Molecular identification of Theileria equi, Babesia caballi, and Rickettsia in adult ticks from North of Xinjiang, China.

BACKGROUND: Ticks in Xinjiang distribute widely and account for one third of China. Ticks can carry and transmit bacteria, virus, and parasite. However, the research of tick-borne pathogens in Xinjiang is rather little.
OBJECTIVE: To understand the situation of hard tick carry Theileria equi, Babesia caballi and Rickettsia spp. of Zhaosu and Altay in Xinjiang.
METHODS: In this study, 119 tick samples were obtained from horses in Xinjiang, China, Ticks were identified morphologically to determine species and PCR was used to investigate the situation of pathogens by hard ticks.
RESULTS: One hundred and seven belong to Dermacentor marginatus, five belong to D. niveus, and seven belong to D. silvarum. Theileria equi and Babesia caballi were detected in one tick and 18 ticks, respectively. However, the carrying rate of Rickettsia spp. was 51.26% (61/119). Among these, the mixed carriage rate of T. equi and Rickettsia spp. was 0.8% (1/119). The mixed carriage rate of B. caballi and Rickettsia spp. was 10.1% (12/119).
CONCLUSION: Our results revealed that hard tick can carry not only haeimoparasite but also many important zoonotic pathogens in Xinjiang, and this situation was worth heeding.

INTRODUCTION

Infectious diseases are the second most common cause of death worldwide, followed by cardiovascular diseases. Many arthropod vectors are known to transmit infection by ‘vector‐borne diseases’ (René‐Martellet et al., 2017). Both ticks and tick‐borne diseases have affected the animal and human health worldwide (De et al., 2012). Globally, ticks are considered the second most crucial disease vectors after mosquitoes (de la Fuenta et al., 2008). There are a large number of microorganisms that use ticks as a reservoir host, for example, virus, bacteria, spirochete, rickettsia, mycoplasma, chlamydia, protozoan, and nematode (Wu et al., 2013). Most of them are natural reservoirs and cause zoonosis such as forest encephalitis, Lyme disease, haemorrhagic fever, Q fever, typhus fever, pestis, tularaemia, and brucellosis (Aktas et al., 2015, 2005; Iqbal et al., 2013). Among them, rickettsia was also an important pathogen that was transmitted by hard ticks and caused zoonosis (Walker et al., 1998). For prevention against tick‐borne disease, there is a need to develop control strategies and identify pathogens that attack the geographical area by using ticks as a vector (Aktas, 2014).

Equine piroplasmosis is a tick‐borne protozoan disease caused by the haemoprotozoan parasites Theileria equi and Babesia caballi (Salim et al., 2013; Sant et al., 2016; Sezayi et al., 2018). The clinical signs of acute T. equi infection are haemolysis that causes anaemia. However, B. caballi caused anaemia in horses but reported a few cases of acute deaths. Therefore, the failure of multiple organ dysfunction is directly correlated with both systemic formation of microthrombi and disseminated intravascular coagulation (Wise et al., 2013). The sub‐clinical infection related explicitly to the horse‐racing industry where the geographical performance of healthy horses was considered to help the spread of equine piroplasmosis or think that sub‐clinical infection negatively affected the animal's activity (Rampersad et al., 2003).

Rickettsiae are obligate intracellular gram‐negative bacteria , an agent of emerging infectious disease, especially in humans (Raoult et al., 1997). Humans are only occasional hosts for ticks and played a role in the consecutive transmission of bacteria that showed symptoms such as headache, fever, and myalgia (Minichová et al., 2017). Evidence showed 10 types of rickettsioses present in China that were confirmed by isolated pathogens from the patients and performed genetic tests including epidemic typhus, endemic typhus, tsutsugamushi disease, North Asia tick‐borne spotted fever, Inner Mongolia tick‐borne spotted fever, heilongjiangii tick‐borne spotted fever, Q fever, human monocytic ehrlichiosis, Human Granulocytic Ehrlichiosis, and Bartonellosis (Fan, 2005). In China, the tick species that can transmit Rickettsiae are Dermacentor nuttali, D. silvarum, D. sinicus, Haemaphysalis yeh, H. concinna, hyalomma asiaticum, and so forth (Zhang et al., 2005).

In this research, we showed the division of tick‐borne diseases present in Zhaosu and Alytai county and Xinjiang area of China. We collected hard‐ticks from that area, and a polymerase chain reaction (PCR) was conducted to detect the infection of the hard‐ticks with T. equi, B. caballi, and Rickettsia spp.

MATERIALS AND METHODS

Study areas, sampling frame, and collection of ticks

Xinjiang Uygur Autonomous Region of China covers 166 km2 from 34″25′N to 48″10′N latitude and 73″40′E to 96″18E longitudes 155 m and 8611 m altitude. On 19 May 2017, adult ticks were collected from horses in Zhaosu and Alytai and were identified morphologically to determine species. One hundred and nineteen hard ticks were collected from eight horses, 107 were D. marginatus, five were D. niveus, and seven were D. silvarum.

DNA extraction from ticks

The tick samples were removed from 95% ethanol, blotting the ethanol of ticks, and the ticks were washed two times with 1X TE Buffer for 20 min. The ticks and liquid nitrogen were added to a mortar and ground to a fine powder. Genomic DNA was extracted from each tick sample using the TIANamp Genomic DNA Kit (Tiangen Biotech Co., Ltd), dissolved in 70 μl of TE (Tris‐ EDTA) buffer, and stored at −20°C until further use.

Primer synthesis and PCR

All PCR primers are listed in (Table 1). The PCR was conducted in a 25 μl volume consisting of 0.5 μl of the stored DNA templates, 1 μl of every primer (10 μM), 0.5 μl of Phanta Max Super‐Fidelity DNA Polymerase (1 U/μl) (Vazyme Bio Inc.), 12.5 μl of 2× Phanta Max Buffer (Mg2+ plus), 0.5 μl dNTP Mix (10 mM), and 9 μl of nuclease‐free water. All DNA concentrations of all samples examined in this study were diluted to a concentration of 10 ng/μl. The PCR materials were subjected to 1% agarose gel electrophoresis, stained through ethidium bromide, and then pictured under ultraviolet light.

TABLE 1

Sequences of oligonucleotides used for target gene polymerase chain reaction (PCR) amplification

Pathogen	Target	Primer	PCR products size(bp)	Reference
B. caballi	Bc48	GCGACGTGACTAAGACCTTATTGG	451	(Li, 2016)
		GTTCTCAATGTCAGTAGCATCCGC
T. equi	18S	TTTGGGCTGTTTACAGTTGC	531	(Luo, 2012)
		CTCAAAGTAAACGTCGAGTCATG
Rickettsia	16S	ATCAGTACGGAATAACTTTTA	1332	(Anstead, 2013)
		TGCCTCTTGCGTTAGCTCAC

Sequencing analysis and phylogenetic study

A suitable size of DNA pieces produced from PCR was evaluated. The generated sequences were equated to those originally recorded in the NCBI nucleotide database (http://www.ncbi.nlm.nih.gov/nuccore/). Therefore, the multiple sequences were allied, and the phylogenetic tree was created by using MEGA version 6.06, which was designated the extreme likelihood test. Note that 1000 bootstrap repeats evaluated customer support.

RESULTS

One hundred and nineteen hard ticks from horses were tested for the presence of T. equi, B. caballi, and Rickettsia DNA by PCR, of which the infection rate of T. equi was 0.84%, B. caballi was 15.13%, and Rickettsia was 51.26% (Table 2). The majority of collected Dermacentor ticks were D. marginatus 89.9% (107/119).

The nucleotide sequences of Theileria and Babesia spp. were analyzed, and they are depicted in a phylogenetic tree (Figures 1 and  2). We detected one T. equi from D. niveus (ZS‐16) and three B. caballi from D. marginatus (ZS‐10, ZS‐12, ZS‐30), 13 sequences of piroplasmosis 18S rRNA, including T. equi (KP177882, KM046918, MF398476, AB733376, AY534882, KF597077, AB515310, KY464023), T. sergenti (FJ822144), T. ovis (KX989508), B. bigemina (KM046917), B. gibsoni (KC461261), and B. caballi (EU888904) were used in this study. For the 18S rRNA of T. equi, the geographical origins of the gene we chose contain Swiss, Mongolia, Spain, Kenya, Sudan, Brazil, Altai, and Ili from Xinjiang, China. A phylogenic tree of the 18S rRNA gene detected in this study is shown in Figure 1. Our results suggest that the sequences we acquired (ZS‐16), Ili strain, Altai strain, and Swiss strain, are more closely related. Compared with the 18S rRNA of different species, it is not hard to observe that the genera of Babesia were classified into the same cluster and the genera of Theileria were classified into the same cluster compared with different Rap gene of piroplasmosis. The three isolated B. caballi strains were also classified into the same cluster. In other countries, B. caballi strains and Rap gene of different species were present in the independent group (Figure 2). We detected three Rickettsia from D. marginatus (ZS‐2, ZS‐4, ZS‐31), three sequences of Rickettsia raoultii from China (KY474575, MN446749) and France (NR043755), two sequences of R. conorii from China (MF002584) and France (NR074480), one sequence of R. japonica from China (MH722238), one sequence of R. massiliae from China (MF098399), one sequence of R. parkeri from the United States (KY124256), three sequences of R. sibirica from China (KU586293, MF098398) and Japan (NR036848), and three sequences of R. slovaca from China (KJ410262, MF002588) and Pakistan (MN577235) were used in this study. Based on the phylogenetic tree, sequences of Z4, ZS‐2, and ZS‐31 were close to three R. raoultii sequences. The result could evidence that Z4, ZS‐2, and ZS‐31 belonged to R. raoultii (Figure 3).

FIGURE 1

Phylogenetic tree based on nucleotide sequences of the 18S rRNA genes of Theileria and Babesia spp. detected in this study along with reference sequences. This tree was constructed using the neighbour joining method in MEGA version 6.06

FIGURE 2

Phylogenetic tree based on nucleotide sequences of the RAP genes of Theileria and Babesia spp. detected in this study along with reference sequences. This tree was constructed using the neighbour joining method in MEGA version 6.06

FIGURE 3

Phylogenetic tree based on nucleotide sequences of the 16S rRNA genes of Rickettsia spp. detected in this study along with reference sequences. This tree was constructed using the neighbour joining method in MEGA version 6.06

DISCUSSION

Three studies investigating the prevalence of apicomplexan parasites in ticks in China, using molecular methods, have previously been published (Aodungerile et al., 2015; Tuersong et al., 2018; Yi et al., 2014). Yi et al. (2014) tested 303 individual ticks belonging to Rhipicephalus sanguineus and D. nuttalli collected from Guangzhou province and Xinjiang province. The positive rate of B. caballi was 5.9% (18/303). Aodungerile et al. (2015) also collected 347 D. nuttalli from Inner Mongolia and Xinjiang. In their study, the positive rate of B. caballi from Inner Mongolia was 8.16% (12/147), and Xinjiang was 13.5% (27/200). Tuersong et al. (2018) collected 181 D. niveus and found that the carrier rate of T. equi was 7.2% (13/181). These three surveys collected samples in Xinjiang, meaning that Xinjiang is the endemic of equine piroplasmosis. However, the above three studies just focused on one of the pathogens of equine piroplasmosis but still not have been a comprehensive study of the T. equi, B. caballi and Rickettsia spp.

As the early report, equine piroplasmosis was transmitted by the genera of Boophilus, Hyalomma, Dermacentor, and Rhipicephalus (Alhassan et al., 2007). B. microplus, H. uralense, R. evertsi mimeticus, and R. pulchellus can transmit T. equi, D. ralbipictus, D. nitens, D. silvarum, D. reticulates, and H. truncatum. H. volgense can transmit B. caballi. T. equi and B. caballi can be transmitted by D. marginatus, D. nuttallis, D. pictus, D. variabilis, H. anatolicum, H. marginatum, H. dromedarii, R. bursa, R. evertsi evertsi, and R. sanguineus (Rothschild, 2013). In this scenario, we studied that D. marginatus could carry T. equi, B. caballi, and Rickettsia; D. silvarum could carry Rickettsia; D. niveus could carry B. caballi and Rickettsia. The research conducted by Tuersong showed that D. niveus could also carry T. equi. Unfortunately, we did not detect the gene of T. equi from D. niveus, this might be due to the small numbers of D. niveus.

In conclusion, this is the report describing the presence of T. equi, B. caballi, and Rickettsia in ticks in Xinjiang, China. Interestingly, our results indicated that D. niveus could also carry B. caballi. Our results also suggest that Rickettsia was more prevalent in Xinjiang than previously thought. Although we couldnot confirm that these ticks are biological vectors of equine piroplasmosis and Rickettsia, a high infection rate of equine piroplasmosis in Xinjiang and the presence of Rickettsia show we should find out ways to prevent tick‐borne disease as soon as possible.

AUTHOR CONTRIBUTION

Yang Zhang: Conceptualization, Investigation, Writing‐original draft, Writing‐review & editing; Xiu Wen: Data curation, Software; Pei Xiao: Investigation; Xinli Fan: Investigation; Min Li: Investigation; Bayin Chahan: CRediT contribution not specified.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

ETHICS STATEMNET

The authors confirm that the ethical policies of the journal, as noted on the journal's author guidelines page, have been adhered to. The experiments conducted in this research were according to the Laboratory Animal‐Guideline for ethical review of animal welfare (GB/T 35892‐2018).

PEER REVIEW

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.613.

TABLE 2

Results of infected T. equi, B. caballi and Rickettsia from different ticks

Collection area	Tick species	Number	T. equi	B. caballi	Rickettsia
Zhaosu	D. marginatus	107	1 (0.93%)	17 {15.89%)	56 (52.34%)
	D. niveus	2	0	0	1 (50%)
Altai	D. silvarum	7	0	0	3 (42.86%)
	D. niveus	3	0	1 (33.33%)	1 (33.33%)
Total	Hard tick	119	1)0.84%(	18 (15.13%)	61 (51.26%)