Literature DB >> 34432209

Distinct interferon response in bat and other mammalian cell lines infected with Pteropine orthoreovirus.

Ronald Tarigan1, Tetsufumi Katta1, Hitoshi Takemae1, Hiroshi Shimoda2, Ken Maeda3, Atsuo Iida1, Eiichi Hondo4.   

Abstract

Bats serve as natural hosts of Pteropine orthoreovirus (PRV), an emerging group of bat-borne, zoonotic viruses. Bats appear to possess unique innate immune system responses that can inhibit viral replication, thus reducing clinical symptoms. We examined the innate immune response against PRV and assessed viral replication in cell lines derived from four bat species (Miniopterus fuliginosus, Pteropus dasymallus, Rhinolophus ferrumequinum, and Rousettus leschenaultii), one rodent (Mesocricetous auratus), and human (Homo sapiens). The expression levels of pattern recognition receptors (PRRs) (TLR3, RIG-I, and MDA5) and interferons (IFNB1 and IFNL1) were higher and PRV replication was lower in cell lines derived from M. fuliginosus, R. ferrumequinum, and R. leschenaultii. Reduction of IFNB1 expression by the knockdown of PRRs in the cell line derived from R. ferrumequinum was associated with increased PRV replication. The knockdown of RIG-I led to the most significant reduction in viral replication for all cell lines. These results suggest that RIG-I production is important for antiviral response against PRV in R. ferrumequinum.
© 2021. The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature.

Entities:  

Keywords:  Bat; Interferon; Pattern recognition receptor; Pteropine orthoreovirus

Mesh:

Substances:

Year:  2021        PMID: 34432209      PMCID: PMC8386163          DOI: 10.1007/s11262-021-01865-6

Source DB:  PubMed          Journal:  Virus Genes        ISSN: 0920-8569            Impact factor:   2.332


Introduction

Bats are well recognized as natural hosts of multiple highly pathogenic zoonotic viruses, such as Marburg virus [1], SARS-CoV [2], MERS-CoV [3], Hendra virus [4], Nipah virus [5], and Ebola virus [6]. Viral transmission to humans directly from bats or via other animals as intermediate hosts has occurred previously, causing fatal outbreaks in humans and suggesting an important role of bats in disease transmission [1, 7–9]. Pteropine orthoreoviruses (PRVs) are bat-borne viruses (family Reoviridae, genus Orthoreovirus). The genomes of these viruses contain ten double-stranded RNA (dsRNA) segments. The first PRV to be isolated, Nelson Bay orthoreovirus (NBV; previously known as Nelson Bay virus), was isolated from the gray-headed flying fox (Pteropus poliocephalus) in Australia in 1968 [10]. Since then, PRVs have been isolated from some frugivorous and nectarivorous bats in Malaysia, Indonesia, Philippines, and China [11-14]. Viral transmission from bats to humans occurs in these regions, as revealed by viral isolation from people living near bat roosts in Malaysia and by serological studies conducted in Malaysia, Vietnam, and Singapore [15-18]. Non-fatal imported cases of PRV have been reported in Japan and Hong Kong in patients presenting with an acute respiratory syndrome, who had previously traveled to Bali and Indonesia [19, 20]. Notably, the virulence of PRV may be altered by the process of reassortment, much like the influenza virus [21]. It is speculated that bats, as the natural hosts of PRVs, do not show the same clinical symptoms as those observed in humans and mice [22, 23]. The limited clinical symptoms observed in bats after experimental infection with highly pathogenic viruses such as Nipah virus, Ebola virus, and MERS-CoV suggest an innate immune response peculiar to bats [24-26]. The innate immune response against dsRNA viruses is initiated upon sensing by pattern recognition receptors (PRRs), which stimulate the production of interferons (IFNs) and cytokines [27]. The PRRs for dsRNA are toll-like receptors-3 (TLR3), retinoic acid-inducible gene-I (RIG-I), and melanoma differentiation-associated protein 5 (MDA5); these are highly expressed in bat cell lines and promote greater IFN stimulation as part of the bat antiviral response than that observed in other mammalian cell lines [28-30]. We hypothesize that an increased IFN response is responsible for suppressing PRV in bat cell lines. Here, we examine the IFN response in cell lines derived from four bat species (Miniopterus fuliginosus, Pteropus dasymallus, Rhinolophus ferrumequinum, and Rousettus leschenaultii), from human (Homo sapiens), and from Syrian hamster (Mesocricetous auratus). The bat cell lines used in this study have been utilized for analysis of Ebola and Marburg virus [31], encephalomyocarditis and Japanese encephalitis viruses [30], Lloviu virus [32, 33], bat-derived influenza virus [34], and African bat mumps virus [35].

Materials and methods

Cell lines and viruses

The cell lines BHK-21 (Syrian hamster, kidney), HEK293T (human, kidney), FBKT1 (Ryukyu flying fox, P. dasymallus, kidney), DEMKT1 (Leschenault’s rousette, Rousettus leschenaultii, kidney), BKT1 (Greater horseshoe bat, R. ferrumequinum, kidney), YUBFKT1 (Eastern bent-wing bats, M. fuliginosus, kidney), and Vero JCRB9013 (African green monkey, Cercopithecus aethiops, kidney) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM; Nissui, Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, USA), 2% L-Glutamine (Sigma, Milwaukee, Wisconsin, USA), 0.14% sodium hydrogen carbonate (NaHCO3; Sigma, Milwaukee, USA), and penicillin–streptomycin (Meiji, Tokyo, Japan) at a final concentration of 100 U/mL and 0.1 μg/mL. The bat kidney cell lines were established as previously described [32, 36]. The PRV used in this study, strain Garut-50 (PRV50G), was isolated from a rectal swab of a greater flying fox (Pteropus vampyrus) from Garut Regency, West Java Province, Indonesia. PRV50G was propagated in Vero JCRB9013 cells, and the viral titer was measured by plaque assay.

Detection of virus RNA and host-factor mRNA in the cells

The cells were seeded at a concentration of 5 × 105 cells/well in a 6-well plate to obtain 50–80% confluency in most of the cells in 24 h. Cells were infected with PRV50G at a multiplicity of infection (MOI) of 0.1 in a Biosafety Level 2 laboratory. The RNA copy number of inoculating virus is 1.78 × 104 viral RNA copy number/well. The viruses were allowed to adsorb onto the cells for 2 h in DMEM medium containing 2% FBS. The inoculum was removed and the cells were rinsed twice with DMEM medium containing 2% FBS to remove the residual inoculum. Then, fresh DMEM medium containing 2% FBS was added to the cells. This virus infection method was used in all assays. RNA extraction was performed using ISOGEN II (Nippon Gene, Japan), and RNA clean-up was performed using RNeasy Mini Kit (QIAGEN, Hilden, Germany). First-strand cDNA synthesis was performed using ReverTra Ace (Toyobo, Osaka, Japan). The expression levels of TLR3, RIG-I, MDA5, IFNB1, IFNL1, TNF-α, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, housekeeping gene) in mock- and PRV50G-infected cells were determined by qRT-PCR. The primer sequences are listed in Supplementary Table 1. The Roche LightCycler 96 system (Roche, Mannheim, Germany) was used in conjunction with Thunderbird SYBR qPCR Mix (Toyobo, Osaka, Japan) per the manufacturer’s instructions. For qRT-PCR, after the pre-denaturation step (95 °C, 60 s), three-step cycling was performed at 95 °C/60 s, 55 °C/30 s, and 72 °C/30 s for 40 cycles. Melting curve analysis was performed at 95 °C/10 s, 60 °C/60 s, and 97 °C/1 s to generate the dissociation curve. Relative expression level is expressed as reciprocal of ΔCt (the PCR cycle at which the product is measurable and normalized to Ct for GAPDH) [37]. The relative fold change in gene expression between two groups of cells (infected/mock) was calculated after normalizing the Ct values using the value for GAPDH. For comparative quantitative analysis of viral genome copies, absolute quantification was performed with specific primers for the S4 segment (5′- TTGGATCGAATGGTGCTGCT, 5′- TCGGGAGCAACACCTTTCTC) with target nucleotides (256–415) of the S4 genome segment of PRV50G (GenBank accession number LC494117.1) and has expected size of PCR amplicon 159 bp. PCR-amplified fragments were serially diluted and used for the creation of standard curves. The exact number of copies was calculated using the standard curve.

Cell viability assay

Cells were seeded at a concentration of 5 × 104 cells/well in a 24-well plate and were infected with PRV50G at MOI of 0.1. Both mock- and PRV50G-infected cells were washed with PBS and were harvested using 0.25% Trypsin–EDTA (Gibco, Ontario, Canada) at 1, 2, 3, 4, 5, 6, and 7 days post-infection (dpi). Assessment of cell growth (cell viability and total live cell numbers) was carried out by trypan blue dye exclusion test. Cell suspensions were mixed with an equal volume of 0.4% trypan blue solution (Chroma-Gesellschaft Schmid, Stuttgart, Germany). Unstained or live cells were counted using the automated Cell Counter model R1 (Olympus, Tokyo, Japan). Relative viabilities of PRV50G-infected cells are shown as the ratio between the live cell numbers of PRV50G-infected cells and mock-infected cells on the same days. Relative viabilities of viral-infected cells are shown as % of mock-infected cells.

Knockdown of pattern recognition receptors and TNF-α

Phosphorothioate antisense RNA oligonucleotide (s-oligo) against TLR3 (5′-GCACAAUUCUGGCUCCAGUTT-3′), RIG-I (5′-AUCUGAGAAGGCAUUCAACTT-3′), and MDA5 (5′-UGACACUUCCUUCUGCCAATT-3′) of three bat species (R. ferrumequinum, R. leschenaultii, and M. fuliginosus), human TNF-α (5′-GGCGUGGAGCUGAGAGAUA-3′), and negative control s-oligo (5′-GGUUCGUACGUACACUGUUCATT-3′) designated from the sequence of Arabidopsis thaliana were synthesized by FASMAC Co., Ltd. (Kanagawa, Japan). Three bat cell lines (BKT1, DEMKT1, and YUBFKT1) and HEK293T were transfected with the antisense RNA oligonucleotides (120 pmol) using polyethylenimine [38]. After verification of remarkably decreased expression level of PRRs and TNF-α in each cell line by qRT-PCR 2 days after gene knockdown, the knockdown cells were infected with PRV50G at an MOI of 0.1. RNA extraction and first-strand cDNA synthesis using 500 ng of total RNA, quantified by nanodrop, were performed at 1 dpi. The expression levels of TLR3, RIG-I, MDA5, IFNB1, IFNL1, TNF-α, and GAPDH and viral copy numbers in both mock- and PRV50G-infected cells were determined by qRT-PCR.

Statistical analysis

All statistical analyses were performed using Prism software (version 9.0, GraphPad Software Inc.). Significant statistical differences were calculated by two-tailed Mann–Whitney U test or one-way ANOVA followed by Dunnett’s test. P < 0.05 was considered statistically significant.

Results

Cytopathic effect of PRV50G in cell lines

As PRVs are fusogenic orthoreoviruses [39], the cytopathic effect (CPE) after PRV infection is characterized by syncytia formation. The syncytial CPE was observed in non-bat cell lines (BHK-21 and HEK293T) at 1 dpi (Fig. 1a). One bat cell line (FBKT1) showed a syncytial CPE at 2 dpi. Cell viability in those lines rapidly decreased at 1–2 dpi, and complete cell lysis was observed at 3 dpi (Fig. 1b). In contrast, the other bat cell lines (BKT1, DEMKT1, and YUBFKT1) did not show a syncytial CPE, although a subtotal destruction CPE was observed at 3 dpi for BKT1 and at 4 dpi for DEMKT1 and YUBFKT1 (Fig. 1a). Cell viability in those cell lines decreased slowly (Fig. 1b), and complete cell lysis was observed at 7 dpi. Until 7 days, a decrease in cell viabilities of mock-infected cells was observed as a result of overgrowth (Supplementary Fig. 1).
Fig. 1

Cytopathology and cell viabilities in bats and non-bat cell lines after PRV50G infection. a Cytopathic effect (CPE) at different days post-infection (dpi) in bats and non-bat cell lines infected with PRV50G at a multiplicity of infection (MOI) of 0.1. Syncytial CPE is indicated by an arrow. b The relative viabilities of the six cell lines following PRV50G infection at a multiplicity of infection (MOI) of 0.1 until 7 dpi. Relative viabilities = number of live cells in viral-infected cells/number of live cells in mock-infected cells. The relative viabilities of each virus-infected cell are shown as % of mock-infected cells. Data are shown as the mean of n = 3 independent biological replicates ± SD

Cytopathology and cell viabilities in bats and non-bat cell lines after PRV50G infection. a Cytopathic effect (CPE) at different days post-infection (dpi) in bats and non-bat cell lines infected with PRV50G at a multiplicity of infection (MOI) of 0.1. Syncytial CPE is indicated by an arrow. b The relative viabilities of the six cell lines following PRV50G infection at a multiplicity of infection (MOI) of 0.1 until 7 dpi. Relative viabilities = number of live cells in viral-infected cells/number of live cells in mock-infected cells. The relative viabilities of each virus-infected cell are shown as % of mock-infected cells. Data are shown as the mean of n = 3 independent biological replicates ± SD

Viral replication and expression of PRRs and IFNs

Viral replication was observed in all cell lines at 1 dpi (Fig. 2a). The cell lines BHK-21, HEK293T, and FBKT1 showed significantly higher viral genome titers than the bat cell lines BKT1, DEMKT1, and YUBFKT1. The viral genome titers in BKT1, DEMKT1, and YUBFKT1 were still low until 4 dpi when the CPE in all cell lines was observed (Fig. 2b). Two PRRs (RIG-I and MDA5) were up-regulated in two bat cell lines (BKT1 and YUBFKT1), and one PRR (RIG-I) was up-regulated in DEMKT1 (Fig. 2d and e). In contrast, TLR3 was only up-regulated in YUBFKT1 (Fig. 2c). Both BHK-21 and FBKT1 displayed high viral replication levels; all PRRs were down-regulated in BHK-21, while no changes in expression level were observed in FBKT1. Conversely, TLR3 and MDA5 were up-regulated in HEK293T (0.060 ± 0.001 versus 0.087 ± 0.003, p = 0.002 for TLR3 and 0.057 ± 0.002 versus 0.066 ± 0.001, p = 0.001 for MDA5, Table 1); however, the expression levels of TLR3 and MDA5 in HEK293T were lower than all bat cell lines, except for BKT1 (Fig. 2c, e). IFNB1 was highly up-regulated in BKT1 and YUBFKT1, and to a lesser extent in HEK293T. Surprisingly, IFNB1 was not up-regulated in DEMKT1, although that cell line showed lower PRV replication (Fig. 2f). IFNL1 was up-regulated in YUBFKT1, which showed low viral replication, and was up-regulated to a lesser extent in cell lines FBKT1 and HEK293T, which both showed high viral replication (Fig. 2g). The expression levels of IFNB1 and IFNL1 could not be measured in BHK-21, as this cell line is known to be deficient in Type I IFN production, and IFNL1 is a pseudogene in rodents [40, 41]. The expression of IFNL1 also could not be measured in two bat cell lines (BKT1 and DEMKT1).
Fig. 2

PRV50G replication and relative expression of pattern recognition receptors and interferons in bats and non-bat cell lines after PRV50G infection. a The total PRV50G genome RNA in six cell lines after infection at a MOI of 0.1 at 1 dpi. Total virus genome RNA are expressed as Log10 virus genome copies/well (n = 3, mean ± SD). Statistical significance was calculated using one-way ANOVA, followed by Dunnett’s test. *p < 0.05, **p < 0.01, ***p < 0.001, ns not significant vs HEK293T group. b The total PRV50G genome RNA in BKT1, DEMKT1, and YUBFKT1 infected with PRV50G at a multiplicity of infection (MOI) of 0.1 until 4 dpi. Total virus genome RNA are expressed as Log10 virus genome copies/well (n = 3, mean ± SD). c Relative mRNA expression levels of TLR3, d RIG-I, e MDA5, f IFNB1, and g IFNL1 in six cell lines after PRV50G infection at an MOI of 0.1 at 1 dpi. Expression levels of IFNB1 in BHK-21 cells and IFNL1 in BKT1 and DEMKT1 cells could not be measured. Relative expression level is expressed as reciprocal of ΔCt (the PCR cycle at which the product is measurable and normalized to Ct for GAPDH) (n = 3, mean ± SD). Statistical significance was determined by the Mann–Whitney test. *p < 0.05, **p < 0.01, ***p < 0.001, ns not significant vs mock-infected cells

Table 1

Innate immune response against PRV50G and viral replication among six cell lines

Cell linesPattern recognition receptorsInterferonsViral replication
TLR3RIG-IMDA5B1L1
FBKT1aHigh
BKT1bLow
DEMKT1cLow
YUBFKT1dLow
HEK293TeHigh
BHK-21fHigh

aPteropus dasymallus (Ryukyu flying fox), bRhinolophus ferrumequinum (Greater horseshoe bats), cRousettus leschenaultii (Leschenault’s rousette), dMiniopterus fuliginosus (Eastern bent-wing bats), eHomo sapiens (human), fMesocricetus auratus (Syrian hamster)

↑: Up-regulation, –: No change, ↓: Down-regulation

PRV50G replication and relative expression of pattern recognition receptors and interferons in bats and non-bat cell lines after PRV50G infection. a The total PRV50G genome RNA in six cell lines after infection at a MOI of 0.1 at 1 dpi. Total virus genome RNA are expressed as Log10 virus genome copies/well (n = 3, mean ± SD). Statistical significance was calculated using one-way ANOVA, followed by Dunnett’s test. *p < 0.05, **p < 0.01, ***p < 0.001, ns not significant vs HEK293T group. b The total PRV50G genome RNA in BKT1, DEMKT1, and YUBFKT1 infected with PRV50G at a multiplicity of infection (MOI) of 0.1 until 4 dpi. Total virus genome RNA are expressed as Log10 virus genome copies/well (n = 3, mean ± SD). c Relative mRNA expression levels of TLR3, d RIG-I, e MDA5, f IFNB1, and g IFNL1 in six cell lines after PRV50G infection at an MOI of 0.1 at 1 dpi. Expression levels of IFNB1 in BHK-21 cells and IFNL1 in BKT1 and DEMKT1 cells could not be measured. Relative expression level is expressed as reciprocal of ΔCt (the PCR cycle at which the product is measurable and normalized to Ct for GAPDH) (n = 3, mean ± SD). Statistical significance was determined by the Mann–Whitney test. *p < 0.05, **p < 0.01, ***p < 0.001, ns not significant vs mock-infected cells Innate immune response against PRV50G and viral replication among six cell lines aPteropus dasymallus (Ryukyu flying fox), bRhinolophus ferrumequinum (Greater horseshoe bats), cRousettus leschenaultii (Leschenault’s rousette), dMiniopterus fuliginosus (Eastern bent-wing bats), eHomo sapiens (human), fMesocricetus auratus (Syrian hamster) ↑: Up-regulation, –: No change, ↓: Down-regulation

Knockdown of TNF-α in HEK293T

The expression of TNF-α, a pro-inflammatory cytokine, was up-regulated in FBKT1 and highly up-regulated in HEK293T (Fig. 3a). In contrast, TNF-α was down-regulated in BHK-21, while the other bat cell lines did not show a significant change in expression level.
Fig. 3

Relative expression of TNF-α in bats and non-bat cell lines after PRV50G infection and knockdown of TNF-α in HEK293T. a The relative expression of TNF-α in six cell lines after PRV50G infection at a MOI of 0.1 at 1 dpi (n = 3, mean ± SD). Relative expression is expressed as fold of mock-infected, normalized to GAPDH values. Statistical significance was determined by the Mann–Whitney test. *p < 0.05, **p < 0.01, ***p < 0.001, ns not significant vs mock-infected cells. b The total PRV50G genome RNA, c live cell numbers, and d syncytial CPE in TNF-α knockdown HEK293T cells compared with HEK293T cells transfected with control s-oligo after PRV50G infection at a MOI of 0.1 at 12 h post-infection. Total virus genome RNA are expressed as Log10 virus genome copies/well (n = 3, mean ± SD). Live cell numbers are expressed as × 105 cells/mm3. Statistical significance was determined by the Mann–Whitney test. *p < 0.05, **p < 0.01, ***p < 0.001 vs control s-oligo

Relative expression of TNF-α in bats and non-bat cell lines after PRV50G infection and knockdown of TNF-α in HEK293T. a The relative expression of TNF-α in six cell lines after PRV50G infection at a MOI of 0.1 at 1 dpi (n = 3, mean ± SD). Relative expression is expressed as fold of mock-infected, normalized to GAPDH values. Statistical significance was determined by the Mann–Whitney test. *p < 0.05, **p < 0.01, ***p < 0.001, ns not significant vs mock-infected cells. b The total PRV50G genome RNA, c live cell numbers, and d syncytial CPE in TNF-α knockdown HEK293T cells compared with HEK293T cells transfected with control s-oligo after PRV50G infection at a MOI of 0.1 at 12 h post-infection. Total virus genome RNA are expressed as Log10 virus genome copies/well (n = 3, mean ± SD). Live cell numbers are expressed as × 105 cells/mm3. Statistical significance was determined by the Mann–Whitney test. *p < 0.05, **p < 0.01, ***p < 0.001 vs control s-oligo TNF-α that was highly up-regulated in HEK293T with high replication of PRV50G (Figs. 2a and 3a) might positively impact PRV50G replication. An antisense RNA oligonucleotide was used in the knockdown of TNF-α in HEK293T, which was performed to determine its role in supporting PRV50G replication. The knockdown of TNF-α was confirmed by a reduced expression of it (Supplementary Fig. 2). TNF-α might not have any effect on PRV50G replication. The knockdown of TNF-α did not change the viral genomic titer significantly (Fig. 3b). PRV50G infection of TNF-α knockdown cells resulted in a syncytial CPE (Fig. 3d). Cell viability did not differ between normal and knockdown cells at 12 h post-infection (Fig. 3c).

Knockdown of PRRs in BKT1

Knockdown of TLR3, RIG-I, and MDA5 was performed in BKT1, DEMKT1, and YUBFKT1 which showed up-regulation of PRR genes and IFNB1 without formation of syncytial CPE after PRV50G infection. The knockdown of PRRs was confirmed by the remarkably reduced expression of TLR3, RIG-I, and MDA5 in BKT1 (Supplementary Fig. 3). The knockdown of PRRs also depressed the expression of IFNB1 (Fig. 4a) in BKT1. However, an attempt to knockdown the PRR genes in DEMKT1 and YUBFKT1 failed to suppress the expression of those genes.
Fig. 4

Knockdown of TLR3, RIG-I, and MDA5 in BKT1 cells. a The Relative mRNA expression level of IFNB1 after knockdown of TLR3, RIG-I, and MDA5. b Relative mRNA expression of IFNB1 in BKT1 cells knocked down for TLR3, RIG-I, and MDA5 after PRV50G infection at a MOI of 0.1 at 1 dpi. Relative expression level is expressed as reciprocal of ΔCt (the PCR cycle at which the product is measurable and normalized to Ct for GAPDH) (n = 3, mean ± SD). Statistical significance was calculated using one-way ANOVA, followed by Dunnett’s test. *p < 0.05, **p < 0.01, ***p < 0.001, ns not significant vs control s-oligo group. c The total PRV50G genome RNA in BKT1 cells knocked down for TLR3, RIG-I, and MDA5 and BKT1 cells transfected with control s-oligo after PRV50G infection at an MOI of 0.1 at 1 dpi. Total virus genome RNA are expressed as × 106 virus genome copies/well (n = 3, mean ± SD). Statistical significance was calculated using one-way ANOVA, followed by Dunnett’s test. ns not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns not significant vs control s-oligo group

Knockdown of TLR3, RIG-I, and MDA5 in BKT1 cells. a The Relative mRNA expression level of IFNB1 after knockdown of TLR3, RIG-I, and MDA5. b Relative mRNA expression of IFNB1 in BKT1 cells knocked down for TLR3, RIG-I, and MDA5 after PRV50G infection at a MOI of 0.1 at 1 dpi. Relative expression level is expressed as reciprocal of ΔCt (the PCR cycle at which the product is measurable and normalized to Ct for GAPDH) (n = 3, mean ± SD). Statistical significance was calculated using one-way ANOVA, followed by Dunnett’s test. *p < 0.05, **p < 0.01, ***p < 0.001, ns not significant vs control s-oligo group. c The total PRV50G genome RNA in BKT1 cells knocked down for TLR3, RIG-I, and MDA5 and BKT1 cells transfected with control s-oligo after PRV50G infection at an MOI of 0.1 at 1 dpi. Total virus genome RNA are expressed as × 106 virus genome copies/well (n = 3, mean ± SD). Statistical significance was calculated using one-way ANOVA, followed by Dunnett’s test. ns not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns not significant vs control s-oligo group After viral infection, the IFNB1 expression in all types of knockdown cells was still significantly lower than that of the control cells (Fig. 4b). The lowest IFNB1 expression levels were observed in RIG-I knockdown cells. All cells knocked down for PRR genes demonstrated higher viral genome titers than control cells; however, only RIG-I knockdown cells exhibited significantly higher PRV50G titers than control cells (Fig. 4c). The syncytial CPE and a rapid decrease in cell viability were observed at 1 dpi in RIG-I knockdown cells and at 2 dpi in MDA5 knockdown cells (Fig. 5a, b, and Supplementary Fig. 4). No syncytial CPE was observed in control cells, and the viability of these cells was higher than that of those knocked down for PRRs.
Fig. 5

Cytopathology and cell viabilities in BKT1 cells knocked down for TLR3, RIG-I, and MDA5 after PRV50G infection. a Cytopathic effect (CPE) at different days post-infection (dpi) in BKT1 cells knocked down for TLR3, RIG-I, and MDA5 and BKT1 cells transfected with control s-oligo after infected with PRV50G at a multiplicity of infection (MOI) of 0.1. Syncytial CPE is indicated by arrows. b The relative viabilities of BKT1 cells knocked down for TLR3, RIG-I, and MDA5 and BKT1 cells transfected with control s-oligo following infection with PRV at MOI of 0.1 until 7 dpi. Relative viabilities = number of live cells in viral-infected cells/number of live cells in mock-infected cells. The relative viabilities of each virus-infected cell are shown as % of mock-infected cells. Data are shown as the mean of n = 3 independent biological replicates ± SD

Cytopathology and cell viabilities in BKT1 cells knocked down for TLR3, RIG-I, and MDA5 after PRV50G infection. a Cytopathic effect (CPE) at different days post-infection (dpi) in BKT1 cells knocked down for TLR3, RIG-I, and MDA5 and BKT1 cells transfected with control s-oligo after infected with PRV50G at a multiplicity of infection (MOI) of 0.1. Syncytial CPE is indicated by arrows. b The relative viabilities of BKT1 cells knocked down for TLR3, RIG-I, and MDA5 and BKT1 cells transfected with control s-oligo following infection with PRV at MOI of 0.1 until 7 dpi. Relative viabilities = number of live cells in viral-infected cells/number of live cells in mock-infected cells. The relative viabilities of each virus-infected cell are shown as % of mock-infected cells. Data are shown as the mean of n = 3 independent biological replicates ± SD

Discussion

Although all cell lines examined in this study were susceptible to PRV50G, the virulence differed among cell lines. All bat cell lines, except for FBKT1, were more resistant than the other mammalian cell lines, as indicated by a lack of observable syncytial CPE, a slighter decrease of cell viability, and a limited viral replication. The less susceptibility of PRV in Yinpterochiropteran (or Pteropodiformes) bat cell lines (BKT1 and DEMKT1) was different from the kidney cell line derived from the black flying fox (Pteropus alecto) that is susceptible to the extensive syncytial formation and high viral replication when exposed to NBV [42]. Low replication of PRV has been reported recently in a bat cell line derived from Yangochiropteran (or Vespertilioniformes) bats, David’s myotis (Myotis davidii) [43]. The resistance against PRV in most bat cell lines suggests that the innate immune response of some bat species is capable of inhibiting PRV replication (Table 1). The innate immune response is initiated upon viral recognition by PRR proteins, which stimulates the production of IFNs as part of the antiviral response. TLR3, RIG-I, and MDA5, which are responsible for dsRNA virus recognition, are highly expressed in bat cells and enable heightened stimulation of IFN expression. Stimulation by dsRNA molecule induced expression of TLR3, RIG-I, MDA5, and IFNB1 in bat cells and bat cell lines [28, 29]. The highly up-regulation of RIG-I and MDA5 in YUBFKT1 and RIG-I in BKT1 possibly promotes the up-regulation of IFNs and therefore limits PRV replication. Although some PRRs and IFNs were up-regulated in FBKT1 and HEK293T, PRV replication was not significantly reduced in those cell lines. This finding may be related to the fact that the baselines of PRR and IFN expression levels were lower than those in BKT1 and YUBFKT1. It has been shown that reoviruses can successfully replicate in non-bat cells by inhibiting the activation of proteins involved in the IFN-stimulated antiviral response, such as IFN-induced double-stranded RNA-dependent protein kinase (PKR) and 2′,5′-oligoadenylate synthetase [44, 45]. However, the only different PRRs between bat and non-bat cell lines after PRV infection is RIG-I. High expression of RIG-I is correlated with low viral replication titer in YUBFKT1. In contrast, low expression of RIG-I is correlated with high viral replication titer in HEK293T. The relatively slight increase in TNF-α expression in the bat cell lines might account for the limited inflammation observed after PRV50G infection. A similar slight increase in TNF-α expression has been reported in a bat cell line derived from the big brown bat (Eptesicus fuscus) after MERS-CoV infection [46]. The c-Rel protein, an NF-κβ-family member, binds the promoter region of the TNF-α gene, thus restricting the production of TNF-α [47]. The lack of strong inflammation after PRV (Melaka virus, PRV3M) infection was also reported in immune cells derived from P. alecto; this result was attributed to reduced NLRP3 inflammasome activation, which restricted IL-1β secretion [48]. Such examples of inflammatory response regulation might be crucial in limiting tissue damage and preventing the manifestation of clinical symptoms during viral infection. In contrast, the high up-regulation of TNF-α observed in HEK293T suggests a strong inflammatory response might occur in this line, similar to results observed after orthoreovirus infection in murine and human monocyte cell lines [49-51]. However, high TNF-α production apparently has a minimal effect on PRV replication. In addition, the level of other pro-inflammatory cytokines, such as IL-1β, has not been shown to correlate with the replication of Melaka virus (PRV3M) [48]. Knockdown of TLR3, RIG-I, and MDA5 resulted in a decreased expression level of IFNB1, suggesting that these PRRs are important for stimulating IFNB1 expression in rhinolophoid (horseshoe) bats. However, RIG-I played a more significant role in stimulating an antiviral response against PRV50G than TLR3 or MDA5, as demonstrated by the high rate of viral replication that accompanied a low expression of IFNB1. High basal expression of PRRs enables greater viral RNA detection and therefore higher stimulation levels of IFN-stimulated genes (ISGs) and IFNs, such as 2′,5′-oligoadenylate synthetase and RNase L, which can cleave and therefore shorten viral RNA fragments [52]. These shorter viral RNA fragments are recognized by RIG-I, which in turn promotes the production of IFNs [53]. The importance of RIG-I-signaling and IFNs in the antiviral response against PRV has also been elucidated in an NBV-resistant mouse fibroblast cell line (L929), and against other RNA viruses, Marburg and Ebola virus in cell lines derived from Rousettus bats. The suppression of RIG-I signaling and caspase/cell-death pathways was observed in P. alecto kidney cell line (PaKiT03) during NBV infection [54-56]. RIG-I signaling might be the main mechanism for bats to avoid diseases after infection with PRV50G and other RNA viruses. Pre-treatment with IFNs can reduce viral replication and increase the expression of RIG-I and ISGs in cell lines that are susceptible to NBV [55, 57, 58]. In addition, several IFN-regulatory factors (IRF1, IRF3, and IRF7) control the IFN-regulated genes (IRGs) response during PRV3M infection [43]. The serine residues that were positively selected in IRF3 from multiple bats also contribute to a higher basal level of IFNs and enhance protection against MERS-CoV in bat cells [46, 59]. In conclusion, RIG-I production plays an important role in the antiviral response against PRV50G infection, especially in rhinolophoid (horseshoe) bats. In addition to displaying a robust antiviral response, bats apparently are also capable of suppressing excessive viral-mediated inflammatory responses. Below is the link to the electronic supplementary material. Supplementary Figure 1. Morphologies and cell viabilities of mock-infected cells in bats and non-bat cell lines. Morphologies and cell viabilities of (a−b) HEK293T, (c−d) BHK-21, (e−f) FBKT1, (g−h) BKT1, (i−j) DEMKT1, and (k−l) YUBFKT1 until 7 days. The viabilities of each mock-infected cell are shown as % of live cells. Data are shown as the mean of n = 3 independent biological replicates. Supplementary file1 (PDF 34410 KB) Supplementary Figure 2. Relative expression of TNF-α 2 days after knockdown of TNF-α and transfection with control s-oligo in HEK293T cells. Relative expression level is expressed as reciprocal of ΔCt (the PCR cycle at which the product is measurable and normalized to Ct for GAPDH) (n = 3, mean ± SD). Statistical significance was determined by the Mann–Whitney test. *p < 0.05, **p < 0.01, ***p < 0.001, ns: not significant vs control s-oligo group. Supplementary file2 (TIF 13439 KB) Supplementary Figure 3. Relative expression of (a) TLR3, (b) RIG-I, and (c) MDA5 after 2 days after knockdown of each pattern recognition receptor and transfection with control s-oligo in BKT1 cells. Relative expression level is expressed as reciprocal of ΔCt (the PCR cycle at which the product is measurable and normalized to Ct for GAPDH) (n = 3, mean ± SD). Statistical significance was determined by the Mann–Whitney test. *p < 0.05, **p < 0.01, ***p < 0.001, ns: not significant vs control s-oligo group. Supplementary file3 (TIF 3517 KB) Supplementary Figure 4. Morphologies and cell viabilities of mock-infected BKT1 cells knocked down for PRRs and transfected with control s-oligo. Morphologies and cell viabilities of (a–b) BKT1 cells transfected with control s-oligo, (c–d) BKT1 cells knocked down for TLR3, (e–f) BKT1 cells knocked down for RIG-I, (g–h) BKT1 cells knocked down for MDA5. The viabilities of each mock-infected cell are shown as % of live cells. Data are shown as the mean of n = 3 independent biological replicates. Supplementary file4 (PDF 24330 KB) Supplementary Table 1. qRT-PCR primers used to measure the expression of innate-immune-response genes. Supplementary file5 (DOCX 25 KB)
  59 in total

1.  Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses.

Authors:  Hiroki Kato; Osamu Takeuchi; Shintaro Sato; Mitsutoshi Yoneyama; Masahiro Yamamoto; Kosuke Matsui; Satoshi Uematsu; Andreas Jung; Taro Kawai; Ken J Ishii; Osamu Yamaguchi; Kinya Otsu; Tohru Tsujimura; Chang-Sung Koh; Caetano Reis e Sousa; Yoshiharu Matsuura; Takashi Fujita; Shizuo Akira
Journal:  Nature       Date:  2006-04-09       Impact factor: 49.962

2.  A novel reovirus isolated from a patient with acute respiratory disease.

Authors:  Peter Cheng; Chi Shan Lau; Alexander Lai; Eric Ho; Peter Leung; Fanny Chan; Ann Wong; Wilina Lim
Journal:  J Clin Virol       Date:  2009-04-07       Impact factor: 3.168

3.  Development of molecular and cellular tools to decipher the type I IFN pathway of the common vampire bat.

Authors:  Sarkis Sarkis; Marie-Claude Lise; Edith Darcissac; Stéphanie Dabo; Marcel Falk; Laura Chaulet; Christine Neuveut; Eliane F Meurs; Anne Lavergne; Vincent Lacoste
Journal:  Dev Comp Immunol       Date:  2017-11-06       Impact factor: 3.636

4.  Polyethylenimine (PEI)/siRNA-mediated gene knockdown in vitro and in vivo.

Authors:  Sabrina Höbel; Achim Aigner
Journal:  Methods Mol Biol       Date:  2010

5.  Serological evidence of human infection by bat orthoreovirus in Singapore.

Authors:  Anna Uehara; Chee Wah Tan; Shailendra Mani; Kaw Bing Chua; Yee Sin Leo; Danielle E Anderson; Lin-Fa Wang
Journal:  J Med Virol       Date:  2018-11-28       Impact factor: 2.327

6.  Transmission of Nipah Virus - 14 Years of Investigations in Bangladesh.

Authors:  Birgit Nikolay; Henrik Salje; M Jahangir Hossain; A K M Dawlat Khan; Hossain M S Sazzad; Mahmudur Rahman; Peter Daszak; Ute Ströher; Juliet R C Pulliam; A Marm Kilpatrick; Stuart T Nichol; John D Klena; Sharmin Sultana; Sayma Afroj; Stephen P Luby; Simon Cauchemez; Emily S Gurley
Journal:  N Engl J Med       Date:  2019-05-09       Impact factor: 91.245

7.  Characterization of the envelope glycoprotein of a novel filovirus, lloviu virus.

Authors:  Junki Maruyama; Hiroko Miyamoto; Masahiro Kajihara; Hirohito Ogawa; Ken Maeda; Yoshihiro Sakoda; Reiko Yoshida; Ayato Takada
Journal:  J Virol       Date:  2013-10-16       Impact factor: 5.103

8.  Interferon Regulatory Factor 3-Mediated Signaling Limits Middle-East Respiratory Syndrome (MERS) Coronavirus Propagation in Cells from an Insectivorous Bat.

Authors:  Arinjay Banerjee; Darryl Falzarano; Noreen Rapin; Jocelyne Lew; Vikram Misra
Journal:  Viruses       Date:  2019-02-13       Impact factor: 5.048

9.  Role of pattern recognition receptors and interferon-beta in protecting bat cell lines from encephalomyocarditis virus and Japanese encephalitis virus infection.

Authors:  Ronald Tarigan; Hiroshi Shimoda; Karla Cristine C Doysabas; Maeda Ken; Atsuo Iida; Eiichi Hondo
Journal:  Biochem Biophys Res Commun       Date:  2020-04-23       Impact factor: 3.575

10.  Virulence, pathology, and pathogenesis of Pteropine orthoreovirus (PRV) in BALB/c mice: Development of an animal infection model for PRV.

Authors:  Kazutaka Egawa; Masayuki Shimojima; Satoshi Taniguchi; Noriyo Nagata; Hideki Tani; Tomoki Yoshikawa; Takeshi Kurosu; Shumpei Watanabe; Shuetsu Fukushi; Masayuki Saijo
Journal:  PLoS Negl Trop Dis       Date:  2017-12-14
View more
  1 in total

1.  Bat Employs a Conserved MDA5 Gene to Trigger Antiviral Innate Immune Responses.

Authors:  Jie Wang; Zhenyu Lin; Qiuju Liu; Feiyu Fu; Zhaofei Wang; Jingjiao Ma; Hengan Wang; Yaxian Yan; Yuqiang Cheng; Jianhe Sun
Journal:  Front Immunol       Date:  2022-05-23       Impact factor: 8.786

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.