenetics, involving the interplay of PIWI and the endogenous non LTR-retrotransposable nimbus, plays a role in the plasticity of snail susceptibility to S. mansoni.

Title, Phylogenetic tree constructed from amino acid sequences of BgPiwi and those from other organisms.

Phylogenetic tree constructed using the neighbor-joining method from the amino acid sequences of BgPiwi isoform 1 and of other organisms (Table 3). The data reveal that the B. glabrata isoform 1 protein shows closer evolutionary relationship to the C. elegans, human, mouse, and zebra fish amino acid sequences than to D. melanogaster.

(TIF)

Click here for additional data file.

BgPiwi siRNA transfected BS-90 snail shedding cercariae at 4 weeks post-exposure to S. mansoni.

To determine the biological effect of silencing BgPiwi in relation to S. mansoni infection in BgPiwi siRNA/PEI transfected BS-90 snails, schistosome exposed BgPiwi siRNA transfected and untransfected snails were left at room temperature and evaluated at 4- and 6-weeks post-exposure. Note that the BS-90 snail transfected with BgPiwi siRNA shed cercariae at 4 weeks post-exposure to S. mansoni.

(TIF)

Click here for additional data file.

BgPiwi siRNA transfected BS-90 snail shedding cercariae at 6 weeks post-exposure to S. mansoni.

To determine the biological effect of silencing BgPiwi in relation to S. mansoni infection in BgPiwi siRNA/PEI transfected BS-90 snails, schistosome exposed BgPiwi siRNA transfected and untransfected snails were left at room temperature and evaluated at 4- and 6-weeks post-exposure. Note that the BS-90 snail transfected with BgPiwi siRNA shed cercariae at 6 weeks post-exposure to S. mansoni.

(TIF)

Click here for additional data file.

15 Feb 2021

Dear Dr. Knight,

Thank you very much for submitting your manuscript "PIWI silencing mechanism involving the retrotransposon nimbus orchestrates resistance to infection with Schistosoma mansoni in the snail vector, Biomphalaria glabrata" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Philip T. LoVerde

Guest Editor

PLOS Neglected Tropical Diseases

Michael Hsieh

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: I do not believe that new analyses are required for acceptance but the manuscript should be comprehensively revised.

Reviewer #2: -Are the objectives of the study clearly articulated with a clear testable hypothesis stated? y

-Is the study design appropriate to address the stated objectives? nd

-Is the population clearly described and appropriate for the hypothesis being tested? y

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested? nd

-Were correct statistical analysis used to support conclusions? n

-Are there concerns about ethical or regulatory requirements being met? nd, it may be included to be published

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Figures were mostly clear. See comments on figure legends in attached document. Photographs of shedding snails doesn't appear to be necessary.

Reviewer #2: -Does the analysis presented match the analysis plan? y

-Are the results clearly and completely presented? y

-Are the figures (Tables, Images) of sufficient quality for clarity? y

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: (No Response)

Reviewer #2: -Does the analysis presented match the analysis plan? y

-Are the results clearly and completely presented?y

-Are the figures (Tables, Images) of sufficient quality for clarity?y

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: Please see attached document. I selected accept with minor revisions as I do not think any additional experiments need to be carried out. However, I believe the manuscript should be comprehensively revised.

This manuscript describes the findings of a comprehensive study on the interplay of piwi and nimbus, and their potential role in the resistance or susceptibility of Biomphalaria snails to schistosome infection. This research is original and important to the field. It will also be of interest to researchers in other fields such as epigenetics and invertebrate immunology. Overall I recommend the following major editing. I recommend the following points be addressed and I’ve listed suggested edits.

• Overall, there was variation in formatting and writing style, perhaps as there are multiple authors. I recommend revising the paper so it is more uniform.

• It would be helpful to clarify why the 2 different siRNAs were used together rather than separately.

• Can the authors provide any explanation for why in Fig 3, UNI siRNA treated unexposed BS-90 showed a much greater decrease in nimbus expression than in UNIsiRNA treated and schistosome-exposed BS-90?

• This was a comprehensive study comprising several different methods/experiments. A flow chart or graphic giving overview of all methods would be helpful to readers.

• Likewise, a graphic summarizing the results would be helpful.

• The description of methods used to acquire sequences in order to design primers for qPCR were confusing (lines 209-223). There was mention of exploring the phylogeny of the B. glabrata orthologs but it isn’t clear why this was performed and I didn’t see the resulting data anywhere.

• If space in journal is limited, Figures 2B and 2C do not appear to be absolutely necessary. A table with number cercariae shed might be more impactful.

• The significance of the use of the BPPA hTERT inhibitor, and that it stops cercarial shedding when snails treated with it 2 weeks post-infection, was not clear.

• It was not clear why the 2 siRNAs were used simultaneously not individually.

Reviewer #2: The manuscript entitled “PIWI silencing mechanism involving the retrotransposon nimbus orchestrates resistance to infection with Schistosoma mansoni in the snail vector, Biomphalaria glabrata” is focusing on to decipher the role of bgPIWI snail resistance to one of its parasite, S. mansoni. Firstly, the authors uses a comparative transcriptomic approach to analyze the differential expression genes between permissive and non per-issive BS90 snails, a model of choice to investigate the link between snail epigenetics and resistance. Then, by a classical QPCR approach , they confirmed the differential gene expression for BgPiwi, BgMTn BgCBx1, BgHAT et HDAC between BS90 (non permissive) and another snail strain BBO2 (or BB02?) which is susceptible to S. mansoni. siRNA experminents targeting bgPIWI render resistant BS90 snails susceptible. A correlation has been done between bgPIWI and a non LTR retrotransposable element nimbus expression. RT inhibition by lamivudine affect snail susceptibility against S. mansoni.

This study could be of relevance for the field. However, I have major concerns regarding the method used and the interpretation of the results. These concerns are detailed below.

MAJOR COMMENTS

Statistics methods used could be improved. For instance, multiple time points (parasite challenge) could be compared globally using a Kruskal-Wallis or an ANOVA test (depending on normality and homoscedasticity of the distributions) and post-hoc test can be then performed to identify pairwise differences. No test on normality data was mentioned for all analyzed data. Please provide more details for the statistical analysis

The authors also do not report the validation of the primer couples they are using in terms of PCR efficiency; thus, it is not clear whether they meet the conditions required for DeltaDeltaCt use. Note there are also statistics that are specifically dedicated to qRT-PCR (Pfaffl method).

In the abstract, the authors mentioned that comparative analysis will be performed on permissive and non-permissive BS90 snails, and the strain BBO2 was not indicated. All in all, the reader might reasonably expect that all comparisons are made between permissive and not permissive BS90, but this is not the case. Why ? To my mind, it will reinforce the conclusions of the paper and it will be a best straight strategy to claim on the bgPiwi role. All results performed with the BBO2 strain could be extrapolated for the BS90 F2 (permissive condition) ? It will be elegant to reinforce the conclusion to have the results from qPCR analysis of RNA from permissive BS90 exposed to parasite. In the same way, treatment with inhibitors could be performed on permissive BS90 snails and compared to non-permissive snails.

Please for all QPCR analysis, give the same scale for the y-axis. For example in Fig2A, bgpiwi expression seems to be unchanged with 200 ng/ml of inhibitor whereas its expression is decreased compared to the untreated snails. Intersection at x-axis, the y co-ordinate should be 1

Please indicate the prevalence for the snails treated and not treated with inhibitors. According to me, Figure 2C ca be added in supplementary data. Note that no legend is associated with the figure 2D

In the manuscript, the authors report that “Treatment of the snails with 464 lamivudine at day 14 post-exposure, however, showed some snails shed cercariae when 465 the drug was utilized later after infection.” Please indicate for how many snails (%) , this observation has been done. Also, if I understand well, this treatment can affect parasite development. So, in Fig5A, what is the developmental stage of the parasites in the BBO2 snails exposed to lamivudine ? Are they killed, encapsulated or present as sporosysts but unable to grow. Please provide further discussion /clarification.

MINOR COMMENTS

Reviewer 1

Suggested edits

Line 37-38 – swap permissive and non-permissive

Line 42 – join acetyl and transferase = acetyltransferase

Line 42 – need to separate histone acetyl transferase and histone deacetylase with comma

Line 139 – suggest changing “obtain leads” to “obtain candidates” to avoid having leads twice in same sentence

Line 194 – insert comma after “(TmHMM)

Line 203 – please include more detail on how specific transcripts to be examined vi two step qPCR were selected.

Line 209 – not clear what “#7050” refers to. Should this citation be a number in refs rather than name and year?

Line 216 - join acetyl and transferase = acetyltransferase, insert comma after (BgHAT)

Line 228 – join “Bio” and “systems”. Is Wolston Warrington the correct address? I could not find it on a map. Maybe just include Warrington

Lines 208-226 – there is lack of consistency in wording of two step RT qPCR (i.e. sometimes two step included other times not), and whether given in full or abbreviated

Lines 244-75 – P of BgPiwi was uppercase previously

Line 246 – would change wording to “either dsRNA or siRNA, complexed with PEI”

Line 274 – remove “in”

Line 286 – have already given Sigma address in full (line 252)

Line 286 – insert comma after “MO)”

Line 310 – should the comma be replaced with a semicolon?

Line 317 & 328 – perhaps change “presented” to added

Line 330-1 – would reword description of incubations at different temperatures, e.g., The Top Brite was set for 2 min at 37C, then 2 mins at 75C, and then 30 min at 37C

Line 352 – numbers can be in same box, don’t’ need separate box for each number

Line 366 – De-novo doesn’t need uppercase d or a hyphen

Line 368 – should be one sentence, no period after “temperatures”

Line 395 – “demonstrates” rather than “demonstrate”

Line 399, “he” should be “the”

Line 426 – insert comma after “nimbus”

Line 428 – after “PEI)” insert a comma and then “ the”

Line 456 – remove “either”

Line 509 – insert space after “insects”

Line 514-19 – insert some commas in lists of genes, overall this sentence doesn’t read well

Line 528 – insert commas in list of transcripts (e.g. after (HAT) and after (HDAC)

Line 546 – replace “preformed” with “examined” or “recorded”

Line 551 – delete “reveals the repertoire”

Line 592 – can put 2 numbers in same [ ]

Figure legends

Line 630 & 682 & 695 & 716 & 728 – think plural of asterisk is asterisks, not asterixis

Line 674 -5 – legend refers to blue and gray histograms but both are blue though different shades of blue

Figure 2D lacks a figure legend

Figure 6 legend could clarify A, B, and C as showing examples of shell positions. Clarify which part of legend referring to 6D.

Reviewer 2

L2 : 25°C (permissive) maybe non permissive ?

Please harmonize writing for PIWI, Piwi or piwi

Please indicate the origin of BS90 (BS-90 ?) as done for the other snail strains.

L193 : Pfam

L196 : clarify different categories

L188 : 2 hours ?

L209 : Format the reference

L271 Edit a space between TR and nimbus

L376 and 396 : hours ?

Addressing these points may require minor revisions and supplementary experiments, but will significantly improve the quality of the manuscript, which has great potential to provide novel insight into Biomphalaria - Schistosoma complex interaction

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see https://journals.plos.org/plosntds/s/submission-guidelines#loc-methods

Submitted filename: review.docx

Click here for additional data file.

13 May 2021

Submitted filename: Responses to reviewers comments.docx

Click here for additional data file.

16 Jun 2021

Dear Dr. Knight,

Thank you very much for submitting your manuscript "PIWI silencing mechanism involving the retrotransposon nimbus orchestrates resistance to infection with Schistosoma mansoni in the snail vector, Biomphalaria glabrata" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you make the minor corrections according to the review recommendations. Please address the issue of qPCR.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Philip T. LoVerde

Guest Editor

PLOS Neglected Tropical Diseases

Michael Hsieh

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: (No Response)

Reviewer #2: all the points are satisfied

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: (No Response)

Reviewer #2: y

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: (No Response)

Reviewer #2: y

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: line 44 - differential expression doesn't need uppercase letters (Differential Expression)

line 83 - "became" should be "become"

line 109 - check if unnecessary space between "long-" and "term"

line 155 - insert "temperatures" after (25C)

lines 166-168 - could these 2 sentences be merged, in 1st sentence state that BS-90 resistant to S. mansoni NMRI strain, and in 2nd sentence state that BS-90 resistant to S. mansoni strains from Old World and New World.

line 177 - should "exposure" be plural?

line 180 - remove space in bri address

line 211 - transcriptome should be plural as multiple transcriptomes generated

line 214 - insert comma after "(32C)

line 223 - Table 1 lacks a title and not clear if upregulated and downregulated refers to in 32C or in 25C. Legend for table would be helpful.

line 228 - why is the formatting of this citation not a number?

line 235 - check if unnecessary space between "RNA-" and "seq"

line 237 - insert "temperatures" after "(25C)"

line 267 - give BLAST in full earlier (line 234)

line 289 - check for unnecessary spaces within equation in subscripts

line 311 - not clear which reagent "(Sigma)" refers to

line 314 - don't need "(" as have one line 313

line 318 - don't need uppercase T for "Total"; don't think it is necessary to include "(by serendipity)"

line 329 - please correct "in at"

line 349 - please check if need space in siRNABgPIWI/

line 383 - suggest changing verb from "was presented to a coverslip" to "was applied to a coverslip"

line 427 - unnecessary space after "mansoni"

line 450 - "No" should be "No."

line 451 - unnecessary space after "set"

line 454 and 455 - check if space missing between "1" and "and"

line 468 - title for table not accurate as table not showing multiple alignments, it shows the degree of identity between homologs

line 471 - suggest replacing "however" with "furthermore"

line 482 - suggest changing "infection" to exposure as BS-90 maintained at 25C

line 497 - insert commas after "transfected" and "normal snails". Also suggest not using the term "normal". Instead suggest using "untransfected". Same for line 509 regarding use of "normal".

line 518 and following - lack of consistency in BgPiwi, p often lowercase in remainder of manuscript (e.g., lines 525, 526, 533, 534 )

lines 553 & 554 - suggest using S. mansoni miracidia/sporocysts instead of "parasite" for sake of clarity and consistency

line 612 - insert comma after "(BgHAT)"

line 679 - remove space after "54" and insert before "55"

line 684 - suggest changing wording to clarify that referring to exposure of resistant and infection of susceptible, rather than referring to both using "infection"

line 681 - check for consistency in how write piwi when referring to gene

line 686 - suggest changing miracidium to plural

line 687 - do the authors mean systematic rather than systemic?

Reviewer #2: Accept

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: This manuscript describes research that was done to increase our understanding of the complex molecular interactions between B. glabrata snails and Schistosoma mansoni. It is of interest to researchers of this host-parasite system, as well as to those in the fields of host-parasite interactions, molecular parasitology, and vector biology, to name a few. The research is very novel, interesting, and significant to the fields mentioned above.

I have suggested multiple edits in a separate section as well as a few concerns or suggestions below.

lines 247-250 - It seems that if qPCR carried out to verify RNA-seq data from BS-90 maintained at 25C and 32C, then qPCR should also be carried out on BS-90 maintained at 32C. It is valuable to carry out qPCR on susceptible BBO2 but i think it should also be carried out on BS-90 maintained at 32C seeing as original RNA-seq data from BS-90 maintained at 32C. Lines 420-430 mention carrying out qPCR on BS-90 maintained at 32C but earlier in manuscript, and in text following from lines 430 it is not clear when BS-90 maintained at 32C used for qPCR.

Line 457 - BgPiwi described as being highly conserved by amino acid identity around 40% which isn't that high. Would just state that it is conserved.

Reviewer #2: Authors have answered point by point to the several questions that i have raised.

The manuscript can be published

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article's retracted status in the References list and also include a citation and full reference for the retraction notice.

26 Jul 2021

Submitted filename: R2 point-by-point responses to the reviewers.docx

Click here for additional data file.

27 Jul 2021

Dear Dr. Knight,

We are pleased to inform you that your manuscript 'PIWI silencing mechanism involving the retrotransposon nimbus orchestrates resistance to infection with Schistosoma mansoni in the snail vector, Biomphalaria glabrata' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Philip T. LoVerde

Guest Editor

PLOS Neglected Tropical Diseases

Michael Hsieh

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

24 Aug 2021

Dear Dr. Knight,

We are delighted to inform you that your manuscript, "PIWI silencing mechanism involving the retrotransposon nimbus orchestrates resistance to infection with Schistosoma mansoni in the snail vector, Biomphalaria glabrata," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases