Literature DB >> 34449822

The antagonistic mechanism of Bacillus velezensis ZW10 against rice blast disease: Evaluation of ZW10 as a potential biopesticide.

Zuo Chen1,2, Lu Zhao3, Yilun Dong1,2, Wenqian Chen1, Chunliu Li1,2, Xiaoling Gao1,2, Rongjun Chen1,2, Lihua Li1,2, Zhengjun Xu1,2.   

Abstract

Rice blast, caused by the fungus Magnaporthe oryzae, is one of the three major diseases affecting rice production and quality; it reduces rice grain yield by nearly 30%. In the early stage of this study, a strain of Bacillus velezensis with strong inhibition of M. oryzae was isolated and named ZW10. In vitro assays indicated prolonged germination time of conidia of M. oryzae treated with the antifungal substances of ZW10, 78% of the conidia could not form appressorium, and the conidial tubes expanded to form vacuolar structure and then shrank. The results of FDA-PI composite dyes showed that the antifungal substances of ZW10 inhibited the normal activity of M. oryzae hyphae that were rarely able to infect the epidermal cells of rice leaf sheath in vivo tests. In addition, rice treated with the antifungal substances of ZW10 showed a variety of defense responses, including activation of defense-related enzymes, increased expression of the salicylic acid pathway genes, and accumulation of hydrogen peroxide (H2O2), which might function directly or indirectly in resistance to pathogen attack. The field experiment with rice blast infection in different periods showed that the antifungal substances of ZW10 had the same control effect as carbendazim. The significant biological control activity of ZW10 and its capacity to stimulate host defenses suggest that this B. velezensis strain has the potential to be developed into a biopesticide for the biocontrol of rice blast.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34449822      PMCID: PMC8396770          DOI: 10.1371/journal.pone.0256807

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Rice (Oryza sativa L.) is one of the most important food crops in the world, being the staple food of about half of the world population [1]. However, rice blast, a devastating fungal disease caused by Magnaporthe oryzae, causes large losses in rice production and quality worldwide. When the rice blast is prevalent, the rice yield is reduced by 10–30%, and even 40–50% when the disease is severe [2-4]. M. oryzae, similarly to many other plant pathogens, is infecting not only rice, but also other crops, such as barley, wheat, sorghum, corn, and millet [5]. Rice blast affects different tissues of rice at different growth stages, with leaf blast and neck blast being the most common and most harmful [6, 7]. Synthetic fungicides play an important role in the control of rice blast. However, the overuse of synthetic fungicides has led to increasingly serious environmental pollution and potential health problems in humans and livestock, as well as pathogens developing resistance to the fungicides [8]. Hence, identification and use of bio-control agents to manage rice blast disease is gaining importance, with a growing interest in (i) the discovery and development of new and improved fungicides based on natural products that are environmentally friendly as well as (ii) the introduction of alternative measures such as biological control agents to manage plant diseases [9]. So far, a large number of microorganisms have been reported to have an antagonistic effect on rice blast. Gao et al. [10] isolated Streptomyces albidoflavus OsiLf-2 from rice that was antagonistic to M. oryzae. The fermentation filtrate of Bacillus laterosporus BPM3 controlled rice blast [11]. Bacillus cereus REN3 and REN4 isolated from rice rhizosphere and roots promoted rice growth and inhibited some rice pathogenic fungi [12]. B. velezensis, a relatively new species of Bacillus, was discovered in 2005 [13]. In recent years, the research on B. velezensis mainly focused on promoting the growth of animals and plants, induction of systemic resistance, production of antimicrobial substances, antagonism against pathogens, and the underlying mechanisms [14, 15]. B. velezensis FZB42 not only inhibited Rhizoctonia solani directly, but also mediated the defense response in lettuce [16]. Difficidin was purified and identified from the secondary metabolites of B. velezensis AP193, which has the effect of controlling tomato bacterial spot disease [17-19]. Zhang et al. [20] investigated the antifungal effects of non-volatile lipopetides and volatile organic compounds released by B. velezensis C16 on the Alternaria solani. The surfactant A, which was isolated from B. velezensis by Jin et al. [21], had a strong inhibitory effect on Xanthomonas oryzae pv. oryzae. Up to now, there are only a few reports on the control of rice blast by B. velezensis. Previous studies characterized the physical and chemical properties of B. velezensis ZW10 and elucidated its antagonistic activity against M. oryzae [22]. In this paper, we aimed to explore the inhibitory mechanism of B. velezensis ZW10 and the host defense response against M. oryzae, and to evaluate the potential of ZW10 as a biological pesticide.

Materials and methods

Determination of the concentration of antifungal substances

B. velezensis ZW10 was inoculated to 10 L of Landy medium (LM: 20 g glucose, 5 g L-glutamate, 10 g peptone, 1 g KH2PO4, 0.5 g KCl, 0.15 mg FeSO4, 5 mg MnSO4, 0.16 mg CuSO4 in 1 L distilled water) and incubated at 35°C, 180 rpm on a rotary shaker for 72 h. The culture filtrate was extracted successively with 30 L of N-hexane, dichloromethane, ethyl acetate, and N-butanol. Each organic solvent was used for extraction three times. Each organic extract was concentrated to 50 mL using a rotary vacuum evaporator under reduced pressure of 42 mbar at 45°C to detect the antifungal activity. The organic extract with the strongest antifungal activity was chosen for purification using silica gel column chromatography. The mobile phase was CH2Cl2/MeOH at ratios of 100:0, 80:20, 60:40, 40:60, 20:80, and 0:100. The organic extract absorbed on the column was eluted by four column volumes of the mobile phase, then concentrated to 10 mL. The disc containing 9-day-old M. oryzae was placed in the center of PDA (Potato Dextrose Agar) plate, and then 20 μL fractions of crude-extract of fermentation broth (CFB) were added to determine the fraction with an antagonistic effect [23]. The active components were diluted with distilled water, and the half-inhibitory concentration (IC50) of CFB was determined by the plate confrontation method.

Germination test of M. oryzae conidia and formation of appressorium

The GFP-tagged M. oryzae isolate (Guy11-Egfp) was kindly provided by State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China. The conidia were scraped from 9-day-old Guy11-Egfp grown on complete medium (CM: 50 mL 20x nitrate salts, 1 mL trace elements, 10 g D-glucose, 2 g peptone, 1 g yeast extract, 1 g casamino acids, 1 mL vitamin solution, 15 g agar in 1 L distilled water) using the CFB at IC50 and distilled water; the spore concentration was adjusted to approximately 1×105 conidia/mL [24]. Then, 50 μL of spore suspension was dropped on the hydrophobic slide and kept at room temperature. After 2, 8, 12, 24, and 48 h, the germination rate of conidia and the formation of appressorium were observed under a ZEISS fluorescence microscope, with 100 conidia randomly selected for observation. The experiment was repeated three times. The equation to calculate the germination rate was: Germination rate (%) = (A1 / A2) × 100% where A1 = the number of germinated conidia, and A2 = the total number of conidia. The appressorium formation rate was calculated as follows: Formation rate of appressorium (%) = (B1 / B2) × 100% where B1 = the number of conidia that formed appressorium and B2 = the total number of conidia [25].

Determination of M. oryzae mycelial activity

About 1 cm2 agar disk containing mycelium of M. oryzae was put into 100 mL of CM, and cultured at 28°C and 180 rpm for 3 days. The CFB at IC50 was added, and the other group was supplied with the equal amount of sterile water as control. After shaking for 24 h, the mycelia were stripped off M. oryzae cake, stained with FDA-PI composite dye, and treated in darkness at room temperature for 10 minutes [26]. After that, the stained hyphae were washed twice with PBS, sliced and observed under a ZEISS microscope. The antagonistic effect of B. velezensis on the morphological structure of M. oryzae mycelia was observed by scanning electron microscopy (SEM).

Infection of rice leaf sheaths by M. oryzae

After 4 weeks of cultivation in greenhouse, we stripped the sheaths of the second leaf of the seedlings of susceptible rice variety Lijiangxintuanheigu (LTH). The spore suspension was prepared as described above. Then, 200 μL of spore suspension was slowly injected into rice leaf sheath [27]. At 2, 12, 24, and 36 h post-inoculation (hpi), the capacity of conidia to infect leaf sheath was observed under a ZEISS fluorescence microscope.

Defense-related gene expression

The LTH plants were grown in a growth chamber (18 hours of light at 28°C and 6 hours of darkness at 22°C) to the three leaf–stage. First, plants were sprayed with the CFB at IC50 or distilled water with 0.1% Tween 20. After 24 h, plants were inoculated by spraying the conidia suspension (concentration of 1 × 105 conidia / mL) [10]. Rice leaves were collected at 0, 24, 48, and 72 hpi. Total RNA was extracted by the Trizol method, and the quality and quantity of RNA were determined by a Thermofisher Nano DROP. Amplification of cDNA was carried out using a Primescript RT reagent kit (Takara) by following the manufacturer’s instructions. The qRT-PCRs were carried out using a BIO-RAD connect and normalized using OsActin expression levels as the internal reference. The primer sequences of the relevant defense genes and the internal reference gene are shown in Table 1. Real-time PCR was performed with SYBR Premix Ex TaqTM (TransGen Biotech, Beijing, China). All reactions were performed in triplicate.
Table 1

The primer sequences of defense-related genes and internal reference gene.

GeneForward primer (5’-3’)Reverse primer (5’-3’)
OsPR1a GCTACGTGTTTATGCATGTATGGTCGGATTTATTCTCACCAGCA
OsPR5 GGTACAACGTCGCCATGAGCTTGGGCAGAAGACGACTCGGTAG
OsPR10a AATGAGAGCCGCAGAAATGTGGCACATAAACACAACCACAA
OsWRKY45 GCAGCAATCGTCCGGGAATTGCCTTTGGGTGCTTGGAGTTT
OsLYP6 TGCCCAGGACCACATCAGTCCAGGGAAGCCCGGAATAT
OsPAL1 CGAGTTCAACGCCGACACCCGGTAGAGCGGATACGAC
OsPOD GGCCTTGGCAAATACCGACCTCGTGTGTGCTCCTGAGAGA
OsActin GAGTATGATGAGTCGGGTCCAGACACCAACAATCCCAAACAGAG

H2O2 accumulation

The LTH rice plants were treated as described above. For H2O2 accumulation, LTH rice leaves were collected at 0, 24, 48, and 72 hpi and stained with diaminobenzidine (DAB, 1 mg/mL) at pH = 3.8 in the dark for 12 h. The dyed leaves were destained with 95% ethanol until transparent, followed by rinsing in distilled water. The accumulation of H2O2 in leaves was observed under a ZEISS stereomicroscope.

Field trial with the antifungal substances of ZW10 against leaf blast

The control ability of ZW10 against rice blast was studied in Wenjiang District, Chengdu City, Sichuan Province, China (30°68′ N, 103°85′ E). The field was divided into four blocks, each with an area of 1 m2. To avoid the influence of different treatments a thin film was used to separate each plot. Each plot was evenly seeded with 100 seeds of Jiangnanxiangnuo (JNX) rice, and then cultivated for 30 days. The plots were sprayed with 150 mL of water, Landy medium, carbendazim or the CFB at IC50. All the above solutions contained 0.1% Tween 20. After 1 day, each plot was sprayed with 150 mL of the M. oryzae conidia suspension (concentration of 1 × 105 conidia / mL). Seven days after inoculation, 50 rice plants were collected using the five-point sampling method for disease index evaluation. The experiment had three replicates per treatment and was arranged in a randomized complete block design. The disease index was evaluated according to the Standard Evaluation System (SES) for rice [28]. Disease index (%) = ∑ (number of diseased plants in all disease categories × the value of the relevant level) / (total number of investigated plants × highest disease category) × 100.

Field trial with the antifungal substances of ZW10 against neck blast

Field trial design and early rice seedling cultivation were the same as in the leaf blast experiment. When JNX seedlings were in the heading stage, the plots were sprayed with 150 mL water, Landy medium, carbendazim or the CFB at IC50. All the above solutions contained 0.1% Tween 20. After 1 day, each plot was sprayed with 150 mL of the M. oryzae conidia suspension (concentration of 1 × 105 conidia / mL). Thirty days after inoculation, 50 rice panicles were collected using the five-point sampling method for disease index evaluation. The experiment had three replicates per treatment and was arranged in a randomized complete block design. The disease index was evaluated according to the Standard Evaluation System (SES) for rice [28], as specified above.

Statistical analysis

Statistical analysis of the data was evaluated with SPSS 20.0 software. The significant differences among treatment were assessed by one-way analysis of variance (ANOVA), followed by Duncan’s multiple range tests (DMRT) when one-way ANOVA revealed significant differences. The P-Values < 0.05(*) and P-value < 0.01 (**) were considered to indicate statistical significance. All data was expressed as mean standard deviation.

Results

Purifying the fermentation broth of ZW10 and determining its IC50

The fermentation broth was extracted by organic solvents ranging in polarity from weak to strong. The dichloromethane, ethyl acetate and n-butanol extracts had antifungal activity, with ethyl acetate extract being the most active (Fig 1A). The ethyl acetate extract was separated and purified using a silica gel gradient; the activity of 60% MeOH extraction was the strongest (Fig 1B). Therefore, the IC50 of the 60% methanol fraction was determined by gradient dilution. As shown in Fig 1C, the inhibitory activity of the 60% methanol extract was decreasing due to gradient dilution. Finally, the concentration of 1% CFB was IC50.
Fig 1

Isolation and IC50 of active components in the ZW10 cell-free culture filtrate extracted by different organic solvents (a, 1–4: N-hexane extract, dichloromethane extract, ethyl acetate extract, and N-butanol extraction), and the activity of various fractions of ethyl acetate extract in the CH2Cl2/MeOH system (b, 5–10 fractions were: 0% MeOH, 20% MeOH, 40% MeOH, 60% MeOH, 80% MeOH, and 100% MeOH). (c), IC50 of the 60% MeOH extraction against M. oryzae. Data are presented as means of three replicates ± SD. Scale bar, 10 mm.

Isolation and IC50 of active components in the ZW10 cell-free culture filtrate extracted by different organic solvents (a, 1–4: N-hexane extract, dichloromethane extract, ethyl acetate extract, and N-butanol extraction), and the activity of various fractions of ethyl acetate extract in the CH2Cl2/MeOH system (b, 5–10 fractions were: 0% MeOH, 20% MeOH, 40% MeOH, 60% MeOH, 80% MeOH, and 100% MeOH). (c), IC50 of the 60% MeOH extraction against M. oryzae. Data are presented as means of three replicates ± SD. Scale bar, 10 mm.

Effects of the antifungal substances of ZW10 on M. oryzae conidia germination and appressorium formation

The M. oryzae conidia were treated with distilled water or 1% CFB. As shown in Fig 2A, in the control group, the conidia began to produce germ tubes after 2 h. After 8 h, the germ tube elongated and appressorium formed at the other end of the tube. After treatment with 1% CFB, conidia germinated and formed germ tube, but longer time was needed compared with the control group. After 24 h, the hyphae were deformed and the middle part expanded to form vacuoles, followed by increasing the pressure in the vacuole. In the control group, the germination rate of conidia was 88.71 ± 2.01% at 2 h, and levelled off at 97.96 ± 0.42% after 8 h (Fig 2B). Appressorium began to form after 8 h, and the formation rate was 85.42 ± 1.15%, leavlling off at 92.07 ± 0.53% after 12 h. In the treatment group, the germination rate of conidia was only 3.87 ± 1.33% after 2 h, and higher than 90% after 8 h. However, only about 18% of conidia formed a normal appressorium structure (Fig 2C).
Fig 2

Effects of the antifungal substances of ZW10 on M. oryzae conidia germination and appressorium formation.

Morphological changes in conidia of M. oryzae in different periods after 1% CFB of ZW10 treatment (a); germination rate (b) and appressorium formation rate (c) of M. oryzae conidia after ZW10 treatment. Data are presented as means of three replicates ± SD. **, the treatment difference was significant at P<0.01. Scale bar, 10 μm.

Effects of the antifungal substances of ZW10 on M. oryzae conidia germination and appressorium formation.

Morphological changes in conidia of M. oryzae in different periods after 1% CFB of ZW10 treatment (a); germination rate (b) and appressorium formation rate (c) of M. oryzae conidia after ZW10 treatment. Data are presented as means of three replicates ± SD. **, the treatment difference was significant at P<0.01. Scale bar, 10 μm.

Effects of the antifungal substances of ZW10 on M. oryzae membrane permeability and morphology

FDA dye can penetrate cell membrane and accumulate in living cells as green fluorescein, while dead cells are dyed red by PI [26]. The hyphae treated with distilled water showed obvious green fluorescence (Fig 3A). In contrast, the mycelia of M. oryzae treated with 1% CFB were stained with PI, and the red fluorescence was obvious, especially around the vacuoles.
Fig 3

The effect of the antifungal substances of ZW10 on M. oryzae membrane permeability and mycelium morphology.

After the treatment with 1% CFB of ZW10, the permeability of cell membrane was observed by FDA-PI staining (a), and the morphological structure of mycelium was observed by scanning electron microscopy (b). Scale bar in (a): 10 μm, and (b): 5 μm.

The effect of the antifungal substances of ZW10 on M. oryzae membrane permeability and mycelium morphology.

After the treatment with 1% CFB of ZW10, the permeability of cell membrane was observed by FDA-PI staining (a), and the morphological structure of mycelium was observed by scanning electron microscopy (b). Scale bar in (a): 10 μm, and (b): 5 μm. The results of SEM (Fig 3B) showed that the hyphae treated with distilled water had smooth surface. After treatment with 1% CFB, mycelia of M. oryzae showed numerous cavitation structures, with some of them appearing broken; moreover, some hyphae were ruptured.

Effect of the antifungal substances of ZW10 on M. oryzae conidial infection in vivo

In order to analyze the infection of rice by M. oryzae, the leaf sheath of LTH, a susceptible rice variety, was inoculated with M. oryzae, and fluorescence was assessed. During the formation of the specific appressoria structure of M. oryzae, glycerin accumulated in the inner part of the appressoria, resulting in huge swelling in the inner part until the formation of infection points, which allowed M. oryzae to colonize the rice epidermis [29-31]. As shown in Fig 4, at 12 hpi, the appressoria in control group differentiated to form melanin, and the appressoria’s infection points pierced the rice epidermal cells. However, after treatment with 1% CFB, the spores formed germ tubes, but did not form appressoria. At 24 hpi, several secondary hyphae were derived from the inoculated hyphae in the control group and began to infect the adjacent epidermal cells, whereas in the experimental group, vacuoles were formed at the opposite end of the conidia germ tube. At 36 hpi, the vacuoles in the experimental group began to collapse, and the deformed hyphae and shriveled vacuoles were observed in the leaf sheath epidermis.
Fig 4

The antifungal substances of ZW10 were antagonistic to M. oryzae in vivo.

After the treatment with 1% CFB of ZW10 treatment, the capacity of M. oryzae mycospores to infect epidermal cells of leaf sheath was altered. Scale bar, 20 μm.

The antifungal substances of ZW10 were antagonistic to M. oryzae in vivo.

After the treatment with 1% CFB of ZW10 treatment, the capacity of M. oryzae mycospores to infect epidermal cells of leaf sheath was altered. Scale bar, 20 μm.

The antifungal substances of ZW10 enhanced rice resistance to M. oryzae

In most pathogen-plant interactions, systemic acquired resistance (SAR) becomes activated, which confers plants broad-spectrum resistance to persistent pathogen infection [32]. Thus, pathogenesis related proteins (PRs) genes (OsPR1a, OsPR5, OsPR10a), lysin motif-containing protein (LYP) gene (OsLYP6), phenylalanine ammonia-lyase (PAL) gene (OsPAL1), transcription regulation factor (TF) genes (OsWRKY45) and OsPOD gene were tested. OsPR1, OsPR5, OsPR10a, OsPAL1, OsLYP6, and OsWRKY45 are known to be involved in the salicylic acid (SA) signaling pathway [33]. As shown in Fig 5A, the defense genes of rice were activated to varying degrees from 24 hpi to 72 hpi. The expression of defense genes in rice treated with 1% CFB was significantly increased. The peak expression of defense genes occurred at 24 hpi or 48 hpi. The highest expression of SA pathway-related genes was observed at 48 hpi, except for OsPR5, which reached the peak after 24 h. The OsPOD gene reached maximum expression at 48 hpi.
Fig 5

The antifungal substances of ZW10 induced rice capacity to resist M. oryzae.

The expression of relevant defense genes in rice leaves after inoculation with 1% CFB of ZW10 (a), and differential content of H2O2 as indicated by diaminobenzidine (DAB) staining (b). Data are presented as means of three replicates ± SD. Means with different letters have significant differences (P < 0.05). Scale bar, 50 μm.

The antifungal substances of ZW10 induced rice capacity to resist M. oryzae.

The expression of relevant defense genes in rice leaves after inoculation with 1% CFB of ZW10 (a), and differential content of H2O2 as indicated by diaminobenzidine (DAB) staining (b). Data are presented as means of three replicates ± SD. Means with different letters have significant differences (P < 0.05). Scale bar, 50 μm. H2O2 is a relatively stable ROS. When a host is infected by a pathogen, the accumulated H2O2 mediates the programmed cell death (PCD) of infected and surrounding cells [34]. The DAB staining method was used in this experiment, and the results are shown in Fig 5B. The rice leaves treated with fermentation broth gradually accumulated H2O2, reaching maximum at 48 hpi.

Biocontrol efficacy of the antifungal substances of ZW10

Field experiments were conducted to further evaluate the control effect of B. velezensis on rice blast. The results are shown in Fig 6A. In the treatment with 1% CFB, the leaf blast disease index was 17.70 ± 1.89%, which was significantly lower than that of the water (80.30 ± 6.1%) and the Landy culture (79.18±5.8%) treatments. The control efficiency of 1% CFB was similar to that of the carbendazim treatment (17.72 ± 2.38%), a fungicide (Fig 6B).
Fig 6

In the field conditions, the antifungal substances of ZW10 were evaluated regarding control of rice blast.

The outbreak of leaf blast was different in different treatments (a), resulting in significant treatment differences in disease index (b). The treatment effects on the neck blast disease index and its thousand-seed weight (c). Data are presented as means of three replicates ± SD.

In the field conditions, the antifungal substances of ZW10 were evaluated regarding control of rice blast.

The outbreak of leaf blast was different in different treatments (a), resulting in significant treatment differences in disease index (b). The treatment effects on the neck blast disease index and its thousand-seed weight (c). Data are presented as means of three replicates ± SD. Rice neck blast is one of the most important diseases reducing rice yield. As shown in Fig 6C, when JNX rice was treated with 1% CFB or carbendazim at the heading stage, the neck disease indices were 32.57 ± 2.45% and 33.37 ± 3.45%, respectively. These values were lower compared with the water (69.06 ±3.70%) and the Landy medium (69.03 ± 9.19%) treatments. The thousand-seed weight of the 1% CFB treatment was 32.77 ± 2.45g, similar to that of the carbendazim treatment (32.89 ± 2.45 g); in contrast, the thousand-seed weight of the water treatment was 1.88-fold lower (17.43 ±2.92 g).

Discussion

At present, the control of rice blast mainly depends on host resistance and application of pesticides. Due to the variation in M. oryzae strains, the host resistance is non-sustainable [35, 36]. Although chemical control is the dominant strategy, the abuse of pesticides leads to resistance of pathogenic microorganisms and environmental pollution [37]. Therefore, it is an important challenge to seek a sustainable and environmentally friendly control alternatives [38]. Bacillus is potentially the ideal strain for biological control because it is environmentally friendly, easy to obtain, and can produce a variety of polypeptide and lipopeptide antifungal metabolites [39-41]. However, B. velezensis is a new strain discovered in the recent years, and there are few reports on its biological control of M. oryzae. We isolated and identified a strain of B. velezensis from the Sichuan basin neutral purplish soil and named it ZW10; it has antagonistic activity against M. oryzae fungi. Based on silica column chromatography, the 60% methanol fraction was the most active, and the IC50 was 1% CFB. The reason M. oryzae can infect plant epidermis is that conidia germinate and produce germ tubes, which grow and expand, and then differentiate into appressorium [2, 42]. After 1% CFB treatment, the conidia germinated and formed germ tubes, but the germination time was relatively prolonged. At 24 h, only 18.98% of conidia treated by 1% CFB germinated to form appressorium, whereas 95.48% of control conidia formed appressorium. These results indicated that B. velezensis could delay the germination of conidia and inhibit the formation of appressorium. FDA-PI complex dye was used to detect the activity of M. oryzae. It was found that the mycelia treated with 1% CFB showed obvious red fluorescence, especially the deformed mycelia and vacuolar area. In the previous experiment, we found that ZW10 could produce protease, cellulase and chitinase [22]. Therefore, the loss of mycelial permeability caused by 1% CFB treatment of M. oryzae may be related to this. Rong et al. [43] reported a similar phenomenon after treatment with the secondary metabolite (Iturin A) of B. safensis R2. SEM was used to observe that the mycelium of M. oryzae after treatment expanded and that part of the expanded mycelium was broken. At the same time, vacuoles were formed in the middle of the mycelium, and the internal pressure was too high, which led to the rupture of vacuoles and the leakage of cell contents, such as glycerol and trehalose [2]. The blast fungus mechanically breaches the outer plant surface using an appressorium, that generates enormous turgor pressure [3, 44]. And then the appressorium produces a specialized hypha, a penetration peg, which pierces the plant surface [45]. In the experiment with rice sheaths infected by M. oryzae, although 1% CFB treated conidia germinated, they could not form appressoria due to deformations, fractures and formation of vacuoles in germ tubes; hence, they lost the ability to infect rice sheaths. Therefore, we can infer that B. velezensis ZW10 affects the permeability of cell membrane of M. oryzae, leading to cell disruption and death; in addition, it affects the normal growth of mycelium and spore germination, leading to pathological changes and deformities. H2O2 is one of the main biological redox metabolites, whose high concentration induces oxidative damage to biomolecules [46]. Plants can eliminate H2O2 through enzymatic antioxidants such as peroxidases (POXs), catalases (CATs) and superoxide dismutases (SODs), to avoid oxidative damage to cell structures [47]. In this study, 1% CFB significantly promoted the accumulation of H2O2 in the LTH leaf cells, which was consistent with the expression of OsPOD. H2O2 and SA are important signaling molecules in the plant defense system; these two molecules can interact with each other. For example, increasing SA can up- regulate the level of hydrogen peroxide in plant tissues [48]. The systemic acquired resistance (SAR) of rice was induced by 1% CFB spraying. The results showed that the expression of OsPAL1, OsLYP6 and OsPRs was up-regulated. The transcription factor WRKY45 was induced by benzothiadiazole and SA in rice, which helped enhance the host resistance to pathogens [49, 50]. The results showed that the expression trend of OsWRKY45 was similar to that of the genes involved in the SA pathway. By producing antibiotics against plant pathogenic microorganisms and activating rice PTI (PAMP-triggered immunity) response, B. velezensis directly or indirectly protects against rice blast. The rice variety JNX is susceptible to M. oryzae, especially the neck blast. In the field evaluation experiment, leaf blast and neck blast decreased by, respectively, 62.60% and 36.50%, in the 1% CFB treatment, and the thousand-seed weight increased by 188.01%. Hence, using B. velezensis is an effective strategy to prevent and control rice blast and reduce the need to applying fungicides.

Conclusion

In this study, the cell-free culture filtrate of B. velezensis ZW10 was purified. The 1% CFB had a significant antagonistic effect against M. oryzae. The inhibitory mechanism may involve secretion of active metabolites to directly impair the pathogen or indirectly promote the induction of plant innate immunity. In the field experiment, the antifungal substances of ZW10 significantly reduced the incidence of rice blast, and ultimately increased the yield. In conclusion, ZW10 has a potential to be a biological control agent against rice blast. The future research will focus on the isolation and identification of the active metabolites from ZW10 and the systematic evaluation of them as biological control agents that may be used widely in agriculture. In short, B. velezensis ZW10 and its bioactive compounds can be developed as a biopesticide for the biocontrol of rice blast.

Effects of the antifungal substances of ZW10 on M. oryzae’s appressorium formation.

After ZW10 treatment, the appressorium was deformed and did not emit green fluoresce. (TIF) Click here for additional data file.

Germination test of M. oryzae conidia and formation of appressorium.

Row date for Fig 2. (PDF) Click here for additional data file.

Defense-related gene expression.

Row date for Fig 5. (PDF) Click here for additional data file.

Field trial with the antibacterial antifungal substances of ZW10 against leaf blast and neck blast.

Row date for Fig 6. (PDF) Click here for additional data file.

16S rRNA sequence of B. velezensis ZW10.

(PDF) Click here for additional data file. 13 Jul 2021 PONE-D-21-17085 The antagonistic mechanism of Bacillus velezensis ZW10 against rice blast disease and its evaluation as a potential biopesticide PLOS ONE Dear Dr. Xu, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Aug 27 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, R M Sundaram, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free. Upon resubmission, please provide the following: The name of the colleague or the details of the professional service that edited your manuscript A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file) A clean copy of the edited manuscript (uploaded as the new *manuscript* file) 3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 4. Thank you for stating the following financial disclosure: “The author(s) received no specific funding for this work.” At this time, please address the following queries: a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution. b) State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” c) If any authors received a salary from any of your funders, please state which authors and which funders. d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 5. Thank you for stating the following in the Acknowledgments Section of your manuscript: “This work was supported by the Sichuan Science and Technology Program under grant number 2020YJ0352 and grant number 2020YJ0411.” We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: “The author(s) received no specific funding for this work.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. Additional Editor Comments: Based on the comments of the reviewers and based on my own review of the manuscript, I recommend it for a major revision [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Comments on MS No. PONE-D-21-17085 MS title: The antagonistic mechanism of Bacillus velezensis ZW10 against rice blast disease and its evaluation as a potential biopesticide Rice blast caused by Magnaporthe oryzae is one of the most serious diseases of rice causing significant yield loss every year. Extensive work has been done on genetics of blast resistance and several blast resistant rice cultivars are available for commercial cultivation. A large number of highly effective chemicals are also available to manage the disease in the standing crop. However, identification and use of bio-control agents to manage rice blast disease is also equally important. The authors may note the following points Line No. 19: it causes the rice grain yield decreases The author can make: it causes the rice grain yield reduction Line 25: In the in vivo tests most of M. oryzae could not infect The sentence should be modified properly Lines 59-60: In recent years, the research on B. velezensis mainly focused on promoting the growth of animals and plants The authors may provide reference please Line 64: Dai Zhang et al. Should it be only Zhang et al.? Lines 68-70: Previous studies characterized the physical and chemical properties of B. velezensis ZW10 and elucidated its antagonistic activity against M. oryzae. Please provide the reference Line 70: In the paper Authors can make it ‘in this paper’ Line 76: B. velezensis ZW10 was inoculated to Landy medium (10 L) to be cultured at 35 ℃ The authors are requested to make the sentence proper. The authors should also give the composition of Landy medium or any reference which details the Landy medium composition Lines 80-84: The authors mentioned that the ethyl acetate extract had the maximum inhibitory effect against the blast fungus and this extract was then further separated using column chromatography and the running phase CH2Cl2 /MeOH at ratio of 40:60 yielded maximum elution of inhibitory compounds. What is the actual compound which gave the inhibitory activity against blast fungus? Line 91: What was the logic in using GFP-tagged M. oryzae isolate for conidial germination study? Whether the same GFP-tagged M. oryzae isolate was used for field inoculation studies? Line 96: the germination degree of conidia The authors can modify the sentence Lines 107-108: Please give the composition of ‘complete medium’ and any suitable reference. The authors also can mention the objective of this experiment. Is it to know, whether the antagonist produces any cell wall degrading enzymes? Line 115: Infection of rice leaf sheaths by M. oryzae The objective of this experiment is not clear Lines 122-124: Was this experiment was done under glass house condition or inside a plant growth chamber? Whether experiment was done under a particular temperature and RH condition? Whether any treatment was kept with only spraying with CFB (no blast pathogen inoculation)? Line 172: The fermentation broth was extracted by different polar organic solvents But hexane is not a polar solvent Line 189-190: In the treatment group, the germination rate of conidia was only 3.87 ±1.33% after 2 h, and higher than 90% after 8 h. But Figure 2b shows that germination rate did not cross beyond 20% even after 48 hpi. Please check and clarify. Why in Figure 1b Y-axis it is written formation rate? Should it be germination rate? Overall quality of the figure is not good Line 216: The antibacterial substances of ZW10 ….. Should it be antifungal? Figure 5: Pictures/graphs are not clear Lines 224-228: Upregulation of these genes involved in defense was only due to CFB or pathogen inoculation also has some role? The authors could have taken one treatment with only CFB application. Lines 235-243: Application of CFB has drastically reduced the leaf and neck blast severity under field condition and equal to carbendazim. Most of the literatures suggest comparatively lower level of protection by biocontrol agents compared to recommended pesticide. How many sprays of CFB were given? The authors could have repeated the field experiment to confirm exceptionally high level of protection by CFB. Graph showing the neck blast control is not clear. Whether any field trial was taken using the antagonist formulation? Reference # 26 is incompletely cited Line # 414-415: Ref # 33: 33. Ou SH. Pathogen Variability and Host Resistance in Rice Blast Disease. Ann rev phytopathol. 2014; 18(1):167-187. Please check the year. It should be 1980 The manuscript requires improvement in its presentation style and language. Also the authors should suggest practical use of this antagonist. Reviewer #2: Bacillus velezensis is harmless to human being so it should be an excellent candidate as bioagent controlling plant pathogens. The most interesting is that it is widely distributed so will be available easily. But in the present MS there are few issues which are needed for modification. In line no. 44 of introduction you have written which leaf blast and panicle blast are the most common and most harmful: In many places neck blast is emerging in severe form causing massive yield loss. Change the line no 47 as problems in humans and livestock, as well as pathogens are developing resistance to the fungicides instead of resistance to pathogens. Sentence no. 48 & 49 modify the sentence as Therefore, there is a growing interest in the discovery and development of new and improved fungicides based on natural products which are environment friendly as well as the... Pseudomonas aeruginosa magna has sustained: Please check the species name. besides this is not a good example as Pseudomonas aeruginosa can cause infections in the blood, lungs (pneumonia), or other parts of the body after surgery in human. In line no. 57 B. velezensis, a new species of Bacillus, was discovered in 2005: please give reference. the growth of animals and plants , induction of systemic resistance: Please give reference. 92.07 ± 0.53% after 12 h. In the treatment group, the germination rate of conidia was only 3.87 ± 1.33% after 2 h:In case of blast more than 10,000 spores are formed from a single lesion of a susceptible variety and a susceptible variety contain more than 100 lesions in it’s leaf blades so 1.33% also is not less: How do you justify that? normal appressorium structure due to the abnormal germ tube formation (Fig. 2c):How normal appressorium can be formed due to abnormal germ tube formation? Please rectify the sentence. Please modify all the bibliography in similar style like Annual review of microbiology should be written as Annual Review of Microbiology. Journal of Cereal ence or Journal of Cereal Science?? Frontiers in plant science: please change it to maintain uniform style. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Dr. Arup Kumar Mukherjee [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 22 Jul 2021 Dear Editor and Reviewers: Thank you for your letter and for the reviewers’ comments concerning our manuscript entitled “The antagonistic mechanism of Bacillus velezensis ZW10 against rice blast disease and its evaluation as a potential biopesticide” (ID: PONE-D-21-17085). Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in red in the paper. The main corrections in the paper and the responds to the reviewer’s comments are as flowing: Response to the reviewer’s comment: Reviewer #1: 1. Response to comment: Line No. 19: it causes the rice grain yield decreases. Response: We have re-written this part according to the reviewer’s suggestion. 2. Response to comment: Line 25: In the in vivo tests most of M. oryzae could not infect. The sentence should be modified properly. Response: Thanks to the reviewer for pointing out the ambiguous sentences, we have made correction according to the comments. 3. Response to comment: Lines 59-60: In recent years, the research on B. velezensis mainly focused on promoting the growth of animals and plants. The author can make: it causes the rice grain yield reduction. The authors may provide reference please. Response: Considering the reviewer’s suggestion, we have provided references for evidence. 4. Response to comment: Line 64: Dai Zhang et al. Should it be only Zhang et al.? Response: We are very sorry for our incorrect writing. We have corrected it. 5. Response to comment: Lines 68-70: Previous studies characterized the physical and chemical properties of B. velezensis ZW10 and elucidated its antagonistic activity against M. oryzae. Please provide the reference. Response: Thanks to the reviewer for pointing out the problem, we have provided reference. 6. Response to comment: Line 70: In the paper. Authors can make it ‘in this paper’. Response: Thank you, we have corrected it. 7. Response to comment: Line 76: B. velezensis ZW10 was inoculated to Landy medium (10 L) to be cultured at 35 ℃. The authors are requested to make the sentence proper. The authors should also give the composition of Landy medium or any reference which details the Landy medium composition. Response: Considering the reviewer’s suggestion, we have corrected the sentence and elucidated Landy medium formulation. 8. Response to comment: Lines 80-84: The authors mentioned that the ethyl acetate extract had the maximum inhibitory effect against the blast fungus and this extract was then further separated using column chromatography and the running phase CH2Cl2 /MeOH at ratio of 40:60 yielded maximum elution of inhibitory compounds. What is the actual compound which gave the inhibitory activity against blast fungus? Response: Thanks to reviewer for point out the problemq. At present, the experiment of separation of B. velezensis ZW10 secondary metabolites is still under planning, so we are sorry that we could not give a definite reply to the reviewer. Refer to relevant papers, the secondary metabolites of Bacillus were as follows surfactin A[1], iturin A[2], this have significant antagonistic effect on pathogenic fungi. [1]: Jin P, Wang Y, Tan Z, Liu W, Miao W. Antibacterial activity and rice-induced resistance, mediated by C15surfactin A, in controlling rice disease caused by Xanthomonas oryzae pv. oryzae. Pesticide Biochemistry and Physiology. 2020;169:104669. https://doi.org/10.1016/j.pestbp.2020.104669. [2]: Rong S, Xu H, Li L, Chen R, Gao X, Xu Z. Antifungal activity of endophytic Bacillus safensis B21 and its potential application as a biopesticide to control rice blast. Pesticide Biochemistry and Physiology. 2020;162:69-77. https://doi.org/10.1016/j.pestbp.2019.09.003. 9. Response to comment: Line 91: What was the logic in using GFP-tagged M. oryzae isolate for conidial germination study? Whether the same GFP-tagged M. oryzae isolate was used for field inoculation studies? Response: Green fluoresce protein (GFP) derived from Aequoreavic-Victoria has the advantages of stable fluorescence property, convenient observation, non-toxic to cells, non-species-specific and no substrate, which can be used for direct and real-time monitoring of the occurrence, colonization and infection process of pathogenic bacteria. It has become one of the important molecular markers in biochemistry and cell biology [1]. Meanwhile, the transfer of nutrients from M. oryzae spore to appressorium could be monitored in real time by fluorescence labeling [2]. And in field inoculation studies, we used common M. oryzae. [1] Lippincott-Schwartz J. Development and Use of Fluorescent Protein Markers in Living Cells. Science.2003;300(5616):87-91. https://doi.org/10.1126/science.1082520. [2] Zhang HF, Zhao Q, Liu KY, Zhang ZG, Wang YC, Zheng XB. MgCRZ1, a transcription factor of Magnaporthe grisea, controls growth, development and is involved in full virulence. Fems Microbiology Letters. 2010; 293(2):160-169. https://doi.org/10.1111/j.1574-6968.2009.01524.x. 10. Response to comment: Line 96: the germination degree of conidia. The authors can modify the sentence. Response: Thank you, we have corrected it. 11. Response to comment: Lines 107-108: Please give the composition of ‘complete medium’ and any suitable reference. The authors also can mention the objective of this experiment. Is it to know, whether the antagonist produces any cell wall degrading enzymes? Response: Considering the reviewer’s suggestion, we have elucidated Landy medium formulation. In the discussion section, the reason for the result of the experiment is speculated. It is related to the production of protease, cellulase and chitinase by ZW10. 12. Response to comment: Line 115: Infection of rice leaf sheaths by M. oryzae. The objective of this experiment is not clear. Response: The blast fungus mechanically breaches the outer plant surface using an appressorium, that generates enormous turgor pressure [1,2]. And then the appressorium produces a specialized hypha, a penetration peg, which pierces the plant surface [3]. Eventually the plant infected with rice blast. Dear rewiewers, we thought that this experiment is helpful readers to understand the process of dynamic infection of GFP-tagged M. oryzae on rice leaf sheath epidermal cells. And the reason why the GFP-tagged M. oryzae cannot infected after 1% CFB treatment. [1] Howard R. Breaking and entering: host penetration by the fungal rice blast pathogen magnaporthe grisea. Annual Review of Microbiology. 1996; 50(50):491-512. https://doi.org/10.1146/annurev.micro.50.1.491. [2] Talbot NJ. On the trail of a cereal killer: Exploring the biology of Magnaporthe grisea. Annual Review of Microbiology. 2003;57(1):177-202. https://doi.org/10.1146/annurev.micro.57.030502.090957. [3] Prasanna K, Kirk C, Barbara V. Roles for rice membrane dynamics and plasmodesmata during biotrophic invasion by the blast fungus. Plant Cell. 2007;19(2):706-724. https://doi.org/10.1105/tpc.106.046300. 13. Response to comment: Lines 122-124: Was this experiment was done under glass house condition or inside a plant growth chamber? Whether experiment was done under a particular temperature and RH condition? Whether any treatment was kept with only spraying with CFB (no blast pathogen inoculation)? Response: Thanks to the reviewer for pointing out the deficiencies in writing. The LTH plants were grown in plant growth chamber (18 hours of light at 28 ℃ and 6 hours of darkness at 22 ℃). In this experiment, the control group was sprayed with clean water instead of only spraying with 1% CFB. 14. Response to comment: Line 172: The fermentation broth was extracted by different polar organic solvents. But hexane is not a polar solvent. Response: We are very sorry for our incorrect writing. We have corrected it. 15. Response to comment: Line 189-190: In the treatment group, the germination rate of conidia was only 3.87 ±1.33% after 2 h, and higher than 90% after 8 h. But Figure 2b shows that germination rate did not cross beyond 20% even after 48 hpi. Please check and clarify. Why in Figure 1b Y-axis it is written formation rate? Should it be germination rate? Overall quality of the figure is not good Response: Thanks to the reviewer for pointing out the problem. It was caused by an oversight when we processed Fig 2. We have corrected the picture. 16. Response to comment: Line 216: The antibacterial substances of ZW10 … Should it be antifungal? Response: Thank you, we have made correction according to the comments. 17. Response to comment: Figure 5: Pictures/graphs are not clear. Response: We are very sorry for our negligence of the clarity Fig 5. We have corrected the picture. 18. Response to comment: Lines 224-228: Upregulation of these genes involved in defense was only due to CFB or pathogen inoculation also has some role? The authors could have taken one treatment with only CFB application. Response: Plant perception, recognition and response to pathogens are realized by monitoring non self, damaged self and changed self-molecules. Through this mechanism, plants achieve resistance to most pathogens (or potential pathogens) [1]. The experimental design was based on the experimental method of Gao et al. [2]. We hypothesized that these genes might not be activated if they were not inoculated with M. oryzae. [1] Sanabria NM, Huang JC, Dubery, IA. Self/non-self perception in plants in innate immunity and defense. Self/Nonself - Immune Recognition and Signaling 2010; 1(1):40-54. https://doi.org/10.4161/self.1.1.10442. [2] Gao Y, Zeng XD, Ren B, Zeng JR, Xu T, Yang YZ, et al. Antagonistic activity against rice blast disease and elicitation of host-defence response capability of an endophytic Streptomyces albidoflavus OsiLf-2. Plant Pathology. 2020;69(2):259-271. https://doi.org/10.1111/ppa.13118. 19. Response to comment: Lines 235-243: Application of CFB has drastically reduced the leaf and neck blast severity under field condition and equal to carbendazim. Most of the literatures suggest comparatively lower level of protection by biocontrol agents compared to recommended pesticide. How many sprays of CFB were given? The authors could have repeated the field experiment to confirm exceptionally high level of protection by CFB. Graph showing the neck blast control is not clear. Whether any field trial was taken using the antagonist formulation? Response: In the field experiment, 1% CFB, carbendazim, water, and Landy medium were sprayed 24 hours before spraying M. oryzae. Thanks to the reviewer for pointing out the problem in time. This problem was neglected in writing. The field experiment, the evaluation of leaf blast and panicle and neck blast were all repeated for three times. 20. Response to comment: Reference # 26 is incompletely cited. Line # 414-415: Ref # 33: 33. Ou SH. Pathogen Variability and Host Resistance in Rice Blast Disease. Ann rev phytopathol. 2014; 18(1):167-187. Please check the year. It should be 1980. Response: Thank you. We have corrected it. 21. Response to comment: The manuscript requires improvement in its presentation style and language. Also the authors should suggest practical use of this antagonist. Response: Thanks for the reviewer's correction. We have checked our presentation style and language. We have also modified the conclusion to emphasize the application prospect of this antagonist. Reviewer #2: 1. Response to comment: In line no. 44 of introduction you have written which leaf blast and panicle blast are the most common and most harmful: In many places neck blast is emerging in severe form causing massive yield loss. Response: Thanks for the reviewer's valuable suggestions on revision. We confuse the two proper nouns. we have made correction according to the comments. 2. Response to comment: Change the line no 47 as problems in humans and livestock, as well as pathogens are developing resistance to the fungicides instead of resistance to pathogens. Response: Thank you, we have made correction according to the comments. 3. Response to comment: Sentence no. 48 & 49 modify the sentence as Therefore, there is a growing interest in the discovery and development of new and improved fungicides based on natural products which are environment friendly as well as the... Response: Thanks for the reviewer's valuable suggestions on revision. we have made correction according to the comments. 4. Response to comment: Pseudomonas aeruginosa magna has sustained: Please check the species name. besides this is not a good example as Pseudomonas aeruginosa can cause infections in the blood, lungs (pneumonia), or other parts of the body after surgery in human. Response: Thanks to the reviewer's correction, we have deleted this part of content. 5. Response to comment: In line no. 57 B. velezensis, a new species of Bacillus, was discovered in 2005: please give reference. The growth of animals and plants, induction of systemic resistance: Please give reference. Response: Considering the reviewer’s suggestion, we have provided references for evidence. 6. Response to comment: In the treatment group, the germination rate of conidia was only 3.87 ± 1.33% after 2 h. In case of blast more than 10,000 spores are formed from a single lesion of a susceptible variety and a susceptible variety contain more than 100 lesions in it’s leaf blades so 1.33% also is not less: How do you justify that? Response: Thanks for the reviewer's valuable questions. We thought that can be explained by the difference of appressorium activity. As shown in Fig S1, in the control group, appressorium was almost produced after 24 h treatment, and the appressorium also fluoresced. Although few of the ZW10-treated rice blast fungi could produce appressorium, appressorium did not fluorescene, and appressorium (marked) ruptured. Therefore, we hypothesized that appressorium activity decreased after treatment with ZW10. Fig S1. Effects of the antifungal substances of ZW10 on M. oryzae’s appressorium formation. After ZW10 treatment, the appressorium was deformed and did not emit green fluoresce. 7. Response to comment: normal appressorium structure due to the abnormal germ tube formation (Fig. 2c): How normal appressorium can be formed due to abnormal germ tube formation? Response: Thanks to the reviewer for pointing out the ambiguous sentences, we have made correction according to the comments. 8. Response to comment: Please rectify the sentence. Please modify all the bibliography in similar style like Annual review of microbiology should be written as Annual Review of Microbiology. Journal of Cereal ence or Journal of Cereal Science? Frontiers in plant science: please change it to maintain uniform style. Response: Thanks for the reviewer's valuable suggestions on revision. we have made correction according to the comments. We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper. And here we did not list the changes but marked in red in revised paper. We appreciate for Editor and Reviewers’ warm work earnestly, and hope that the correction will meet with approval. Once again, thank you very much for your comments and suggestions. Submitted filename: Response to Reviewers.docx Click here for additional data file. 17 Aug 2021 The antagonistic mechanism of Bacillus velezensis ZW10 against rice blast disease:evaluation of ZW10 as a potential biopesticide PONE-D-21-17085R1 Dear Dr. Xu, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, R M Sundaram, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): I understand that the authors have addressed the concerns/suggestions of the reviewers. In view of this, I recommend the manuscript for publication in PLoS one Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: MS # PONE-D-21-17085R1 MS Title: The antagonistic mechanism of Bacillus velezensis ZW10 against rice blast disease:evaluation of ZW10 as a potential biopesticide Comments The authors have addressed all the queries and incorporated all the corrections and clarifications raised by the reviewers Line # 59: was discovered in 2005[13]. Please give a space between 2005 and [13] Line # 66: antifungal effects of LPs and VOCs released by B. velezensis Please put the full form of LP and VOC Line 68: on Xanthomonas oryzae pv. oryzae pv. will not be in italics Line # 206: broken, and; moreover Please make necessary changes The manuscript may be accepted for publication Reviewer #2: The article is now modified as per the suggestions. The reference also modified. So, it may be considered for acceptance. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Dr. Arup Kumar Mukherjee 19 Aug 2021 PONE-D-21-17085R1 The antagonistic mechanism of Bacillus velezensis ZW10 against rice blast disease:evaluation of ZW10 as a potential biopesticide Dear Dr. Xu: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. R M Sundaram Academic Editor PLOS ONE
  34 in total

1.  Septin-mediated plant cell invasion by the rice blast fungus, Magnaporthe oryzae.

Authors:  Yasin F Dagdas; Kae Yoshino; Gulay Dagdas; Lauren S Ryder; Ewa Bielska; Gero Steinberg; Nicholas J Talbot
Journal:  Science       Date:  2012-06-22       Impact factor: 47.728

2.  Mixtures of plant growth-promoting rhizobacteria enhance biological control of multiple cucumber pathogens.

Authors:  G S Raupach; J W Kloepper
Journal:  Phytopathology       Date:  1998-11       Impact factor: 4.025

3.  Rice WRKY45 plays important roles in fungal and bacterial disease resistance.

Authors:  Masaki Shimono; Hironori Koga; Aya Akagi; Nagao Hayashi; Shingo Goto; Miyuki Sawada; Takayuki Kurihara; Akane Matsushita; Shoji Sugano; Chang-Jie Jiang; Hisatoshi Kaku; Haruhiko Inoue; Hiroshi Takatsuji
Journal:  Mol Plant Pathol       Date:  2011-07-04       Impact factor: 5.663

4.  Characterization and mechanism of anti-Aeromonas salmonicida activity of a marine probiotic strain, Bacillus velezensis V4.

Authors:  Xi-Yan Gao; Ying Liu; Li-Li Miao; Er-Wei Li; Guo-Xiang Sun; Ying Liu; Zhi-Pei Liu
Journal:  Appl Microbiol Biotechnol       Date:  2017-01-10       Impact factor: 4.813

5.  The genome sequence of the rice blast fungus Magnaporthe grisea.

Authors:  Ralph A Dean; Nicholas J Talbot; Daniel J Ebbole; Mark L Farman; Thomas K Mitchell; Marc J Orbach; Michael Thon; Resham Kulkarni; Jin-Rong Xu; Huaqin Pan; Nick D Read; Yong-Hwan Lee; Ignazio Carbone; Doug Brown; Yeon Yee Oh; Nicole Donofrio; Jun Seop Jeong; Darren M Soanes; Slavica Djonovic; Elena Kolomiets; Cathryn Rehmeyer; Weixi Li; Michael Harding; Soonok Kim; Marc-Henri Lebrun; Heidi Bohnert; Sean Coughlan; Jonathan Butler; Sarah Calvo; Li-Jun Ma; Robert Nicol; Seth Purcell; Chad Nusbaum; James E Galagan; Bruce W Birren
Journal:  Nature       Date:  2005-04-21       Impact factor: 49.962

6.  The rice leaf blast pathogen undergoes developmental processes typical of root-infecting fungi.

Authors:  Ane Sesma; Anne E Osbourn
Journal:  Nature       Date:  2004-09-30       Impact factor: 49.962

Review 7.  An overview of global rice production, supply, trade, and consumption.

Authors:  Sumithra Muthayya; Jonathan D Sugimoto; Scott Montgomery; Glen F Maberly
Journal:  Ann N Y Acad Sci       Date:  2014-09-15       Impact factor: 5.691

8.  A comprehensive understanding of the biocontrol potential of Bacillus velezensis LM2303 against Fusarium head blight.

Authors:  Liang Chen; Junying Heng; Suya Qin; Ke Bian
Journal:  PLoS One       Date:  2018-06-01       Impact factor: 3.240

Review 9.  The Roles of Environmental Factors in Regulation of Oxidative Stress in Plant.

Authors:  Xiulan Xie; Zhouqing He; Nifan Chen; Zizhong Tang; Qiang Wang; Yi Cai
Journal:  Biomed Res Int       Date:  2019-05-08       Impact factor: 3.411

10.  The durably resistant rice cultivar Digu activates defence gene expression before the full maturation of Magnaporthe oryzae appressorium.

Authors:  Weitao Li; Ya Liu; Jing Wang; Min He; Xiaogang Zhou; Chao Yang; Can Yuan; Jichun Wang; Mawsheng Chern; Junjie Yin; Weilan Chen; Bingtian Ma; Yuping Wang; Peng Qin; Shigui Li; Pamela Ronald; Xuewei Chen
Journal:  Mol Plant Pathol       Date:  2015-07-14       Impact factor: 5.663

View more
  3 in total

Review 1.  Overview of biofertilizers in crop production and stress management for sustainable agriculture.

Authors:  Parul Chaudhary; Shivani Singh; Anuj Chaudhary; Anita Sharma; Govind Kumar
Journal:  Front Plant Sci       Date:  2022-08-23       Impact factor: 6.627

2.  Characterization of a Bacillus velezensis strain isolated from Bolbostemmatis Rhizoma displaying strong antagonistic activities against a variety of rice pathogens.

Authors:  Jianping Zhou; Yunqiao Xie; Yuhong Liao; Xinyang Li; Yiming Li; Shuping Li; Xiuguo Ma; Shimin Lei; Fei Lin; Wei Jiang; Yong-Qiang He
Journal:  Front Microbiol       Date:  2022-09-28       Impact factor: 6.064

Review 3.  Biological Control of Plant Pathogens: A Global Perspective.

Authors:  Rachid Lahlali; Said Ezrari; Nabil Radouane; Jihane Kenfaoui; Qassim Esmaeel; Hajar El Hamss; Zineb Belabess; Essaid Ait Barka
Journal:  Microorganisms       Date:  2022-03-09
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.