Literature DB >> 34469735

Coordination among multiple receptor tyrosine kinase signals controls Drosophila developmental timing and body size.

Xueyang Pan1, Michael B O'Connor2.   

Abstract

In holometabolous insects, metamorphic timing and body size are controlled by a neuroendocrine axis composed of the ecdysone-producing prothoracic gland (PG) and its presynaptic neurons (PGNs) producing PTTH. Although PTTH/Torso signaling is considered the primary mediator of metamorphic timing, recent studies indicate that other unidentified PGN-derived factors also affect timing. Here, we demonstrate that the receptor tyrosine kinases anaplastic lymphoma kinase (Alk) and PDGF and VEGF receptor-related (Pvr), function in coordination with PTTH/Torso signaling to regulate pupariation timing and body size. Both Alk and Pvr trigger Ras/Erk signaling in the PG to upregulate expression of ecdysone biosynthetic enzymes, while Alk also suppresses autophagy by activating phosphatidylinositol 3-kinase (PI3K)/Akt. The Alk ligand Jelly belly (Jeb) is produced by the PGNs and serves as a second PGN-derived tropic factor, while Pvr activation mainly relies on autocrine signaling by PG-derived Pvf2 and Pvf3. These findings illustrate that a combination of juxtacrine and autocrine signaling regulates metamorphic timing, the defining event of holometabolous development.
Copyright © 2021 The Authors. Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  Drosophila; Jak/Stat; PDGF and VEGF receptor-related; Upd; anaplastic lymphoma kinase; metamorphosis; prothoracic gland; prothoracicotropic hormone; receptor tyrosine kinase

Mesh:

Substances:

Year:  2021        PMID: 34469735      PMCID: PMC8428980          DOI: 10.1016/j.celrep.2021.109644

Source DB:  PubMed          Journal:  Cell Rep            Impact factor:   9.423


INTRODUCTION

Body size is one of the most important traits of a multicellular organism. In species whose growth is determinate, the body growth of an individual is largely completed when it matures into an adult (Callier and Nijhout, 2013). A good example of determinate growth is found among holometabolous insects, such as the fruit fly Drosophila melanogaster. During development, the size of a Drosophila larva increases 100-fold during its three molts, but it does not change after metamorphosis, the developmental stage that transitions the juvenile larval form into the sexually mature adult fly. Therefore, the control of metamorphic timing is a key factor that regulates final body size. In the past decades, numerous studies in Drosophila and other holometabolous insect species have demonstrated that the onset of metamorphosis is regulated through a neuroendocrine signaling axis composed of two central information processing nodes: the prothoracic gland (PG), which produces the metamorphosis inducing steroid hormone ecdysone (E), and a bilateral pair of brain neurons, the PG neurons (PGNs), that innervate the PG and release the neuropeptide PTTH that stimulates E production (McBrayer et al., 2007; Yamanaka et al., 2013a, 2015). After release into the hemolymph, E is taken up by peripheral larval tissues through a specific importer (EcI) and then converted into its active form, 20-hydroxyecdysone (20E), by the enzyme Shade (Okamoto et al., 2018; Petryk et al., 2003) Subsequently, 20E stimulates metamorphosis via activation of the EcR/Usp receptor complex and stimulation of tissue-specific downstream transcriptional cascades (Hill et al., 2013). In this scheme, PTTH functions as a trophic hormone to stimulate PG growth and E synthesis (Shimell et al., 2018; Smith and Rybczynski, 2012). In PG cells, PTTH binds to Torso, a receptor tyrosine kinase (RTK) family member, and stimulates the E biosynthetic pathway via Ras/Erk signaling (Rewitz et al., 2009). As the two central nodes on the neuroendocrine axis, both the PG and the PGNs receive additional diverse internal and external signals to modulate their output appropriately. For instance, the PG cells respond to insulin signals reflecting the general nutritional state (Colombani et al., 2005; Mirth et al., 2005). In addition, systemic bone morphogenetic protein (BMP) signals help coordinate metamorphosis with appropriate imaginal disc growth (Setiawan et al., 2018). The PGNs in turn, receive presynaptic inputs from various upstream neurons that regulate circadian and pupation behaviors (Deveci et al., 2019; Imura et al., 2020; McBrayer et al., 2007). They also respond to tissue damage signals to delay maturation onset until the damage is resolved (Colombani et al., 2012, 2015; Garelli et al., 2012, 2015; Vallejo et al., 2015). Although it is widely accepted that PTTH is the key neuropeptide that triggers developmental maturation in holometabolous insects (Deveci et al., 2019; McBrayer et al., 2007; Shimell et al., 2018; Smith and Rybczynski, 2012), several studies indicate that additional timing signals are also likely. The first suggestion that PTTH is not the sole prothoracicotropic signal came from PGN ablation studies in Drosophila where it was found that up to 50% of animals with no PGNs still undergo metamorphosis, but after a prolonged ~5-day developmental delay (Ghosh et al., 2010; McBrayer et al., 2007). Subsequently, it was found that genetic null mutations in the Drosophila PTTH gene only produced a 1-day developmental delay and had little effect on viability (Shimell et al., 2018). In this case electrical stimulation of the mutant PGNs restored proper timing while inactivation produced a more substantial 2-day delay (Shimell et al., 2018). Ptth null mutants have also been generated in Bombyx mori, and while most animals arrest development at late larval stages, a fraction still escape and produce adults (Uchibori-Asano et al., 2017). Taken together, these studies strongly indicated that the PGNs produce additional timing signals besides PTTH. RTK family receptors have been speculated to mediate the additional PGN signal, since blocking the Ras/Erk pathway in the PG causes strong developmental defects, phenocopying the PGN ablation model rather than the ptth mutant (Cruz et al., 2020; Rewitz et al., 2009). Epidermal growth factor receptor (Egfr) has recently been implicated in regulating PG tissue growth, E synthesis, and secretion. However, the Egfr pathway is activated by autocrine signals from the PG, which does not involve the activity of PGNs (Cruz et al., 2020). In the present study, we identify two additional RTK family receptors, anaplastic lymphoma kinase (Alk) and PDGF and VEGF receptor-related (Pvr), which play important roles in the PG controlling metamorphic timing. Interestingly, the Alk ligand Jelly belly (Jeb) and Pvr ligand Pvf3 are both expressed in the PGNs, verifying that the prothoracicotropic function of PGNs is mediated by multiple signaling molecules, while Pvf2 and Pvf3 are also expressed in the PG itself and likely provide additional autocrine signals that also contribute to metamorphic timing control.

RESULTS

Targeted screening of Drosophila RTKs for factors controlling developmental timing

Based on the speculation that RTKs could mediate the trophic signals from PGNs to the PG, we performed a targeted RNAi screening using the PG-specific phm-Gal4 driver to identify RTKs in the PG that regulate the timing of pupariation. Since the knockdown efficiency of the RNAi construct varies, we carried out screening using RNAi lines from the Transgenic RNAi Project (TRiP) and compared the results with recently published genome-wide screening using RNAi lines from the Vienna Drosophila Resource Center (VDRC) (Danielsen et al., 2016). Insulin receptor (InR) and Torso, whose functions in the PG have already been readily documented (Colombani et al., 2005; Mirth et al., 2005; Rewitz et al., 2009), were identified in both screens. In addition, we found Alk and Egfr as hits in our TRiP screen while Pvr was a potential hit in the previous genome-wide screen (Table S1). Since the role of Egfr in the PG has been recently documented (Cruz et al., 2020), we focused our efforts on elucidating the roles of Alk and Pvr in the regulation of metamorphic timing and body size.

Alk and Pvr are required for normal metamorphic timing and body size control

Following the initial screen, we first sought to verify the developmental timing phenotype of Alk and Pvr suppression larvae using multiple RNAi constructs as well as dominant-negative receptors. In line with the screening result, knocking down Alk in the PG using two different RNAi constructs caused developmental delay. Furthermore, overexpressing dominant-negative Alk resulted in developmental arrest in the L3 stage (Figures 1A and S1A). Similarly, the developmental delay phenotype of Pvr suppression larvae was produced by two independent Pvr RNAi constructs, and a third produced developmental arrest. In addition, expression of a dominant-negative Pvr in the PG also produced developmental delay (Figures 1A and S1B).
Figure 1.

Alk and Pvr regulate developmental timing and body size in coordination with PTTH/Torso pathway

(A) Pupariation timing curves and the time of 50% pupariation of phm>w1118, phm>Alk, phm>Pvr, and phm>Alk,Pvr larvae.

(B) Immunofluorescence images of phm>w1118 and phm>Alk,Pvr PGs stained with anti-Alk and anti-Pvr antibodies. Images of phm>w1118 PGs show the changes in Alk and Pvr immunofluorescence signals on the cell membrane, and images of phm>Alk,Pvr PG show that the cytoplasmic signal is non-specific. Dash lines outline the PG area of the ring gland. Scale bar, 50 μm.

(C) Relevant pupal volume changes in animals tested in (A).

(D) Pupariation timing curves and the time of 50% pupariation of phm>w1118, phm>Alk, phm>Pvr, and phm>Alk,Pvr larvae with ptth mutant background. ND, no driver.

(E) Relevant pupal volume changes in animals tested in (D).

(A and C–E) Mean ± SEM; p values by unpaired t test (n = 3 in A and D, n = 17–22 in C and E; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; ns, not significant).

See also Figure S1.

Using immunofluorescence staining, we examined the expression of Alk and Pvr in the PG and tested knockdown efficiency of the RNAi lines used above. In control larvae, strong expression of Alk and Pvr was observed in the PG of late L3 stage larvae, reflected by the distinct fluorescence signals on the PG cell membrane (Figure 1B). Interestingly, the expression of both receptors was remarkably weaker in the early L3 stage (Figure 1B), indicating that the signal outputs from these receptors may be stronger in the late L3 stage when larvae approach the onset of metamorphosis. When expressing Alk and Pvr RNAi (UAS-Alk and UAS-Pvr) (Figures S1A and S1B), we found that the expression of both receptors in the PG was effectively depleted in the late L3 stage (Figure 1B). Since these RNAi constructs induce efficient gene knockdown, we used them in our following studies. When knocking down either Alk or Pvr alone, we observed minor developmental delay. However, simultaneous knockdown of both receptors by phm>Alk,Pvr leads to a more prolonged developmental delay (Figure 1A). Thus, we conclude that both Alk and Pvr act in the PG to regulate metamorphic timing, perhaps in an additive manner. As for the developmental arrest phenotype observed in other crosses (phm>Alk and phm>Pvr) (Figures S1A and S1B), we speculate that they may result from unknown detrimental effects from the transgenes or the genetic background of these lines. In addition to timing, we measured the pupal size of Alk and Pvr suppression animals. The sizes of phm>Alk and phm>Pvr pupae are larger than those of the phm>w1118 controls, while the phm>Alk,Pvr animals formed pupae of even larger sizes (Figure 1C). We conclude that both Alk and Pvr are required in the PG for normal developmental timing and body size control.

Loss of Alk and Pvr causes stronger developmental defects in ptth mutants

The mild developmental delay phenotype of Alk and Pvr suppression animals is comparable to that of ptth mutants (Shimell et al., 2018). Since Alk, Pvr, and Torso are all RTKs, we propose that the Alk and Pvr pathways may function additively or synergistically with the PTTH/Torso pathway to control developmental timing. To test this possibility, we knocked down Alk and Pvr in the PG of ptth mutants and examined whether the timing of pupariation was further prolonged. Consistent with our conjecture, both ptth;phm>Alk and ptth;phm>Pvr larvae took longer to pupariate than the phm-Gal4 and no driver (ND) controls and 30% of ptth;phm>Alk larvae failed to pupariate (Figure 1D). Moreover, longer developmental delay and higher rates of developmental arrest at the L3 stage were observed in ptth;phm>Alk,Pvr larvae in which all three RTK pathways were suppressed (Figure 1D). In parallel to the developmental timing change, the pupal size of double or triple RTK suppression animals were also larger than controls (Figure 1E). These data demonstrate that the Alk and Pvr work in association with PTTH/Torso and suggest that the receptors may share the same downstream signaling pathway to regulate developmental timing.

Alk and Pvr facilitate E synthesis and Halloween gene expression by activating the Ras/Erk pathway

It is well established that PTTH/Torso signaling facilitates pupariation activity by stimulating E synthesis in the PG via Ras/Erk pathway (Rewitz et al., 2009). To determine whether Alk and Pvr function via the same mechanism, we first examined the E level in Alk and Pvr suppression larvae. In mid-L3 stage, we did not observe a significant difference in the E level among phm>w1118, phm>Alk, phm>Pvr, and phm>Alk,Pvr animals. However, at the time point when phm>w1118 larvae are at the wandering stage the receptor suppression larvae produce a markedly lower level of E than phm>w1118 controls (Figure 2A), suggesting that the E synthesis is compromised when Alk and/or Pvr is suppressed in the PG.
Figure 2.

Alk and Pvr facilitate ecdysone synthesis and Halloween gene expression by activating the Ras/Erk pathway

(A) Quantification of ecdysone/20-hydroxyecdysone titers in phm>w1118, phm>Alk, phm>Pvr, and phm>Alk,Pvr larvae at indicated timing stages.

(B) qRT-PCR measurements of Halloween gene expressions in wandering phm>w1118 and age-matched phm>Alk, phm>Pvr and phm>Alk,Pvr larvae.

(A and B) Mean ± SEM; p values by unpaired t test (n = 3 in A, n = 4 in B; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

(C) Immunofluorescence images of spok>w1118, spok>Alk, and spok>Pvr PGs stained with anti-phospho-Erk antibody. Dash lines outline the PG area of the ring gland in the right lane. Enlarged images of the indicated areas are shown in the left lane. To visualize the distribution of fluorescence signals in early L3 spok>w1118 larvae, the brightness is enhanced in the enlarged image. Scale bar, 50 μm.

Ecdysone is synthesized from cholesterol through the action of E biosynthetic enzymes encoded by the Halloween genes (Niwa and Niwa, 2014). To determine how Alk and Pvr affects E synthesis in the PG, we assessed Halloween gene expression in phm>w1118 larvae at the wandering stage and receptor suppression larvae of equivalent age. In phm>Alk, phm>Pvr, and phm>Alk,Pvr larvae, the expression levels of five out of seven Halloween genes (nvd, cyp6t3, phm, dib, sad) were significantly lower than those in the phm>w1118 control (Figure 2B). In addition, the expression of sro was suppressed in phm>Alk,Pvr double suppression larvae, although in phm>Alk or phm>Pvr larvae no significant change was observed compared with phm>w1118 (Figure 2B). These results show that Alk and Pvr signaling regulates E biosynthesis by affecting Halloween gene expression. Previous work has established that both Alk (Englund et al., 2003; Gouzi et al., 2011; Lorén et al., 2001) and Pvr (Learte et al., 2008; Sansone et al., 2015) are able to activate the Ras/Erk pathway in certain Drosophila embryonic and post-embryonic tissues. Thus, we tested whether the two pathways activate Ras/Erk signaling in the PG. Since other RTKs, including Torso and Egfr, also activate Ras/Erk signaling in the PG (Cruz et al., 2020; Rewitz et al., 2009), we speculated that partial suppression of Ras/Erk signaling, if it occurs, could be difficult to detect. To circumvent this possible obstacle, we asked whether we could detect a change in Ras/Erk signaling in Alk and Pvr activation larvae. Unexpectedly, overexpressing Alk or Pvr using the phm-Gal4 driver caused developmental arrest at an early stage (see below), so we employed spok-Gal4, a weaker PG driver for receptor activation/overexpression conditions. To detect the activation level of Ras/Erk signaling, we examined PG immunofluorescence using an antibody that specifically recognizes phosphorylated (phospho-)Erk (Cruz et al., 2020; Ohhara et al., 2015). In spok>w1118 larvae, the Ras/Erk signaling in the PG appears weak in the early L3 stage and is then activated in the middle L3 stage, as indicated by the enhanced overall immunofluorescence signal strength as well as the partial nuclear localization of the signal (Figure 2C). When constitutively activated (CA) Alk or wild-type Pvr was expressed in the PG by spok>Alk and spok>Pvr, respectively, Ras/Erk was strongly activated in the early L3 stage (Figure 2C), indicating that both Alk and Pvr pathways activate Ras/Erk signaling in the PG. This result is consistent with at least partial overlap between Alk, Pvr, and Torso signaling through Ras/ERK activation.

Alk regulates autophagy in the PG by activating the PI3K/Akt pathway

In addition to Ras/Erk, PI3K/Akt is another signaling pathway activated by RTKs (Mele and Johnson, 2019). A well-studied RTK that activates PI3K/Akt signaling in the PG is InR, which conveys nutritional signal to the PG and promotes PG growth (Caldwell et al., 2005; Colombani et al., 2005; Mirth et al., 2005). Interestingly, one study indicates that Alk is also able to activate PI3K/Akt signaling and to compensate the loss of the InR pathway in multiple larval tissues (Cheng et al., 2011). Therefore, we tested whether Alk and Pvr activate PI3K/Akt signaling in the PG. To monitor the activation of PI3K/Akt, we expressed a GFP-tagged PH domain (tGPH), which binds specifically to phosphatidylinositol 3,4,5-trisphosphate (PIP3) produced by activated PI3K on cell membrane. First, we tested whether knocking down either Alk or Pvr causes suppression of the PI3K/Akt pathway. Neither starvation treatment nor the knockdown of Alk or Pvr causes any obvious change in tGPH localization in late L3 stage (24 h after L3 ecdysis [AL3E]) larvae (Figure S2A), perhaps due to the existence of insulin signaling and the slow response of tGPH translocation to the change in PI3K/Akt signaling. To overcome this, we sought to detect activation of PI3K/Akt using early L3 stage (0–4 h AL3E) larvae in which the PI3K/Akt activation level is much weaker than that in the late L3 stage larvae (Ohhara et al., 2015). In the early L3 stage, a comparatively weak level of PI3K/Akt activation was observed in the PGs of spok>w1118 larvae (Figure 3A). The membrane-localized GFP signal was much stronger in the PGs expressing activated InR, consistent with the known capability of InR to activate PI3K/Akt signaling (Weinkove and Leevers, 2000). A comparable strong membrane GFP signal was observed in spok>Alk PG cells (Figure 3A), showing that Alk activation can induce PI3K/Akt signaling in the PG. However, no such signal was identified in spok>Pvr PGs (Figure 3A). Since both InR and Alk activate PI3K/Akt signaling, we sought to determine whether Alk can compensate the loss of InR signaling in the PG. Overexpressing either activated InR or Alk caused precocious pupariation (Figure 3B), suggesting similar activities of the two receptors in the PG. Suppressing InR activity by phm>InR delayed the timing of pupariation, which is effectively rescued by activated Alk (Figure 3B). These results suggest that Alk activates PI3K/Akt signaling and perhaps functions to supplement the InR pathway in the PG.
Figure 3.

Alk regulates autophagy in the PG by activating the PI3K/Akt pathway

(A) Images of spok>w1118, spok>Alk, spok>Pvr, and spok>InR PGs expressing tGPH. Enlarged images of indicated areas are also shown. Scale bar, 50 μm.

(B) Pupariation timing curves of spok>w1118, spok>Alk, spok>InR, spok>InR, and spok>InR,Alk larvae.

(C) Images of phm>w1118, phm>Alk, and phm>Pvr PGs expressing mCherry-Atg8a. Animals were starved at 24 h AL3E for 4 h to induce autophagy. Scale bar, 10 μm.

(D and E) Quantification of the number (D) and the total area (E) of Atg8a-positive puncta per unit of PG cell area.

(F) Images of spok>w1118 and spok>Alk PGs expressing mCherry-Atg8a. Animals were starved at 0–4 h AL3E for 4 h to induce autophagy. Scale bar, 10 μm.

(G and H) The number (G) and total area (H) of Atg8a-positive puncta per unit of PG cell area.

(D–G and H) Mean ± SEM; p values by unpaired t test (n = 5–7; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

See also Figure S2.

Autophagy is a process modulated by PI3K/Akt signaling that has been reported to regulate E biosynthesis by altering cholesterol metabolism in the PG (Pan et al., 2019; Texada et al., 2019). Thus we tested whether Alk suppression affects autophagy induction in the PG. Previously, we have shown that autophagy is strongly induced by starvation in the early, but not the late, L3 stage (Pan et al., 2019). Since Alk is highly expressed in the late L3 stage (Figure 1B), we hypothesized that Alk signaling may be responsible for suppressing autophagy induction during late-stage development. To test this possibility, we analyzed autophagy induction in the PG using phm>mCherry-Atg8a in fed and starved late L3 larvae. By measuring both the number and the area of Atg8a-positive puncta, we found that autophagy is significantly induced in phm>Alk larvae in both the fed and starvation conditions (Figures 3C–3E). Activation of the Alk signal suppressed starvation-induced autophagy in early L3 stage larvae, further confirming the function of Alk on suppressing autophagy (Figures 3F–3H). In contrast, knocking down Pvr in the PG did not affect autophagy induction (Figures 3C–3E), in agreement with the finding that Pvr does not induce PI3K/Akt signaling. Taken together, we conclude that Alk, but not Pvr, suppresses the inducibility of PG autophagy induction in late-stage larvae.

Activation of Alk and Pvr pathways affects developmental timing in a dose-dependent manner

Since suppression of Alk and Pvr delays the timing of pupariation, we tested whether activation of the receptors accelerates developmental timing. Alk and Pvr activation by spok>Alk and spok>Pvr resulted in earlier pupariation and formation of smaller pupae (Figures 4A and 4B), which is consistent with our hypothesis that they contribute to the developmental timing signal. Upon activation of Alk or Pvr in ptth mutants, the developmental delay and larger pupal size caused by the loss of ptth were reversed by Alk and Pvr activation (Figures 4C and 4D), showing that activation of Alk and Pvr can compensate for loss of PTTH/Torso signaling.
Figure 4.

Activation of Alk and Pvr pathway affects developmental timing in a dose-dependent manner

(A) Pupariation timing curves and the time of 50% pupariation of spok>w1118, spok>Alk, spok>Pvr, and spok>Pvr larvae.

(B) Relevant pupal volume changes in animals tested in (A).

(C) Pupariation timing curves and the time of 50% pupariation of spok>w1118, spok>Alk, and spok>Pvr larvae with ptth mutant background.

(D) Relevant pupal volume changes in animals tested in (C).

(E and F) Pupariation timing curves of spok>Alk (E) and spok>Pvr (F) larvae fed with indicated concentrations of RU486.

(G) Pupariation timing curves of phm>w1118, phm>Alk, and phm>Pvr larvae with/without knockdown of Stat92E. To balance the strength of phm-Gal4 driver, a UAS-mCD8GFP transgene was introduced to the groups without UAS-Stat92E.

(A–D) Mean ± SEM; p values by unpaired t test (n = 3 in A and C, n = 16–25 in B and D; **p < 0.01, ***p < 0.001, ****p < 0.0001).

See also Figure S3.

Curiously, when Pvr signaling is further stimulated through expression of CA Pvr (spok>Pvr), many larvae failed to pupariate and the rest pupariated no earlier than did the spok>w1118 controls (Figure 4A). Furthermore, as mentioned above, overexpressing Alk and Pvr using the strong phm-Gal4 PG driver results in developmental arrest before larvae reach the L3 stage. Based on these observations using different Alk/Pvr activation models, we hypothesized that the effect of Alk and Pvr activation on developmental timing is “dose-dependent.” That is, weak/moderate activation of Alk and Pvr causes precocious pupariation, but high-level activation leads to detrimental effects on development. To verify this dose-dependence hypothesis, we employed a spok-Gal4 whose Gal4 driver strength is determined by the concentration of RU486 administration (Roman et al., 2001). In spok>Alk larvae, a low dose of RU486 feeding (0.1 μg/mL) caused earlier pupariation, while a high dose (5.0 μg/mL) led to a high rate of developmental arrest in the L3 stage (Figure 4E). A mid-level dose (1.0 μg/mL) caused a mixed phenotype of precocious pupariation and developmental arrest (Figure 4E), confirming the bi-phasic, dose-dependent effects of Alk activation on developmental timing. Similar results were observed in spok>Pvr larvae, with the only difference being that the mid-level dose RU486 caused a higher rate of developmental arrest (Figure 4F). These data demonstrate that moderate, but not high-level, activation of Alk and Pvr accelerates the timing of pupariation. To explore the mechanism underlying the detrimental effect caused by receptor overactivation, we initially examined PG morphology in the receptor activation larvae. PG tissue overgrowth was found in all spok>Alk, spok>Pvr, and spok>Pvr larvae (Figure S3A). However, only the spok>Pvr PG exhibited uniform cell and nuclear sizes, which was also observed in spok>InR PGs (Figure S3A). In both spok>Alk and spok>Pvr PGs, cells exhibited extensive heterogeneity and loss of normal tissue organization (Figure S3A), reminiscent of the atypical morphology of cancerous tissues. Based on these observations, we speculate that the atypical growth of the PG is likely even worse in phm-Gal4-driven receptor overactivation animals and it produces developmental arrest because of PG cell malfunction or death. Previous studies have shown that simultaneous activation of Ras/Erk and Jak/Stat signaling induces cancerous-like growth in Drosophila larval tissues (Wu et al., 2010). Gain-of-function alleles of Torso have also been found to induce activation of the Jak/Stat pathway during embryonic development (Li et al., 2002). Inspired by these observations, we tested whether Jak/Stat signaling is activated by either Alk or Pvr. Using 10xStat92E-GFP, a reporter of Jak/Stat signaling, we observed remarkably strong GFP signal in spok>Alk, spok>Pvr, and spok>Pvr PGs (Figure S3B), clearly showing that both Alk and Pvr activation can induce Jak/Stat signaling in the PG. Interestingly, spok>Torso did not induce strong Jak/Stat activation in the PG, despite the ability of activated alleles to do so in some embryonic tissues (Figure S3B) (Li et al., 2002), perhaps again indicating that dose is an important factor when considering which downstream pathways can be activated by these different RTKs. We next investigated whether Jak/Stat signaling mediated the developmental defects caused by Alk and Pvr overactivation. We used phm-Gal4 to induce overactivation of the receptors and suppressed the Jak/Stat pathway by UAS-Stat92E. Since UAS-Stat92E could weaken the driver strength of phm-Gal4, we introduced UAS-mCD8GFP in the control groups without UAS-Stat92E to dilute phm-Gal4 strength. Both phm>mCD8GFP,Alk and phm>mCD8GFP,Pvr larvae were arrested at various larval stages before pupariation (Figure 4G). Knockdown of Stat92E did not significantly affect developmental timing by itself. However, the developmental arrest caused by phm>mCD8GFP,Alk and phm>mCD8GFP,Pvr was effectively rescued in phm>Stat92E,Alk and phm>Stat92E,Pvr animals, respectively (Figure 4G). These results demonstrate that Jak/Stat signaling induced by Alk and Pvr overactivation mediates the developmental defects in Alk and Pvr overactivation animals. Since Jak/Stat is very weakly induced in phm>w1118 control animals (Figure S3C), we conclude that Alk and Pvr do not strongly activate Jak/Stat signaling in wild-type animals, but they may do so under certain developmental or environmental conditions.

Ligands that activate Alk and Pvr derive from both PGNs and PG

After confirming the effect of Alk and Pvr on developmental timing and body size control, we sought to determine the source of their ligands that activate the receptors in the PG. Based on our previous observations that ablation of PGNs produces a stronger phenotype than does loss of ptth (Shimell et al., 2018), we speculate that some level of ligand may derive from the PGNs. However, autocrinal regulation pathways have also been discovered in the PG (Cruz et al., 2020; Ohhara et al., 2015), indicating that the ligands may also be produced by the PG itself. Therefore, we tested for ligand expression in both PGs and PGNs. Since Jeb is the only known ligand for Alk (Englund et al., 2003), we first sought to detect jeb expression using fluorescence in situ hybridization (FISH) and found that jeb mRNA is found in the PGNs (Figure S4A). Since the Jeb fluorescence signal in the FISH experiment was weak, we further examined the expression pattern of Jeb by taking advantage of the Minos Mediated Integration Cassette (MiMIC) insertion fly line (jeb) (Nagarkar-Jaiswal et al., 2015) and converting it into a Gal4 expression line (jeb-Gal4) using the recombinase-mediated cassette exchange (RMCE) strategy (Diao et al., 2015; Li-Kroeger et al., 2018). In the jeb>EGFP larvae, we observed jeb expression in numerous larval brain lobe neurons, while no obvious expression was detected in the PG (Figure S4B). By immunostaining using anti-PTTH antibody, we clearly found overlap between the EGFP and the PTTH signals (Figure 5A), showing that jeb is expressed in the PGNs.
Figure 5.

Ligands that activate Alk and Pvr derive from both PGNs and PG

(A and B) Immunofluorescence images of jeb>EGFP (A) and Pvf3>EGFP (B) larval brains stained with anti-PTTH antibody. Arrows indicate the colocalization between the EGFP and PTTH immunofluorescence signals. Scale bars, 20 μm.

(C and D) Images of Pvf2>EGFP (A) and Pvf3>EGFP (B) PGs that have expression of EGFP in Pvf2- and Pvf3-expressing cells. Dash line marks the outline of PG area in the ring gland. Scale bars, 50 μm.

(E) Pupariation timing curves and the time of 50% pupariation of NP423>w1118 and two groups of NP423>jeb larvae.

(F) Relevant pupal volume changes in animals tested in (E).

(G) Pupariation timing curves and the time of 50% pupariation of NP423>jeb and NP423>jeb,Pvf3 larvae with ptth mutant background.

(H) Relevant pupal volume changes in animals tested in (G).

(I) Pupariation timing curves and the time of 50% pupariation of phm>w1118, phm>Pvf2, phm>Pvf3 and phm>Pvf2,Pvf3 larvae.

(J) Relevant pupal volume changes in animals tested in (I).

(E–J) Mean ± SEM; p values by unpaired t test (n = 3 in E and I, n = 16–20 in F and J; *p < 0.05, **p < 0.01).

See also Figure S4.

Unlike Alk, Pvr has three known ligands, Pvf1, Pvf2, and Pvf3. To determine which of the Pvf ligands activate Pvr in the PG, we first tested the viability of null mutants of the three genes. The Pvf2-Gal4 and Pvf3-Gal4 larvae, in which the endogenous Pvf gene expression is disrupted by the T2A cassette insertion (Diao et al., 2015), did not survive into the L3 stage. However, a well-characterized null mutant Pvf1 (Duchek et al., 2001) pupariated without significant delay (Figure S4C). Therefore, we speculate that Pvf2 and Pvf3, but not Pvf1, may be the ligands that interact with Pvr in the PG. Using the T2A-Gal4 lines generated from Pvf2 and Pvf3, we observed Pvf3 expression in the PGNs (Figure 5B), while both Pvf2 and Pvf3 were expressed in the PG (Figures 5C and 5D). Intriguingly, the expression of Pvf2 and Pvf3 in the PG exhibited different temporal patterns. Pvf2 expression is limited in the early L3 stage but surges in the late L3 stage (Figure 5C), while Pvf3 expression is high throughout the L3 stage (Figure 5D). We next tested whether these ligands are required for the effects of Alk and Pvr signaling on pupariation timing control. Using the NP423-Gal4 driver, which is active in the PGNs, (Yamanaka et al., 2013b), we first knocked down jeb or Pvf3 in the PGNs. Depletion of Jeb in the PGNs using two RNAi constructs caused delayed pupariation and enlarged pupal size (Figures 5E and 5F), showing that the activation of Alk in the PG is, at least partially, mediated from the PGN-derived Jeb signal. However, knockdown of Pvf3 in the PGNs did not significantly affect pupariation timing (Figures S4D and S4E), indicating that Pvr signaling does not fully depend on the PGN-derived Pvf3. We then sought to test whether PGN-derived Jeb and Pvf3 function in cooperation with PTTH. Knocking down jeb using NP423-Gal4 in ptth mutants resulted in prolonged developmental delay (Figure 5G) and larger pupal size (Figure 5H), confirming the contribution of the PGN-derived Jeb signal to the control of developmental timing and body size. However, jeb and Pvf3 double knockdown in ptth mutants did not further delay development or affect body size (Figures 5G and 5H), corroborating the minor role of PGN-derived Pvf3 in developmental timing and body size regulation. Next, we suppressed the expression of Pvf2 and Pvf3 in the PG using multiple RNAi constructs. Neither Pvf2 nor Pvf3 knockdown caused a significant delay in developmental timing, except for one Pvf2 RNAi (phm>Pvf2), which resulted in a minor timing delay (Figures S4F–S4I). However, when both ligands were simultaneously knocked down in the PG using phm>Pvf2,Pvf3, we observed significant delay of timing and enlarged pupae compared with phm>w1118 control (Figures 5I and 5J). This result shows that both Pvf2 and Pvf3 likely activate Pvr by an autocrine pathway, although some contribution of PGN-derived Pvf3 cannot be ruled out. Lastly, we examined whether overexpression of the ligands could phenocopy the receptor activation animals. Neither Jeb/Pvf3 overexpression in the PGNs nor Pvf2/Pvf3 overexpression in the PG induced a significant change in the timing of pupariation (Figure S4J–S4M), showing that the activity of the Alk and Pvr pathways in the PG is not solely controlled by expression of the ligands.

DISCUSSION

Multiple RTK signals coordinate in the PG to regulate developmental timing

In previous studies, three RTKs, that is, Torso (Rewitz et al., 2009), InR (Colombani et al., 2005; Mirth et al., 2005), and Egfr (Cruz et al., 2020), have been demonstrated to be crucial in the PG for the control of pupariation and body size. In this work, we identified two additional RTKs, Alk and Pvr, that are also required for proper timing and body size control. Suppression of either Alk or Pvr compromises E synthesis in the PG (Figure 2A), delays pupariation (Figure 1A), and increases pupal size (Figure 1C), while moderate activation of Alk or Pvr accelerates development (Figure 4A). The biological functions of Alk/Pvr in the neuroendocrine pathway are similar to those of the other RTKs (Colombani et al., 2005; Cruz et al., 2020; Mirth et al., 2005; Rewitz et al., 2009), indicating likely signal coordination among the receptors. Downstream signaling from Torso (Rewitz et al., 2009), Egfr (Cruz et al., 2020), Alk, and Pvr (Figure 2C) all involve activation of Ras/Erk signaling, while InR (Mirth et al., 2005) and Alk (Figure 3A) can also stimulate the PI3K/Akt pathway. Consistent with the signaling pathway convergence, suppression of Alk and Pvr simultaneously or suppression of Alk/Pvr in ptth mutants exhibits prolonged delay of developmental timing and larger pupal size (Figures 1A and 1C–1E). In addition, activation of Alk/Pvr rescues the developmental defects of ptth mutants (Figures 4C and 4D), while activated Alk rescues the delay of InRDN overexpression (Figure 3B). In total, both the downstream signaling pathway convergence and the additive effects of receptor activation/suppression support the coordination of signaling among these RTKs. Cellular level coordination of receptor-mediated signals is very common during development. The PG is a good example of this coordination, which integrates a large variety of signals, such as insulin (Colombani et al., 2005; Mirth et al., 2005), PTTH (Shimell et al., 2018), Hedgehog (Palm et al., 2013; Rodenfels et al., 2014), Activin (Gibbens et al., 2011), BMP (Setiawan et al., 2018), serotonin (Shimada-Niwa and Niwa, 2014), and octopamine (Ohhara et al., 2015), to precisely control hormonal output. The coordination among receptors of the same class is of special interest. At least five RTKs (InR, Torso, Egfr, Alk, and Pvr) are expressed in the PG, all of which activate the Ras/Erk pathway (Cruz et al., 2020; Rewitz et al., 2009) (Figures 1B and 2C). Although PTTH/Torso has been considered the key tropic signal for PG function, it appears that three of the other RTKs can partially replace Torso to maintain some level of PG E production (Cruz et al., 2020; this study) Figures 1D and 1E). Loss of either the Torso, Alk, or Pvr signal causes developmental delay but does not block pupariation (Figures 1A and D). Even considering that loss of Egfr in the PG causes arrest at the L3 stage (Cruz et al., 2020), Egfr is still dispensable during the first two molts, which also require production of E pulses by the PG. These observations lead to an open question: why does the PG utilize multiple signals that appear to function redundantly? An obvious possibility is that multiple timing signals provide both robustness and flexibility in response to variable developmental conditions. For example, given a choice of diets, Drosophila larvae chose one that maximizes developmental speed over other life-history traits (Rodrigues et al., 2015). This is not surprising given the ephemeral nature of rotting fruit, a primary food source for Drosophila. Thus, multiple signals may enable larvae to maximize developmental speed. Another possibility is that the different signals contribute to different temporal aspects of the developmental profile. For example, perhaps none of the receptors alone can achieve a strong enough Ras/Erk activation in late-stage larva that meets the demand for the large rise in E production that triggers wandering and initiation of pupation. Interestingly, the expression of Egfr (Cruz et al., 2020), Alk, and Pvr (Figure 1B) all increase remarkably during the late L3 stage when both Halloween gene expression and E synthesis ramps up, suggesting that the three receptors may function as supplements to Torso in order to achieve robust Ras/Erk activation and stimulation of E production. Yet another possibility is that in addition to Ras/Erk signaling, each receptor may induce other downstream pathways. For instance, we have previously reported that regulated autophagy induction in the PG is a key mechanism that prevents precocious non-productive pupation by limiting E availability if larva have not achieved critical weight (CW) (Pan et al., 2019). In that report, we also demonstrated that after CW, autophagy inducibility is greatly repressed. This makes sense from a developmental perspective because if food becomes limiting after CW is achieved, it is likely disadvantageous to slow development down by limiting E production. Therefore, a mechanism to shut down autophagy inducibility after attainment of CW may be beneficial and, in this study, we found that Alk activation is, in part, responsible for shut down of autophagy activation in the PG after the CW nutrient checkpoint has been surpassed (Figures 3C–3E).

Activation of Alk/Pvr pathways results in dose-dependent effects on development via Jak/Stat signaling

Our manipulations of Alk and Pvr, but not Torso, signaling in the PG led to the discovery that Jak/Stat activation can also affect developmental timing (Figure S3B). A distinct feature of Alk and Pvr is that they can exert opposite effects on development likely depending on the activation strength. Weak activation of Alk or Pvr in the PG facilitates pupariation, while strong activation results in the arrest of development at various larval stages (Figures 4E and 4F) due to Jak/Stat activation. Using a weak spok-Gal4 driver led to overgrowth of the PG and to atypical morphology (Figure S3A). Tissue overgrowth is commonly observed when either PI3K/Akt or Ras/Erk is hyperactivated in the PG; however, neither pathway induces atypical morphological change in the overgrown PGs or developmental arrest (Caldwell et al., 2005; Mirth et al., 2005), as we observe when Alk or Pvr are hyperactivated, especially with the strong phm-Gal4 driver. Since suppression of Jak/Stat rescues the developmental arrest caused by phm-Gal4-driven Alk/Pvr hyperactivation (Figure 4G), it appears that Jak/Stat signaling is the key factor that mediates the side effect of Alk/Pvr activation on PG morphology and developmental timing. At lower levels of activation as found in the spok>Alk and spok>Pvr, many larvae still manage to pupariate (Figure 4A), suggesting that larvae can tolerate a certain level of ectopic Jak/Stat signaling caused by Alk/Pvr activation. What goes wrong at a high level of activation of Jak/Stat is still not clear. At present, we do not know what the endogenous late Jak/Stat signal contributes in terms of PG function since knockdown with available reagents did not produce a significant phenotype (Figure 4G). In Drosophila, the canonical Jak/Stat signaling pathway is commonly induced by a group of cytokines including unpaired 1–3 (Upd1–3) via their cognate receptor Domeless (Dome) (Trivedi and Starz-Gaiano, 2018). However, it has also been reported that Torso and Pvr are capable of inducing Jak/Stat activation in some circumstances (Li et al., 2002; Mondal et al., 2011). Although we did not observe induction of Jak/Stat signal by overexpressing wild-type Torso in the PG (Figure S3B), this might be due to a weaker activation using wild-type Torso overexpression versus gain-of-function tor and tor mutants as used in the previous study (Li et al., 2002). Since we observed Dome expression and endogenous activation of the 10xStat92E-GFP reporter in late L3 PGs (Figure S3C), we assume that it is likely to play some role at this stage. Whether the Jak/Stat activation is through Alk/Pvr or via reception of canonical Upd/Dome signals is not clear. Interestingly, note that Upd2 is secreted from the fat body into hemolymph (Rajan and Perrimon, 2012) and therefore may provide a nutrient storage signal to the PG that could be an important regulator of developmental timing, perhaps under certain types of non-standard laboratory growth conditions. It has also been recently demonstrated that inflammation-triggered release of Upd3 acts on the PG to produce developmental delay, indicating that the Jak/Stat pathway may be an important sensor for imbalance of various types of physiological processes (Romão et al., 2021).

Ligands activate Alk/Pvr through both neuronal and autocrine pathways

Since its discovery, PTTH has been recognized as the most important prothoracicotropic neuropeptide that triggers metamorphosis in holometabolous insects (Kawakami et al., 1990; McBrayer et al., 2007; Shimell et al., 2018; Smith and Rybczynski, 2012). In some species, such as Bombyx mori, additional prothoracicotropic neuropeptides such as orcokinin (Yamanaka et al., 2011) and FXPRL-amide peptides (Watanabe et al., 2007) have been discovered; however, PTTH, insulin-like peptides (Ilps), and serotonin (Shimada-Niwa and Niwa, 2014) are the only known brain-derived PG tropic hormones in Drosophila. Nevertheless, analysis of the Drosophila ptth null mutant phenotype verses PGN ablation and PGN electrical manipulation provided evidence that there are other tropic signals derived from the Drosophila PGNs (McBrayer et al., 2007; Shimell et al., 2018). Our observations described herein demonstrate that the Alk ligand Jeb and the Pvr ligand Pvf3 are produced in the PGNs (Figures 5A and 5B). Knockdown of jeb in the PGNs causes delay of pupariation and increased pupal size (Figures 5E and 5F), phenocopying the phm>Alk animals (Figures 1A and 1C) and showing that the PGNs are the major source of Jeb that functions in the PG. Depletion of Pvf3 in the PGNs does not significantly affect developmental timing (Figures S3D and S3E), which is not a surprise since we found that Pvf2 and Pvf3 are also produced in the PG itself (Figures 5C and 5D). Overexpression of Jeb or Pvf3 in the PGNs did not influence timing either (Figures S4J and S4K), indicating that the neural activity of PGNs and/or the temporal regulation of Alk/Pvr expression plays the dominant role in the regulation of signaling by these factors. We also point out that the combined knockdown of both ptth and jeb or ptth, jeb, and Pvf3 in the PGNs still does not produce the ~4- to 5-day developmental delay exhibited by larvae in which the PGNs are ablated (Figure 5G versus Figure 5C in McBrayer et al. [2007]), likely signifying that the additional developmental delay produced by PGN ablation is due to elimination of some other non-RTK-mediated neuropeptide signals. Besides the well-established role of the PGNs in regulating developmental timing and body size, several recent studies also indicate that autocrine signaling within the PG itself provides important developmental regulatory cues. This was first documented for biogenic amine signaling (Ohhara et al., 2015) but more recently was extended to include the RTK Egfr and its ligands Vein and Spitz (Cruz et al., 2020). Interestingly, the expression levels of Vein and Spitz in the PG increase in middle to late L3 and may not contribute to CW determination, but instead they respond to it to form part of a E feedforward circuit that helps ramp up hormone production during late L3 in anticipation of the large pulse that drives pupation (Cruz et al., 2020; Moeller et al., 2013). Similarly, since we observe expression of both Pvf2 and Pvf3 in the late L3 PG (Figures 5C and 5D), and since knockdown of Pvf2 and Pvf3 simultaneously in the PG causes delay of pupariation and larger pupal size (Figure 5I and J), these ligands together with their receptor Pvr also appear to form an autocrine signaling pathway. We and others have also observed expression of Pvf2/3 in other tissues/cell types such as fat body, salivary gland (data not shown), and hemocytes (Parsons and Foley, 2013). Whether these sources also provide some input to the PG is not clear. We also found that overexpression of Pvf2 or Pvf3 did not cause accelerated development (Figures S4L and S4M), which is in stark contrast to the case of Egfr signaling in which overexpression of Vein or Spitz advances pupariation significantly (Cruz et al., 2020). This finding indicates that the activity of Pvr signaling may depend on the expression of Pvr receptor and/or the release of ligands, rather than ligand expression. Endogenous Pvf2 expression is limited to the late L3 stage, yet Pvf3 is constitutively expressed in the L3 stage (Figures 5C and 5D). The biological significance of the differentially regulated Pvf ligand expression is still an open question. It is noteworthy that there are three Pvr isoforms produced by alternative splicing among the exons coding the ligand-binding domain (Cho et al., 2002; Hoch and Soriano, 2003). Thus, reception of different Pvf ligand signals could very much depend on the levels and timing of receptor isoform expression in the PG. Lastly, we note that neither Alk nor Pvr accumulates to substantial levels on the PG membrane until after CW (Figure 1B). Thus, similar to Egfr signaling, their primary functions likely control post-CW events. What regulates the post-CW membrane localization of these receptors is not yet clear, but it is interesting to speculate that the process might be one of the first downstream responses to surpassing the CW checkpoint that prepares the PG gland for a major acceleration in hormone production.

STAR★METHODS

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Michael B. O’Connor (moconnor@umn.edu).

Materials availability

Three T2A-Gal4 fly lines, jeb-Gal4, Pvf2-Gal4 and Pvf3-Gal4, are generated in this study. The request for the fly lines should be directed to the lead contact.

Data and code availability

All data reported in this paper will be shared by the lead contact upon request. This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Flies

Unless noted, all flies were reared on standard agar-cornmeal food supplemented with yeast at 25 °C. Flies were cultured in 12:12 light-dark cycles, however, all experiments were carried out under constant light to avoid the potential impact of circadian cycle on developmental timing. Phm-Gal4 (Ono et al., 2006) and spok-Gal4 (Moeller et al., 2017) was used to drive gene expression specifically in PG cells. NP423-Gal4 (Yamanaka et al., 2013b) was used to drive gene expression in the PGNs. Dome-Gal4 (Ghiglione et al., 2002) (gift from Dr. Norbert Perrimon) was used to examine the expression of Domeless in the PG. Spok-Gal4 (Zeng et al., 2020) was used to drive temporally specific gene expression under control of RU486 administration. A collection of RNAi strains from Transgenic RNAi Project (TRiP) (Ni et al., 2011) were obtained from Bloomington Stock Center (BDSC) and used to carry out the targeted screen of RTKs (see STAR methods). Additional RNAi lines used for gene knockdown were obtained from BDSC, Vienna Drosophila Resource Center (VDRC) and National Institute of Genetics (NIG), Japan. UAS-Alk (Zettervall et al., 2004), UAS-Alk (Bazigou et al., 2007) and UAS-jeb (Varshney and Palmer, 2006) lines (gifts from Dr. Ruth Palmer) were used to manipulate Alk signaling. UAS-Pvr (BDSC #58998), UAS-Pvr (BDSC #58428), UAS-Pvr (BDSC #58431), UAS-Pvf2 and UAS-Pvf3 lines (gifts from Dr. Edan Foley) were used to manipulate Pvr signaling. UAS-Torso and UAS-InR (BDSC #8440) lines were used to manipulate Torso and InR signaling, respectively. tGPH (BDSC #8163) and 10xStat92E-GFP (BDSC #26197) lines were used to monitor activation of Pi3K/Akt and Jak/Stat pathway, respectively. jeb-Gal4, Pvf2-Gal4 and Pvf3-Gal4 lines were generated from jeb (BDSC #36200), Pvf2 (BDSC #32696) and Pvf3 (BDSC #37270), respectively, following recombinase-mediated cassette exchange strategy (Diao et al., 2015) and were used to examine the expression pattern of the corresponding genes. ptth (Shimell et al., 2018) and Pvf1 (BDSC #11450) null mutant lines were also used in the study.

METHOD DETAILS

Developmental timing measurement

Before egg collection, flies were transferred to constant light environment for at least 2 days and all subsequent treatments were carried out under constant light. Eggs were collected on apple juice plates with yeast paste and early L1 larvae were transferred to standard lab fly food with yeast paste after 24 hr. After larvae enter wandering stage, the number of pupa was counted every 6 hours until all larvae pupariated.

Pupal volume measurement

Pupae were picked from vials and imaged under dissection stereoscope. The length (L) and width (W) of pupae were measured using ImageJ software, and the pupal volume (V) was calculated in Microsoft Excel using the following equation, Volumes were then normalized to the average volume of control and the “Δ pupal volumes” were presented in figures.

Fluorescence microscopy

Larvae were dissected in PBS and fixed using 3.7% formaldehyde for 15 mins at room temperature. Tissues were then washed in PBS and mounted in 90% glycerol for imaging. All confocal images were captured using Zeiss LSM710 confocal microscope.

Immunohistochemistry

Larvae were dissected in PBS and fixed using 3.7% formaldehyde for 30 mins at room temperature. Tissues were washed in PBS containing 0.1% Triton X-100 (PBT) for 3 times and then permeabilized and blocked simultaneously using PBT containing 5% normal goat serum (NGS) for 1 hour. Tissues were then incubated with primary antibody (anti-Alk, 1:1000, anti-Pvr, 1:100, anti-phospho-Erk, 1:200) in PBT containing 10% NGS overnight at 4 degrees, followed by 5 washes and then post-secondary incubation for 2 hours at room temperature. DAPI staining occurred for 5 minutes at the pen-ultimate washing step after secondary antibody incubation. Finally, tissues were transferred to 70% glycerol/PBS mounting medium and then mounted on glass slide for imaging. Images were captured using a Zeiss LSM 710 confocal microscope.

Fluorescence in situ hybridization (FISH) of neuropeptide ligands

Preparation of anti-sense probes

The FISH Tag RNA Multicolor Kit (Invitrogen) protocol was used to prepare fluorescence-labeled probes for in situ hybridization. Ptth (Clone ID: IP07658) and jeb (Clone ID: GH16255) were cut and transcribed with Sp6 to make anti-sense message. One μg of amine-modified RNA was labeled with either Alexa Fluor® 488 or Alexa Fluor®®594. The fluorescent-tagged RNA was then fragmented to yield ~300 bp fragments (Kosman et al., 2004), precipitated, and resuspended in hybridization solution (50% formamide, 5x SSC, 50 μg/mL heparin, 100 μg/mL salmon sperm DNA, 0.2% Triton X-100) at a concentration of 10 ng/μL.

In situ hybridization

A mix of early, middle, and late third instar larvae were fixed for 20 minutes, washed with PBTr (PBS + 0.2% Triton X-100), and then treated with 5 μg/mL proteinase K for 5 minutes. After washing with PBTr, the larvae were transitioned to hybridization solution (Kosman et al., 2004) and pre-hybridized for 1 hour at 55°C. Hybridization solution (100 μL) containing fluorescent probes was denatured at 85°C for 3 minutes, chilled on ice, and then added to pre-hybridized larvae. After hybridization at 55°C for 21 hours, larvae were washed 4 times in hybridization solution at 55°C (one of these overnight), transitioned out of hybridization solution to PBTr, washed in PBTr and then placed in 80% glycerol, 20% PBTr for imaging.

Ecdysteroid titer measurement

The ecdysteroid titers of larvae were measured using the 20-hydroxyecdysone Enzyme Immunoassay (EIA) kit (Cayman Chemicals), which detects both ecdysone (E) and 20-hydroxyecdysone (20E). Briefly, frozen larvae were homogenized in methanol and ecdysteroids were extracted as described previously (Warren et al., 2006). The extracts were evaporated in a Speed Vac and the residue resuspended in EIA buffer and analyzed following the manufacturer’s protocol. A standard curve was determined using a dilution series containing a known amount of purified 20E solution provided by the kit. Absorbance at 415 nm was detected using a benchtop microplate reader (Bio-Rad).

Quantitative RT-PCR (qRT-PCR)

Larvae were washed in PBS and then homogenized in Trizol (Invitrogen). Total RNA was purified using RNeasy Mini Kit (QIAGEN) and cDNA library was obtained using SuperScript-III (Invitrogen) following the manufacturer’s protocol. qRT-PCR was then carried out using SYBR Green reagent (Roche) on a LightCycler 480 platform. Rpl23 was used as internal control for normalization. Primers used in this study are listed below. Rpl23 F 5′- GACAACACCGGAGCCAAGAACC –3′ R 5′- GTTTGCGCTGCCGAATAACCAC –3′ nvd F 5′- GGAAGCGTTGCTGACGACTGTG –3′ R 5′- TAAAGCCGTCCACTTCCTGCGA –3′ spok F 5′- TATCTCTTGGGCACACTCGCTG –3′ R 5′- GCCGAGCTAAATTTCTCCGCTT –3′ sro F 5′- CCACAACATCAAGTCGGAAGGAGC –3′ R 5′- ACCAGGCGAATGGAATCGGG –3′ Cyp6t3 F 5′- GGTGTGTTTGGAGGCACTG –3′ R 5′- GGTGCACTCTCTGTTGACGA –3′ phm F 5′- GGATTTCTTTCGGCGCGATGTG –3′ R 5′- TGCCTCAGTATCGAAAAGCGGT –3′ dib F 5′- TGCCCTCAATCCCTATCTGGTC –3′ R 5′- ACAGGGTCTTCACACCCATCTC –3′ sad F 5′- CCGCATTCAGCAGTCAGTGG –3′ R 5′- ACCTGCCGTGTACAAGGAGAG –3′

QUANTIFICATION AND STATISTICAL ANALYSIS

Quantification of autophagic vesicles

The number and area of Atg8a positive vesicles were quantified using imageJ software. Briefly, the vesicles were selected using the “threshold” function. Then the number and total area of the vesicles were calculated automatically using the “analyze particles” function in the software.

Statistics

GraphPad Prism software was used to carry out statistical analyses and Student’s t test was used to determine statistical significance. For all graphs, the numbers of replicates (n values) can be found in the corresponding figure legends. All graphs represent mean values ± SEM, while the p values in the graphs indicate: *p < 0.05, **p < 0.01 ***p < 0.001 and ****p < 0.0001.

KEY RESOURCES TABLE

REAGENT or RESOURCESOURCEIDENTIFIER
Antibodies
AlkGift from Dr. Ruth Palmer, University of Gothenburg, SwedenN/A
PvrGift from Dr. Ben-Zion Shilo, Weizmann Institute, IsraelN/A
phospho-ErkSigma AldrichCat#M8159
Chemicals, peptides, and recombinant proteins
RU486 (Mifepristone)Sigma AldrichCat#M8046
Paraformaldehyde, 16% Aqueous SolutionElectron Microscopy SciencesCat#15700
TRIzol ReagentInvitrogenCat#15596026
SuperScript III Reverse TranscriptaseInvitrogenCat#18080093
Critical commercial assays
20-Hydroxyecdysone EIA KitCayman ChemicalCat#501390
FISH Tag RNA Multicolor KitInvitrogenCat#F32956
RNeasy Mini KitQIAGENCat#74104
Experimental models: Organisms/strains
Drosophila Pvf1 EP1624 BDSCRRID: BDSC_11450
Drosophila Pvf2T2A-Gal4This manuscriptN/A
Drosophila Pvf3T2A-Gal4This manuscriptN/A
Drosophila jebT2A-Gal4This manuscriptN/A
Drosophila ptth 120F2A Shimell et al., 2018 N/A
Drosophila phm-Gal4 Ono et al., 2006 RRID: BDSC_80577
Drosophila spok-Gal4 Moeller et al., 2017 N/A
Drosophila spokGeneSwitch-Gal4 Zeng et al., 2020 N/A
Drosophila NP423-Gal4 Yamanaka et al., 2013b N/A
Drosophila Dome-Gal4 Ghiglione et al., 2002 N/A
Drosophila UAS-Alk CA Zettervall et al., 2004 N/A
Drosophila UAS-Alk DN Bazigou et al., 2007 N/A
Drosophila UAS-jeb Varshney and Palmer, 2006 N/A
Drosophila UAS-Pvr BDSCRRID: BDSC_58998
Drosophila UAS-Pvr CA BDSCRRID: BDSC_58428
Drosophila UAS-Pvr DN BDSCRRID: BDSC_58431
Drosophila UAS-Pvf2 Gift from Dr. Edan Foley, University of Alberta, CanadaN/A
Drosophila UAS-Pvf3 Gift from Dr. Edan Foley, University of Alberta, CanadaN/A
Drosophila UAS-InR CA BDSCRRID: BDSC_8440
Drosophila tGPH BDSCRRID: BDSC_8163
Drosophila 10xStat92E-GFP BDSCRRID: BDSC_26197
Drosophila UAS-Alk RNAi BDSCRRID: BDSC_27518
Drosophila UAS-btl RNAi BDSCRRID: BDSC_40871
Drosophila UAS-Cad96Ca RNAi BDSCRRID: BDSC_55877
Drosophila UAS-CG10702 RNAi BDSCRRID: BDSC_42663
Drosophila UAS-Ddr RNAi BDSCRRID: BDSC_55906
Drosophila UAS-dnt RNAi BDSCRRID: BDSC_67251
Drosophila UAS-drl RNAi BDSCRRID: BDSC_39002
Drosophila UAS-Drl-2 RNAi BDSCRRID: BDSC_55893
Drosophila UAS-Egfr RNAi BDSCRRID: BDSC_25781
Drosophila UAS-Eph RNAi BDSCRRID: BDSC_39066
Drosophila UAS-ht RNAi BDSCRRID: BDSC_35024
Drosophila UAS-InR RNAi BDSCRRID: BDSC_51518
Drosophila UAS-Nrk RNAi BDSCRRID: BDSC_55184
Drosophila UAS-otk RNAi BDSCRRID: BDSC_55869
Drosophila UAS-Pvr RNAi BDSCRRID: BDSC_37520
Drosophila UAS-Ret RNAi BDSCRRID: BDSC_55872
Drosophila UAS-Ror RNAi BDSCRRID: BDSC_62868
Drosophila UAS-sev RNAi BDSCRRID: BDSC_55866
Drosophila UAS-Tie RNAi BDSCRRID: BDSC_54005
Drosophila UAS-tor RNAi BDSCRRID: BDSC_33627
Drosophila UAS-Stat92E RNAi BDSCRRID: BDSC_33637
Drosophila UAS-jeb RNAi BDSCRRID: BDSC_56022
Drosophila UAS-Pvf2 RNAi BDSCRRID: BDSC_61955
Drosophila UAS-Pvf3 RNAi BDSCRRID: BDSC_38962
Drosophila UAS-Alk RNAi VDRCStock #107083; RRID: FlyBase_FBst0478906
Drosophila UAS-Pvr RNAi VDRCStock #43459; RRID: FlyBase_FBst0465099
Drosophila UAS-Pvr RNAi VDRCStock #43461; RRID: FlyBase_FBst0465100
Drosophila UAS-Pvr RNAi VDRCStock #105353; RRID: FlyBase_FBst0477180
Drosophila UAS-jeb RNAi VDRCStock #103047; RRID: FlyBase_FBst0474909
Drosophila UAS-Pvf2 RNAi VDRCStock #7629; RRID: FlyBase_FBst0470770
Drosophila UAS-Pvf3 RNAi VDRCStock #37933; RRID: FlyBase_FBst0462241
Drosophila UAS-Pvf2 RNAi NIGStock #13780R-2
Drosophila UAS-Pvf3 RNAi NIGStock #13781R-1
Software and algorithms
ImageJImageJ-NIH https://imagej.nih.gov/ij/index.html
GraphPad PrismGraphPad Software https://www.graphpad.com/scientific-software/prism/
  70 in total

Review 1.  Roles of PDGF in animal development.

Authors:  Renée V Hoch; Philippe Soriano
Journal:  Development       Date:  2003-10       Impact factor: 6.868

2.  Neuroendocrine control of Drosophila larval light preference.

Authors:  Naoki Yamanaka; Nuria M Romero; Francisco A Martin; Kim F Rewitz; Mu Sun; Michael B O'Connor; Pierre Léopold
Journal:  Science       Date:  2013-09-06       Impact factor: 47.728

3.  Developmental control of blood cell migration by the Drosophila VEGF pathway.

Authors:  Nam K Cho; Linda Keyes; Eric Johnson; Jonathan Heller; Lisa Ryner; Felix Karim; Mark A Krasnow
Journal:  Cell       Date:  2002-03-22       Impact factor: 41.582

4.  A genome-scale shRNA resource for transgenic RNAi in Drosophila.

Authors:  Jian-Quan Ni; Rui Zhou; Benjamin Czech; Lu-Ping Liu; Laura Holderbaum; Donghui Yang-Zhou; Hye-Seok Shim; Rong Tao; Dominik Handler; Phillip Karpowicz; Richard Binari; Matthew Booker; Julius Brennecke; Lizabeth A Perkins; Gregory J Hannon; Norbert Perrimon
Journal:  Nat Methods       Date:  2011-04-03       Impact factor: 28.547

5.  A Membrane Transporter Is Required for Steroid Hormone Uptake in Drosophila.

Authors:  Naoki Okamoto; Raghuvir Viswanatha; Riyan Bittar; Zhongchi Li; Sachiko Haga-Yamanaka; Norbert Perrimon; Naoki Yamanaka
Journal:  Dev Cell       Date:  2018-10-04       Impact factor: 12.270

6.  Anterograde Jelly belly and Alk receptor tyrosine kinase signaling mediates retinal axon targeting in Drosophila.

Authors:  Eleni Bazigou; Holger Apitz; Jana Johansson; Christina E Lorén; Elizabeth M A Hirst; Pei-Ling Chen; Ruth H Palmer; Iris Salecker
Journal:  Cell       Date:  2007-03-09       Impact factor: 41.582

7.  The receptor tyrosine kinase Alk controls neurofibromin functions in Drosophila growth and learning.

Authors:  Jean Y Gouzi; Anastasios Moressis; James A Walker; Anthi A Apostolopoulou; Ruth H Palmer; André Bernards; Efthimios M C Skoulakis
Journal:  PLoS Genet       Date:  2011-09-15       Impact factor: 5.917

8.  An expanded toolkit for gene tagging based on MiMIC and scarless CRISPR tagging in Drosophila.

Authors:  David Li-Kroeger; Oguz Kanca; Pei-Tseng Lee; Sierra Cowan; Michael T Lee; Manish Jaiswal; Jose Luis Salazar; Yuchun He; Zhongyuan Zuo; Hugo J Bellen
Journal:  Elife       Date:  2018-08-09       Impact factor: 8.140

9.  The BMP2/4 ortholog Dpp can function as an inter-organ signal that regulates developmental timing.

Authors:  Linda Setiawan; Xueyang Pan; Alexis L Woods; Michael B O'Connor; Iswar K Hariharan
Journal:  Life Sci Alliance       Date:  2018-11-19

Review 10.  Receptor Tyrosine Kinases in Development: Insights from Drosophila.

Authors:  Sarah Mele; Travis K Johnson
Journal:  Int J Mol Sci       Date:  2019-12-26       Impact factor: 5.923

View more
  4 in total

Review 1.  Endocrine Regulation of Lifespan in Insect Diapause.

Authors:  Corinne Hutfilz
Journal:  Front Physiol       Date:  2022-02-15       Impact factor: 4.566

Review 2.  Transcriptional Regulators of Ecdysteroid Biosynthetic Enzymes and Their Roles in Insect Development.

Authors:  Takumi Kamiyama; Ryusuke Niwa
Journal:  Front Physiol       Date:  2022-02-08       Impact factor: 4.566

3.  Intrinsic and damage-induced JAK/STAT signaling regulate developmental timing by the Drosophila prothoracic gland.

Authors:  Xueya Cao; Marta Rojas; José Carlos Pastor-Pareja
Journal:  Dis Model Mech       Date:  2022-01-26       Impact factor: 5.758

Review 4.  Interorgan communication through peripherally derived peptide hormones in Drosophila.

Authors:  Naoki Okamoto; Akira Watanabe
Journal:  Fly (Austin)       Date:  2022-12       Impact factor: 1.143

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.