Literature DB >> 34349380

Containment of varicella outbreak in intensive care unit of a tertiary level hospital.

Raman Sharma1, Kapil Goyal2, Nidhi Bhatia3, Vikas Rana2, Mini P Singh2, Ashish Bhalla4, Gurpreet Singh5, Ashok Kumar1, Kajal Jain3.   

Abstract

BACKGROUND: Varicella-Zoster virus (VZV) infection in healthcare organizations, especially in intensive care units (ICU), having admitted immunocompromised patients, is of serious concern as well as poses threat to healthcare workers working in such critical areas. The present report defines the transmission and infection control measures initiated to curtail VZV infection spread in the trauma ICU of a tertiary care hospital of North India. OUTBREAK REPORT: At the infection outset, there were 12 patients admitted in ICU and 54 healthcare workers were posted to manage these critical patients. After confirmation of VZV infection, all susceptible patients as well as healthcare workers were quarantined and fresh intake of patients was restricted. Out of the total healthcare workers, 14 (25.92%) were found susceptible (as per protective VZV IgG titers) and were vaccinated. Of the 12 patients admitted in the ICU, six patients were discharged and sent home directly, four patients expired due to their critical disease state, one patient left against medical advice, and one patient remained admitted in ICU till the incubation period was over. Epidemiologically, line listing for index case reporting was done. The efficacy of control measures was re-evaluated to strengthen existing infection control practices and general measures viz. strict hand washing, adherence to aseptic protocols and intensification of environmental cleaning.
CONCLUSIONS: Established varicella surveillance measures ensure VZV outbreaks are identified in a timely manner and control measures implemented to prevent further transmission. Also, vaccination policy among HCWs is the utmost requirement despite having huge financial implications. Copyright:
© 2021 Journal of Anaesthesiology Clinical Pharmacology.

Entities:  

Keywords:  Containment; immunization; intensive care unit; outbreak; varicella

Year:  2021        PMID: 34349380      PMCID: PMC8289633          DOI: 10.4103/joacp.JOACP_542_20

Source DB:  PubMed          Journal:  J Anaesthesiol Clin Pharmacol        ISSN: 0970-9185


Introduction

Varicella-Zoster virus (VZV), a double-stranded DNA virus has been implicated in the causation of chickenpox, a common communicable disease affecting humans.[12] The infection is self-limiting in children; however, certain group of patients, particularly neonates, adults, pregnant women and immunocompromised patients are at increased risk of complications.[34] The nosocomial transmission of this virus in healthcare organizations, where potentially susceptible immunocompromised patients are admitted is of serious concern as infection in these patients can lead to high morbidity and mortality. Also, it may pose an additional threat to the healthcare professionals (HCPs) working in these critical areas who may further transmit it to their co-workers and other susceptible patients.[5] The infection among HCPs and susceptible patients can be transmitted through respiratory route and occasionally by close contact with the blister fluid. Considering that the secondary attack rate is around 80% in household settings, and is likely to reach 90% in healthcare institutions, such outbreaks when occur in critical areas of hospitals such as intensive care units (ICUs), may be difficult to control. To prevent the transmission of VZV infection in the hospital settings, the development and implementation of hospital policies for appropriate infection control is always warranted.[6] We report the transmission of VZV infection among healthcare staff and patients admitted in one of the ICUs of a tertiary care hospital of North India and define the infection control measures initiated to curtail the spread of the disease within the ICU and among HCPs, as well as the additional measures put in place by the institute to prevent future outbreaks.

Outbreak Report

One of the staff nurse posted in Trauma ICU of our institute gave history of fever followed by vesicular lesions on face, chest, and back, which later spread to the whole body. She was clinically suspected to have varicella and was quarantined. During that time there were 12 patients admitted in the ICU, all of whom were on ventilatory support. Fifty-four HCPs were posted in the ICU during this time. Two days later, two more staff nurses and two resident doctors posted in the ICU developed varicella infection. The blister fluid from their active lesions was tested for the presence of VZV DNA, which was reported as positive. The DNA was extracted from the vesicular swabs using commercially available kit (Qiagen, Hilden, Germany) and then subjected to Polymerase Chain Reaction (PCR) targeting ORF28 gene of VZV. The PCR was performed in 25 μL volume reactions containing 5 μL of DNA. The reaction mixture consisted of 1X PCR buffer (10 mM Tris with 15 mM MgCl2), 1 μM of each primer, 200 μM of dNTPs, and 0.5 U Taq polymerase. The thermocycler conditions were 94°C for 3 min followed by 39 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 45 s and final extension at 72°C for 3 min. The amplicons of 355 bp were visualized by gel electrophoresis using 2% agarose gel followed by ethidium bromide staining.[7] The following primers were used: Forward primer: 5'ATCGCGGCTTGTTGTTTGTC TAAT3'. Reverse primer: 5'GGGCGAAATGTAGGATATAA AGGA3'. An outbreak of varicella was confirmed among the health care workers of the ICU. The measures opted to prevent further spread were isolation of suspected patients, microbiological assessments and post-exposure vaccination of susceptible HCPs. Antiviral chemoprophylaxis was initiated in critically ill patients who were found to be susceptible to varicella as evidenced by VZV seronegative IgG levels. It was decided to restrict fresh intake of patients in ICU and to retain the admitted patients in the ICU itself for three weeks since the last fresh case. It was advised that these patients should be discharged home directly without shifting them to a step-down facility to prevent the spread of infection. The rotational duty of the doctors was canceled and same staff was asked to continue working in the ICU to prevent spread of infection among HCPs including resident doctors and nursing students who may further spread it to their hostel inmates. Further, an alternative interim arrangement was created, in a separate area, to cater to needs of newly admitted patients requiring critical care. The number of attendants were restricted to only two per patient and these were the ones who had either previously suffered from chickenpox or were found to be immune to chickenpox (as shown by protective VZV IgG titers). The HCPs who did not give a past history of chickenpox were screened for the presence of VZV IgG antibodies and 14 (25.92%) of total of 54 HCPs were found to be susceptible. They were also tested for the presence of VZV IgM antibodies and seronegative HCPs were offered 2 doses of varicella vaccination within 3-5 days of exposure. A total of two doses were given subcutaneously four weeks apart after ruling out contraindications to the vaccine. The HCPs who gave a history of varicella and had evidence of immunity were asked to continue working and were monitored daily for symptoms or signs of varicella, within 8 to 21 days of exposure. Line listing for every case, patient details, place and time of occurrence, and infection details were done. An intensive review of infection control measures was made and general control measures viz. strict hand washing, intensification of environmental cleaning and hygiene measures, adherence to aseptic protocols, strengthening of disinfection and sterilization measures were initiated at once. Measures taken to contain VZV outbreak in the ICU have been summarised in Figure 1.
Figure 1

Steps Followed to Contain the VZV Outbreak in Trauma Intensive Care Unit

Steps Followed to Contain the VZV Outbreak in Trauma Intensive Care Unit The efficacy of control measures was evaluated by a continued follow-up of cases after outbreak, as well as microbiologically. Control measures were found to be clinically effective as number of cases ceased to occur within 15 days of the occurrence of first case. Though, out of the total of 54 HCPs, five got infected in the outbreak over a period of 36 days, yet, with strict implementation of safety control measures, none of the patients admitted in ICU got infected. Out of the 12 patients admitted in the ICU, six patients were discharged and sent home directly, four patients expired due to their critical disease state, one patient left against medical advice, and one patient remained admitted in ICU till incubation period was over. The ICU was re-opened for fresh admissions after three weeks had lapsed since the occurrence of the last fresh case.

Discussion

Varicella outbreak is defined as occurrence of five or more cases in epidemiologically linked setting.[8] According to the CDC case classification, VZV case is confirmed when laboratory testing or clinical case definition is met and is epidemiologically linked to a confirmed or a probable case.[9] Cases should be considered as a part of an outbreak if they occur within at least one incubation period (10–21 days) of the previous case-patient.[8] For effective disease containment, it is recommended that the surveillance measures should continue through 21 days after the rash onset of the last identified patient to ensure that the outbreak has ended.[810] In our setting, the point source for the outbreak was an HCP, who was exposed to infection and later propagated the infection in this closed ICU environment. The index case possibly acquired the infection 10-14 days prior to the onset of fever and vesicular rash. Since the number of cases also depends on the individual susceptibility, only five HCPs got infected during the outbreak [Figure 2] and the outbreak was curtailed due to timely post-exposure vaccination and implementation of strict isolation measures.
Figure 2

Epidemic Curve of Varicella-Zoster Virus Infection

Epidemic Curve of Varicella-Zoster Virus Infection The present case study demonstrated the significance of assessing HCPs' susceptibilities to VZV infection before exposing them to situations with increased risk of infection acquisition. It is well understood that acquisition of VZV infection is an occupational hazard among HCPs, especially those with no immunity to infection. In the present outbreak as the first case was diagnosed, all the HCP working in ICU were tested for VZV IgG levels and those found to be seronegative were given post-exposure vaccination. As per the CDC guidelines, persons having no evidence of immunity should be given prophylactic vaccine within 3–5 days of exposure. HCPs who have received one dose of varicella vaccine earlier should receive the second dose within 3–5 days after exposure to rash, if more than four weeks have passed since receipt of the first dose. Further, HCPs who have received two doses of varicella vaccine earlier and are exposed to varicella should be monitored for clinical status on daily basis from 8 to 21 days after exposure.[1112] Although post-exposure vaccination was considered an encouraging solution, there are contrary reports which state that its real-life efficacy is not equivalent to that reported in earlier studies.[13] Thus, it emphasizes the need for stringent preventive measures in averting outbreaks of VZV among HCPs.

Review of literature

VZV outbreaks occur worldwide, with epidemics befalling every 2–3 years.[14] Usually, in healthy children most of the varicella infections are mild, self-limiting, and uncomplicated and treatment is usually confined to symptomatic relief.[15] Though early antiviral therapy can reduce illness duration; however, it is reserved for those with severe varicella or for those who are considered at greater risk of developing complications owing to age, compromised immunity or chronic diseases of the skin or lungs.[14] Varicella epidemiology has changed dramatically, especially in countries where varicella vaccination has been routinely recommended in childhood. Before the varicella vaccination, approximately there used to be 4 million cases, 10,500 hospitalizations and 105 deaths each year,[16] whereas the introduction of the vaccine has dramatically improved quality of life and there has been a substantial decline in morbidity and mortality. In the Indian scenario, however, VZV vaccine is still not included in the Universal Immunisation Programme of India, and hence, sporadic outbreaks are still reported.[17] The detection and quantification of viral load during varicella infection may be potentially useful for diagnostic, prognostic and therapeutic monitoring purposes. An early diagnosis in an outbreak situation is desirable for prompt initiation of control measures so as to prevent further spread of the outbreak. Such outbreaks have been reported earlier also and have been managed by following early infection outbreak control measures, infection containment, prophylactic and post-exposure vaccination, and strictly implementation of basic infection control orientation programs.[131618] Alanazi et al.[18] have described measures taken to contain varicella outbreak among patients and HCPs in a psychiatric hospital of Saudi Arabia. The authors reported controlling the outbreak as per their Ministry of Health guidelines. Similar outbreak has also been reported in a residential facility for adults with intellectual disability in Connecticut.[19] Galil et al.[13] investigated an outbreak of varicella in a population of children with a high proportion of vaccinees who were attending a day-care center in a small community in New Hampshire. The authors concluded that vaccination provided poor protection against varicella, although there was good protection against moderate or severe disease, with a longer interval since vaccination being associated with an increased risk of vaccine failure. Sarit et al.[6] reported an outbreak of varicella infection among the HCPs in the pulmonary ICU of a tertiary care hospital. The authors investigated the outbreak as per the guidelines and suggested that appropriate dissemination of information on disease transmission, isolation of infected patients, and adequate protection for susceptible employees was important in preventing such outbreaks

Conclusions

The outbreak emphasized that maintenance of high index of suspicion is one of the earlier requirements for triaging. The information, education, and communication activities of HCPs, patients and their attendants should be undertaken to make them aware about varicella transmission, reasons for isolation and preventive measures that need to be undertaken. CDC also emphasizes upon that future outbreaks of varicella can be mitigated by ensuring high levels of varicella immunity, vaccinating the ones having no evidence of immunity, varicella surveillance and reporting, establishing as well as maintaining an appropriate response whenever a case is identified in any setting.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.
  14 in total

1.  A 2009 varicella outbreak in a Connecticut residential facility for adults with intellectual disability.

Authors:  Jessica Leung; Kathy Kudish; Chengbin Wang; Latetia Moore; Paul Gacek; Kay Radford; Adriana Lopez; Lynn Sosa; D Scott Schmid; Matthew Cartter; Stephanie Bialek
Journal:  J Infect Dis       Date:  2010-10-07       Impact factor: 5.226

2.  An outbreak of cadaver-acquired chickenpox in a health care setting.

Authors:  Navin Paul; Mini E Jacob
Journal:  Clin Infect Dis       Date:  2006-07-27       Impact factor: 9.079

3.  Varicella among adults: data from an active surveillance project, 1995-2005.

Authors:  Mona Marin; Tureka L Watson; Sandra S Chaves; Rachel Civen; Barbara M Watson; John X Zhang; Dana Perella; Laurene Mascola; Jane F Seward
Journal:  J Infect Dis       Date:  2008-03-01       Impact factor: 5.226

4.  Outbreak of varicella at a day-care center despite vaccination.

Authors:  Karin Galil; Brent Lee; Tara Strine; Claire Carraher; Andrew L Baughman; Melinda Eaton; Jose Montero; Jane Seward
Journal:  N Engl J Med       Date:  2002-12-12       Impact factor: 91.245

Review 5.  Preventing varicella-zoster disease.

Authors:  Sophie Hambleton; Anne A Gershon
Journal:  Clin Microbiol Rev       Date:  2005-01       Impact factor: 26.132

6.  Epidemiologic lessons: chickenpox outbreak investigation in a rural community around Chandigarh, North India.

Authors:  Mini Pritam Singh; Gagandeep Singh; Amit Kumar; Amarjeet Singh; Radha Kanta Ratho
Journal:  Indian J Pathol Microbiol       Date:  2011 Oct-Dec       Impact factor: 0.740

Review 7.  Acyclovir for treating varicella in otherwise healthy children and adolescents.

Authors:  T P Klassen; L Hartling; N Wiebe; E M Belseck
Journal:  Cochrane Database Syst Rev       Date:  2005-10-19

Review 8.  Varicella zoster virus infection.

Authors:  Anne A Gershon; Judith Breuer; Jeffrey I Cohen; Randall J Cohrs; Michael D Gershon; Don Gilden; Charles Grose; Sophie Hambleton; Peter G E Kennedy; Michael N Oxman; Jane F Seward; Koichi Yamanishi
Journal:  Nat Rev Dis Primers       Date:  2015-07-02       Impact factor: 52.329

9.  Investigation of an outbreak of varicella in Chandigarh, North India, using a real-time polymerase chain reaction approach.

Authors:  Mini P Singh; Ramanpreet Kaur; Archit Kumar; Madhu Gupta; Shubha Garg; R K Ratho
Journal:  Indian J Med Microbiol       Date:  2017 Jul-Sep       Impact factor: 0.985

Review 10.  Implementation of Hospital Policy for Healthcare Workers and Patients Exposed to Varicella-Zoster Virus.

Authors:  Si-Hyun Kim; Sun Hee Park; Su-Mi Choi; Dong-Gun Lee
Journal:  J Korean Med Sci       Date:  2018-08-27       Impact factor: 2.153

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.