Literature DB >> 34390532

Pathogenic bacteria in cheese, raw and pasteurised milk.

Mahsa Morovati Bastam1, Mahsa Jalili1, Iraj Pakzad1, Abbas Maleki2, Sobhan Ghafourian1.   

Abstract

BACKGROUND: Foodborne diseases, especially those transmitted by milk and its products, are worldwide problem. Milk is not only a complete food but also a unique medium for activating various bacteria such as Listeria monocytogenes, Staphylococcus aureus and Salmonella typhi. In recent years, numerous bacteria with multiple drug resistance patterns have appeared, and there have been many problems in infection control. Today, ranchers use antibiotics for control of the animal disease, and humans are constantly using animal products containing antibiotics.
OBJECTIVE: The purpose of this study was to evaluate the contamination status of raw and pasteurised milk as well as local cheese and to find a rapid Multiplex PCR method for investigation of contamination. Determination of antibiotic resistant isolates is also desirable.
MATERIALS AND METHODS: One hundred samples were collected from livestock and retail outlets using culture and molecular methods to identify S. aureus, L. monocytogenes and S. typhi. The antibiotic resistance pattern was determined for the isolates.
RESULTS: In this study, culture results for 100 samples showed 10% S. aureus isolates while no cases of S. typhi and L. monocytogenes were detected. In real-time qPCR, S. aureus was isolated in 60% (n = 60) of samples, S. typhi in 53% (n = 53) and L. monocytogenes in 2% (n = 2). The results of sensitivity and specificity of Multiplex PCR for the three studied bacteria indicated general specificity of 72% and sensitivity of 80%.
CONCLUSION: Based on the results of this study, it can be concluded that S. typhi, L. monocytogenes and S. aureus are more likely to be detected by real-time qPCR because of the high sensitivity of this test to culture. Multiplex method was not reliable in this study and cannot be suggested for rapid diagnosis.
© 2021 The Authors. Veterinary Medicine and Science published by John Wiley & Sons Ltd.

Entities:  

Keywords:  identification; microbial contamination; milk

Mesh:

Substances:

Year:  2021        PMID: 34390532      PMCID: PMC8604106          DOI: 10.1002/vms3.604

Source DB:  PubMed          Journal:  Vet Med Sci        ISSN: 2053-1095


INTRODUCTION

Milk and dairy products have a special place among various foods of animal and plant origin. Adequate protein, fat, essential amino acids, and minerals like calcium and phosphorus reveal the importance of milk and dairy products (Kaskous & Pfaffl, 2017). In addition, millions of people consume milk and dairy products in their meals every day. Therefore, providing high quality products will be essential to ensure the health of the community. Given the importance of milk in human nutrition and general community health, knowledge of its components and the soundness of this important food product is necessary and inevitable (Singhal et al., 2017). Milk and its products contain different nutrients and the pH of milk is equal to 6.8; therefore, it is a good environment for the growth of many microorganisms. Milk has a primary microbial flora when milking cows, but it may be contaminated with other pathogenic microorganisms (Munera‐Bedoya et al., 2017). A number of diseases can be transmitted to humans through milk. Microbes that can be transmitted to milk through cattle lead to infection with Staphylococcus aureus, bovine tuberculosis, brucellosis, malaria, streptococcal and salmonellosis infections. Also, some contaminants may be transmitted through milk carriers. Transmission through contaminated soil and equipment can also lead to listeriosis and salmonellosis, as well as Campylobacter‐related infections in consumers (Nornberg et al., 2010). The health of raw milk is in the interest of public, and failure provide high quality milk will reduce the level of public health as well as economic health; therefore, due to the importance of this issue, it is vital to quickly and accurately identify raw milk contamination (Abushelaibi et al., 2017). Therefore, it is necessary to study the profile of pathogenic microbes phenotypically. Considering the importance of milk as an essential nutrient, it is advisable for the research community to identify pathogenic bacteria such as Salmonella spp, S. aureus and Listeria monocytogenes and to study the spread of antibiotic resistance in these pathogens (Marin et al., 2017). Therefore, the current study aimed to evaluate the contamination of raw and pasteurised milk as well as cheese with Salmonella typhi, L.monocytogenes and S.aureus to determine the antibiotic resistance pattern of the isolated bacteria.

MATERIALS AND METHODS

2.1 Sample collection

One hundred samples, including 35 samples of raw and 35 samples of pasteurised milk, as well as 30 samples of cheese were collected from diary and livestock centres.

Culture and identification of S. aureus, S. typhi and L. monocytogenes

In each plate, after pouring milk or cheese homogenisation, culture was performed on MacConkey agar, blood agar and chocolate agar and incubated for 24 h at 37°C. After 24 h, the colonies suspected of being S. aureus, S. typhi and L. monocytogenes were examined. Initially, single colonies were expanded, gram stained and catalase tested. Then, all slides were studied under a light microscope. In the final stage, tubular coagulase and DNase tests was performed for S. aureus isolates. Motility tests were performed at 37°C and room temperature for isolates suspected of being L. monocytogenes. For S. typhi, after culture on Mac Conkey agar (Merck) and xylose lysine deoxycholate agar (XLD) (Merck) the specific tests of Enterobacteriaceae family, including catalase test, oxidase test, methyl red (MR) (Merck), Voges–Proskauer (VP) (Merck),citrate utilisation (Merck), sulfide indole motility (SIM) (Merck), Kligler Iron Agar (KIA) (Sigma‐Aldrich) and Lysine iron agar (LIA) (Merck) were performed, the suspected isolates were subsequently evaluated with specific anti‐sera (Bharafshan, Iran).

Antibiotic susceptibility test

To determine the antibiotic resistance patterns of common milk bacteria, antibiotic susceptibility assay was performed by disk diffusion. The antibiotics included ampicillin (10 µg), tetracycline (30 µg), gentamicin (10 µg), ceftazidime (30 µg), ciprofloxacin (5 µg), imipenem (10 µg), penicillin (10 µg), cotrimoxazole (25 µg), ceftriaxone (30 µg) and cefoxitin (30 µg). It should be noted that antimicrobial assay was performed only for S. aureus because only this bacterium was isolated from samples. Disks were purchased from the Padtan Teb Co. (Iran)

DNA extraction

DNA extraction was performed by boiling method (Oliveira et al., 2014).

Real‐time qPCR

Real‐time qPCR was performed to assess the presence of specific bacterial genes. For this purpose, special microtubes with 0.2 transparencies were used. After counting the microtubes, in each microtube, 12 µl of SYBR Green (Real‐Time PCR Master Mix) containing DNA polymerase, dNTP buffer system and SYBR Green fluorescent dye, 8 µl of nuclease free water, 1 µl of forward primer (final concentration of 5 picomoles/µl), 1 µl of reverse primer (final concentration of 5 picomoles/µl) and 3 µl of DNA (concentration of 100 ng/µl) were added to a final volume of 25 µl. Negative control method was used to investigate possible contamination. The microtubes were then placed in a real‐time machine (BioRAD, USA) and the necessary adjustments were made.

Multiplex PCR

For Multiplex PCR, the primers listed in Table 1 were used. The method applied to test may be suggested to accelerate the test.
TABLE 1

Primers used in Multiplex PCR

GeneSequence (5′→3′)Sizes (bp)
nuc F: ACAGAGGTAAACGCAACGA126
R: ACCTGTAACCGCACCAAGTT
hly A F:CAGGAATGACTAATCAAGACA315
R:AGGTTCATTAACAATCACG
Inv A F:CTTTGATAAACTTCATCGCAC200
TCGTTATTACCAAAGGTTCAG
Primers used in Multiplex PCR

Determination of specificity and sensitivity of Multiplex PCR

Sensitivity and specificity are two important indicators for statistically evaluating the performance of binary classification test results, which are known in statistics as classification functions. When data can be divided into positive and negative groups, the performance of the results of an experiment that divides information into these two categories can be measured and described using sensitivity and specificity indexes. Sensitivity: The proportion of positive items that the test correctly marks as positive. Specificity: The proportion of negatives that the test correctly marks as negative.

RESULTS AND DISCUSSION

Our results showed that only S. aureus was isolated with frequency of 10% (n = 10) by culture method, which was detected in three samples out of a total of 30 cheese samples (11%) as well as seven samples from a total of 35 raw milk samples (22.8%). Also, our results showed two cheeses samples (5.7%) that were positive for L. monocytogenes.

Real‐time qPCR test to identify S. aureus, S. typhi and L. monocytogenes via nuc, invA and hlyA genes, respectively

Among 100 samples, 60% (n = 60) were positive for S. aureus via detection of nuc gene, 53% (n = 53) of samples were positive for S. typhi by investigation of invA gene and 2% (n = 2) were positive for L.monocytogenes through identification of hlyA gene (Figure 1 and Table 2).
FIGURE 1

Identification of S. aureus, S. typhi and L. monocytogenes via nuc, invA and hlyA genes, respectively, by real‐time qPCR

TABLE 2

Identification of S. aureus, S. typhi and L. monocytogenes in cheese, raw and pasteurised milk by qPCR

SamplesTotal numberNumber of positive isolatesPercentage of positive isolates
S. aureus
Raw milk351337.1%
Pasteurised milk352674.2%
Cheese302170%
Total1006060%
L. monocytogenes
Raw milk3525.7%
Pasteurised milk3500%
Cheese3000%
Total10022%
S. typhi
Raw milk351851.4%
Pasteurised milk352057.1%
Cheese301550%
Total1005353%
Identification of S. aureus, S. typhi and L. monocytogenes via nuc, invA and hlyA genes, respectively, by real‐time qPCR Identification of S. aureus, S. typhi and L. monocytogenes in cheese, raw and pasteurised milk by qPCR

Multiplex PCR for identification of S. aureus, S. typhi and L. monocytogenes via nuc, invA and hlyA genes, respectively

The presence of nuc, invA and hlyA genes was evaluated in 100 samples of raw milk, pasteurised milk and local cheese with frequency of 35% (n = 35), 78% (n = 78) and 2% (n = 2), respectively (Figures 2 and 3). The results of sensitivity and specificity of Multiplex PCR for the three studied bacteria indicated general specificity and sensitivity of 72% and 80%, respectively. Bacterial susceptibility and specificity are listed in Table 3.
FIGURE 2

Identification of S. aureus, S. typhi and L. monocytogenes in cheese, raw and pasteurised milk by Multiplex PCR

FIGURE 3

Multiplex PCR for nuc, invA and hylA genes in cheese, raw and pasteurised milk; nuc = 126bp, hylA = 315bp, invA = 200bp

TABLE 3

Specificity and sensitivity of Multiplex PCR

SpecificitySensitivity
S. aureus %57.9 %84.5
S. typhi %75.8 %61.6
L. monocytogenes %100 %100
Total %72 %80
Identification of S. aureus, S. typhi and L. monocytogenes in cheese, raw and pasteurised milk by Multiplex PCR Multiplex PCR for nuc, invA and hylA genes in cheese, raw and pasteurised milk; nuc = 126bp, hylA = 315bp, invA = 200bp Specificity and sensitivity of Multiplex PCR

Antibiotic resistance pattern in S. aureus

The results of antibiotic resistance pattern in isolated S. aureus strains indicated that all samples were MSSA and that all were sensitive to cefoxitin, gentamicin and tetracycline but the resistance was observed to ampicillin. In the present study, 100 samples of raw milk, pasteurised milk and cheese were studied for the presence of S. aureus, S. typhi and L. monocytogenes based on culture, biochemical characteristics and amplification of specific genes. Transmission of bacterial species among humans, livestock, farmers and farm workers is increasing dramatically in Europe and many parts of the world. This is of great importance, especially with increasing use of antibiotics, which has increased the resistance to various drugs significantly and has made control and treatment in humans and animals more difficult. Therefore, rising antibiotic resistance is a concern and should be controlled (Patel et al., 2018). Milk is a good environment for S. aureus to grow and produce enterotoxin, especially because enterotoxin retains its biological activity even after pasteurisation. Salmonella spp is one of the most important infectious agents in humans and animals. The crucial role of infected animal populations as a source for preserving and transmitting Salmonella to humans, especially through contaminated food, is quite clear today (Knight‐Jones et al., 2016). Fecal entry into milk can also be a main cause of milk contamination with Salmonella; this bacterium can enter raw milk from the outer surface of udder and from equipment, environment, bed and water. L. monocytogenes has been the focus of many researchers due to its high prevalence and mortality rate (Dhanashekar et al., 2012 Sep 1). This bacterium is also responsible for many food poisoning epidemics, especially in industrialised countries. Recently, a stronger association between listeriosis and dairy consumption has been reported compared to other food products, and pasteurised and unpasteurised milk as well as cheese have been identified as a common source of epidemics. L.monocytogenes is able to grow in unpasteurised milk and there is a possibility of increasing number of organisms during storage in milk, storage tanks in farms and silos (Hunt et al., 2012). During the first study conducted in Iran by Jalali and Abedi (2008) regarding L. monocytogenes on various foods, the contamination rate of dairy products was 1.3%, which was consistent with our results (2%). In a study by Rodríguez‐Lázaro et al. (2017) in Brazil, S. aureus was isolated from 15% of cases that was different from our findings. Van Kessel et al. (2004) conducted a study in 2004 on samples taken from milk containers based on the presence or absence of Salmonella in raw milk. During the isolation of Salmonella by culture technique, the initial results showed that 2.6% of samples were infected with Salmonella. In their study, 20 out of 861 samples of cultured milk were infected with Salmonella, which were viable after enrichment and on the culture medium. These bacteria showed growth, but only two positive samples were obtained from direct culture of bacteria on selective and specific media such as XLD, which indicates the high importance of using pre‐enrichment and enrichment steps. In general, the present study was conducted due to the significance of food pathogens in raw milk, pasteurised milk and cheese since in some areas, dairy consumption is mostly in the form of raw milk and pasteurisation is done at home by individuals or dairy shops that are responsible for sales. It is necessary to assess these milks for the safety of their microbial quality. On the other hand, although there is some degree of monitoring in pasteurised milk, some substances that do not match the microbial quality of milk have been found in them. In this study, the prevalence of S. aureus in raw milk was reported to be 10% by culture method and 60% by real‐time qPCR. The results of culture and real‐time qPCR were different, which indicates the need to examine suspicious samples using molecular methods. On the other hand, Salmonella and Listeria are also considered as indicators of raw milk contamination. The specific genes of these two bacteria were reported to be 2% for L. monocytogenes and 53% for S. typhi, indicating the importance of molecular methods in the diagnosis of such microbial infections. The results of Multiplex PCR showed that 35% (n = 35) of bacteria were S. typhi and 78% (n = 78) were S. aureus. Multiplex PCR cannot be used to identify milk‐borne microbes that showed a difference result from real‐time qPCR. A review of past studies in other areas shows that the tanks carrying raw milk do not have the desired hygienic quality. Consumption of raw milk can reduce safety and health quality, which endangers people's health. According to the results of this study, we conclude that S. typhi, S. aureus and L. monocytogenes can be identified by molecular PCR due to the high sensitivity of the test relative to the culture method. Achieving the result over a short time is one of the advantages of molecular PCR method. However, the possibility of isolating dead bacteria in this method is high and it can be concluded that this approach indicates the presence or absence of bacteria in milk. Therefore, we suggest that the following points: Informing and preventing people from consuming raw milk and products produced from it. Awareness of groups at high risk of infection. This information should be provided to food and medicine authorities and the research should be continued by the university to control contamination Studies should be done on a larger scale.

ETHICAL APPROVAL STATEMENT

The current study was approved by ethical committee of Ilam University of medical sciences (ID:981017/104).

CONFLICT OF INTEREST

There is no conflict of interest.

AUTHOR CONTRIBUTIONS

Mahsa Morovati Bastam: Investigation; methodology; writing‐original draft. Mahsa Jalili: Investigation; project administration. Iraj Pakzad: Formal analysis; software. Abbas Maleki: Data curation; software. Sobhan Ghafourian: Supervision; validation; writing‐review & editing.

PEER REVIEW

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.604
  11 in total

1.  Prevalence of Listeria species in food products in Isfahan, Iran.

Authors:  M Jalali; D Abedi
Journal:  Int J Food Microbiol       Date:  2007-12-05       Impact factor: 5.277

Review 2.  Milk-borne infections. An analysis of their potential effect on the milk industry.

Authors:  Revathi Dhanashekar; Sindhura Akkinepalli; Arvind Nellutla
Journal:  Germs       Date:  2012-09-01

3.  Prevalence of Salmonellae, Listeria monocytogenes, and fecal coliforms in bulk tank milk on US dairies.

Authors:  J S Van Kessel; J S Karns; L Gorski; B J McCluskey; M L Perdue
Journal:  J Dairy Sci       Date:  2004-09       Impact factor: 4.034

4.  A Comparison of the Nutritional Value of Cow's Milk and Nondairy Beverages.

Authors:  Sarita Singhal; Robert D Baker; Susan S Baker
Journal:  J Pediatr Gastroenterol Nutr       Date:  2017-05       Impact factor: 2.839

5.  A case of bovine raw milk contamination with Listeria monocytogenes.

Authors:  Karen Hunt; Niall Drummond; Mary Murphy; Francis Butler; Jim Buckley; Kieran Jordan
Journal:  Ir Vet J       Date:  2012-07-06       Impact factor: 2.146

6.  Influence of attitudes and behavior of milkers on the hygienic and sanitary quality of milk.

Authors:  Oscar David Múnera-Bedoya; Laerte D Cassoli; Paulo F Machado; Mario Fernando Cerón-Muñoz
Journal:  PLoS One       Date:  2017-09-19       Impact factor: 3.240

7.  Detection and Characterization of Staphylococcus aureus and Methicillin-Resistant S. aureus in Foods Confiscated in EU Borders.

Authors:  David Rodríguez-Lázaro; Elena-Alexandra Oniciuc; Patricia G García; David Gallego; Isabel Fernández-Natal; Marta Dominguez-Gil; José M Eiros-Bouza; Martin Wagner; Anca I Nicolau; Marta Hernández
Journal:  Front Microbiol       Date:  2017-07-21       Impact factor: 5.640

8.  Pathogenic bacteria in cheese, raw and pasteurised milk.

Authors:  Mahsa Morovati Bastam; Mahsa Jalili; Iraj Pakzad; Abbas Maleki; Sobhan Ghafourian
Journal:  Vet Med Sci       Date:  2021-08-14

9.  Evaluation of four different DNA extraction methods in coagulase-negative staphylococci clinical isolates.

Authors:  Caio Fernando de Oliveira; Thiago Galvão da Silva Paim; Keli Cristine Reiter; Alexandre Rieger; Pedro Alves D'Azevedo
Journal:  Rev Inst Med Trop Sao Paulo       Date:  2014 Jan-Feb       Impact factor: 1.846

10.  Microbial Contamination and Hygiene of Fresh Cow's Milk Produced by Smallholders in Western Zambia.

Authors:  Theodore J D Knight-Jones; M Bernard Hang'ombe; Mwansa M Songe; Yona Sinkala; Delia Grace
Journal:  Int J Environ Res Public Health       Date:  2016-07-21       Impact factor: 3.390

View more
  1 in total

1.  Pathogenic bacteria in cheese, raw and pasteurised milk.

Authors:  Mahsa Morovati Bastam; Mahsa Jalili; Iraj Pakzad; Abbas Maleki; Sobhan Ghafourian
Journal:  Vet Med Sci       Date:  2021-08-14
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.