Long non-coding RNA LINC00607 silencing exerts antioncogenic effects on thyroid cancer through the CASP9 Promoter methylation.

Thyroid cancer (TC) was the most frequent thyroid malignant tumour, accounting for about 1% of all malignant tumours. Some long non-coding RNAs (lncRNAs) have been reported to exert essential tumour promotion effects, while caspase-9 (CASP9) gene could play a promotive role in the cell apoptosis in TC. However, whether they have a specific effect on TC remains unclear. Hence, this study aims to explore the relationship between LINC00607 and CASP9, and its effect in TC. LINC00607 expression in the TC tissues and cell lines was determined. Then, we explored the combination effect between a LINC00607 and a methylation inhibitor 5-Aza-dc in doxorubicin-resistant ARO cells using colony formation assay, flow cytometry, WST-1 and EdU assay, as well as in vivo tumour growth assay. Besides, the dual-luciferase reporter gene assay, RIP, ChIP, methylation-specific PCR and BSP method were employed to detect the relationship between LINC00607 and CASP9 and its methylation. LINC00607 expression was up-regulated in the doxorubicin-resistant TC cell lines and tissues and negatively correlated to the poor prognosis of TC patients. Knockdown of LINC00607 suppressed doxorubicin resistance, proliferation and colony formation, and promoted cell apoptosis of TC cells in vitro, as well as suppressed tumour growth in vivo, whereas LINC00607 overexpression was observed to exercise the opposite effects. Notably, it was also revealed that LINC00607 down-regulated the CASP9 expression by promoting CASP9 promoter methylation. In conclusion, LINC00607 could inhibit the apoptosis and augment the doxorubicin resistance of TC cells by decreasing CASP9 expression, which might provide a novel therapeutic target for TC treatment.

INTRODUCTION

Thyroid carcinoma (TC) is a commonly diagnosed endocrine malignancy, with alarmingly rises in its incidence rate worldwide., Meanwhile, the associated mortality with TC has increased in the last few decades. Besides, only a small proportion of these patients (10‐30%) experienced recurrent disease and some patients died from TC eventually. Typically, the clinically approved treatment protocols such as surgery, radioactive iodine ablation are effective; however, they elicit a poor prognosis. Furthermore, with the increasing resistance against the conventional chemotherapeutic agents, particularly doxorubicin, an extensively used chemotherapeutic, played a vital role in the resistance of cancer. Therefore, this study attempted to research a new therapeutic protocol at the molecular level to lower the doxorubicin resistance of patients with TC.

Long non‐coding RNAs (lncRNAs) are involved in many aspects of cellular metabolism, such as cell tumorigenesis, proliferation, apoptosis and drug resistance. Several lncRNAs, such as MALAT1, H19, BANCR and HOTAIR, have elicited functionality as vital contributors to cancer progression, which could be adopted as novel biomarkers for early diagnosis or treatment of TC. For example, overexpression of n340790 induced the development in TC while n340790 accelerated the growth of TC tumour. Caspase‐9 (CASP9), an initiator caspase of the intrinsic apoptotic cascade, is closely associated with oxidative stress via disulphide formation. Hence, CASP9 is regarded as a critical therapeutic target of various disorders associated with apoptosis, including cancer. For instance, lncRNA POU3F3 could potentiate proliferation and repress the apoptosis of triple‐negative breast cancer cells by manipulating the CASP9 expression. In a study based on TC, Jirka Grosse et al. have reported a combination protocols of radiation with sunitinib treatment could increase the level of CASP9 in TC cells and induce cancerous cell apoptosis. Notably, the aberrant DNA methylation of oncogenes and the tumour suppressors have been reported in TC, including DAPK, PTEN, as well as TIMP3. An existing study identified LINC00607 to be highly expressed in TC upon application of bioinformatics to analyse the gene expression in TC. However, only a limited number of studies focused on the regulatory role of LINC00607 in the CASP9 promoter methylation and in the cancerous cell development in TC. Thus, we speculated the existence of a promising correlation among LINC00607, CASP9 methylation and the development of cancer cells. Therefore, the aim of this study is to investigate the influence of LINC00607 on the drug resistance and apoptotic ability of TC cells through its regulation on CASP9 methylation, in an attempt to provide a novel theoretical insight for the treatment of TC.

MATERIALS AND METHODS

Study subjects

From a period between September 2016 and September 2017, 47 specimens were harvested from patients who underwent thyroid surgery at the Institutional Review Board of Linyi People’s Hospital. All patients were diagnosed as TC by pathological examination and were treated with doxorubicin. The collected specimens were classified into 2 categories as resistance (n = 18) and sensitive (n = 29) and both were refrigerated at ‐80℃. In the study, the clinical data and follow‐up data (60 months) of the patients, excluding those who died of other ailments or accidents, were provided. The time period from the beginning of the treatment to the day of expiry was defined as the overall survival (OS) analysed by Kaplan‐Meier method. The end point was tumour recurrence, death of the patient or the last follow‐up time. Written informed consent was provided by all patients participating in this study. The used specimens were approved by the Institutional Review Board of Linyi People’s Hospital.

Cell culture and establishment of doxorubicin‐resistant cells

Three human anaplastic TC cell lines ARO, FRO and CAL‐62 (American Type Culture Collection, Manassas, VA, USA) were cultured in Roswell Park Memorial Institute (RPMI) medium containing 10% foetal bovine serum (FBS) 1640 (Sigma, San Francisco, CA, USA). Meanwhile, the human normal thyroid cell line Nthy‐ori 3‐1 (BNCC340487; BeNa Culture Collection, China) was cultured using Dulbecco's Modified Eagle's medium (DMEM) containing 10% FBS (Sigma, San Francisco, CA, USA). All cells were cultured at 37°C under a humidified atmosphere of 5% CO2, and passaged for 2 to 3 days. Next, cells in the logarithmic phage were used for subsequent experimentation.

After conventional recovery, the cells were sustained in RPMI‐1640 complete medium containing 10% FBS, 100 U/L penicillin and 100 mg/L streptomycin in a 5% CO2 incubator at 37℃. The medium was changed every 2 days. Doxorubicin of various concentrations ( 0.1, 0.2, 0.3, 0.4 and 0.5 μg/mL) was used to treat the TC cell lines ARO, FRO and CAL‐62 for 24 h to observe the growth stability. In addition, water‐soluble tetrazolium salt (WST‐1) method was adopted to compare the resistance of all cell lines by IC50, and then the cell lines with high resistance were selected for subsequent experimentation.

RNA‐fluorescence in situ hybridization (FISH)

LINC00607 subcellular location was provided by the bioinformatics website (http://lncatlas.crg.eu/). FISH was applied to identify LINC00607 subcellular localization in the TC cell lines. According to the RiboTM lncRNA FISH probe Mix (Red) (RIBOBIO, Guangzhou, Guangdong, China), TC cells were cultured in a 6‐well plate for 1 d and fixed using 1 mL 4% paraformaldehyde at room temperature upon cell coverage with 80% microscopic view. After treatment with protease K (2 μg/mL), glycine and acetylating agent, the sections were incubated with 250 μL prehybridization solution at 42℃ for 1 h, then 250 μL hybridization solution containing probe (300 ng/mL) at 42℃ overnight. Next, the cells were stained with a combination of 4',6‐Diamidino‐2‐Phenylindole diluted and phosphate‐buffered saline (PBS)/Tween at a ratio of 1:800 for 5 min. Finally, the cells were sealed with an anti‐fluorescence quenching agent and observed from five randomly selected microscopic fields (Olympus Corporation, Tokyo, Japan).

Cell vector construction and transfection

LINC00607 cDNA full‐length sequence, siRNA sequence (Thermo Fisher Scientific Inc., Waltham, MA, USA) and its control sequence with KpnI and XhoI restriction enzyme sites were designed, synthesized and connected with the lentiviral expression vector pLVX‐IRES‐neo (Vigenebio, Rockville, MA, USA) using T4 ligase and introduced with the competent E coli. Next, the cells were incubated at 37℃ for 24 h to extract the plasmids. The eukaryotic expression vectors of LINC0000607 and its siRNA were constructed after sequencing. Upon attaining 80‐90% cell confluence, the cells were infected with LINC00607‐cDNA, si‐LINC00607, or their negative controls (NCs) using Lipofectamin2000 (Invitrogen Corporation, Carlsbad, CA, USA). In the experiment of demethylation, the cells were treated with a DNA methyltransferase (DNMT) inhibitor 5‐Aza‐dc (2 μM) or dimethylsulphoxide (DMSO) solely or in the presence of oe‐LINC00607. The sequence of si‐LINC00607 was 5’‐GGACCAAGAUGAAGAGAUA‐3’, and the sequence of scrambled siRNA was 5’‐GCACTACTGTCGATGACGA‐3’ (used as the NC). The oe‐NC was an empty vector without the target sequence.

Dual‐luciferase reporter gene assay

The wild‐type (wt) and mutant (mut) sequences of CASP9 3’‐untranslated regions (3’‐UTR) were amplified, which were provided by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). The wt sequences were as follows: (1) 5’‐TTTAGACAGATATATATATT‐3’ and (2) 5’‐TTCTTTGTTTC‐3’, while the mut sequences were as follows: (1) 5’‐TTTAGACAGAATATATTATT‐3’ and (2) 5’‐TTCAAAATTC‐3’. Next, the CASP9‐wt‐1/CASP9‐wt‐2 and CASP9‐mut‐1/CASP9‐mut‐2 plasmids were constructed by double digestion with XhoI and NotI and ligating psi‐Cpsi‐CHECK‐2 vectors (Promega, Madison, WI, USA) using the T4 DNA ligase. According to the RiboFECTTMCP transfection reagent (RIBOBIO, Guangzhou, Guangdong, China), TC cells plated in a 24‐well plate were transfected with 200 nmol/L empty vector plasmids (NC) or LINC00607 and 100 ng plasmids (CASP9‐wt or CASP9‐mut) for 48h. The luciferase activity was evaluated after cell transfection and lysis using a Firefly Luciferase Reporter Gene Assay Kit (RG005, Beyotime, Shanghai, China) and a microplate reader (MK3, Thermo Fisher Scientific Inc., Waltham, MA, USA) at 560nm. Three parallels were set for each experiment.

WST‐1 assay

Cells in the logarithmic growth period were cultured in a 96‐well plate at a density of 2 × 105 cell/mL in a 0.1 mL volume for 6 h. Doxorubicin of variable concentrations (0.1, 0.2, 0.3, 0.4 and 0.5 μg/mL) was added to the experiment group, while the control group was cultured with the same volume of culture medium in a 5% CO2 incubator at 37℃ for 24 h. A minimum of 3 parallel wells were set in each group. Cell viability was detected using a WST‐1 kit (Roche Applied Science, Upper Bavaria, Germany). One hour before each measurement, 100 µL Dulbecco’s modified Eagle’s medium and 10 µL WST‐1 solution were added successively, the absorbance (A) value at the wavelength of 450 nm was documented using a microplate reader. The inhibitory concentration IC50 was calculated to compare the resistance.

Colony formation assay

TC cells transfected with different plasmids were detached using 0.25% trypsin, and dispersed in 10 mL culture medium (200 cells in each group). After 3 weeks, colony formation had begun. Then the cells were fixed with 4% paraformaldehyde for 15 min, and stained using 0.1% crystal violet for 10 min. Colony formation rate was calculated using the following equation: (the number of colonies formed/ numbers of seeded cells) × 100%.

Flow cytometry

At 48 h post‐transfection, the cells were trypsinized and dispersed into the cell suspension at 1 × 106 cell/mL. A total of 1 mL suspension was centrifuged at 1500 r/min for 10 min and centrifuged again with 2 mL PBS. Subsequently, pre‐chilled 70% ethanol solution was added for overnight fixation of cells at 4℃. A total of 100 μL of the cell suspension (1 × 106 cell/mL) reacted with 1 mL 50 mg/L propidium iodide (PI) containing RNAase for 30 min under conditions devoid of light and filtered. A flow cytometer was used to document the cell cycle detection under red fluorescence at the excitation wavelength of 488 nm.

The cells were trypsinized and centrifuged at 800 r/min for 5 min. According to the provided protocol of the Annexin V‐fluorescein isothiocyanate (FITC) cell apoptosis detection kit (K201‐100, BioVision, Inc., Exton, PA, USA), the cells were resuspended using 200 µL binding buffer and incubated with 10 µL PI staining solution and 5 µL Annexin V‐FITC for 15 min at room temperature under conditions devoid of light. Finally, a flow cytometer (Becton, Dickinson and Company, Franklin, NJ, USA) was used to detect the DNA content of cells at a wavelength of 488 nm.

RNA‐immunoprecipitation (RIP) assay

According to the Millipore Magna RIPTM KIT kit (Millipore, Boston, MA, USA), the cells were lysed with the lysis buffer for 30 min on ice and centrifuged at 12000 rpm for 3 min at 4℃. A small portion of the supernatant was taken as the positive control of Input and supplemented with 1 μg of the corresponding antibody against protein of interest, rabbit antibodies against DNMT1 (ab13537), DNMT3a (ab2850), DNMT3b (ab2851) or an IgG mouse antibody (negative control) overnight with rotation at 4°C. All antibodies were provided by Abcam (Cambridge, UK). The remaining supernatant was incubated with 10‐50 µL protein A/G magnetic beads overnight 4°C with rotation and centrifuged at 4℃ for 5 min at 3000 rpm. Protein A/G‐beads were rinsed 3‐4 times with 1 mL of the lysis buffer, centrifuged at 1000 rpm for 1 min at 4℃ and boiled with 15 μL 2 × sodium dodecyl sulphate (SDS) loading buffer for 10 min. The isolated and purified relevant RNA from the precipitate by the RNA extraction method, and the reverse transcription quantitative polymerase chain reaction (RT‐qPCR) was performed with the LINC00607‐specific primer (Table 1) to verify the interactions between DNMT1, DNMT3a, DNMT3b and LINC00607.

TABLE 1

Primer sequences

Gene	Forward primer (5' ‐ 3')	Reverse primer (5' ‐ 3')
LINC00607	GACGCTGTAGGAAGAGGATTG	AGTAATGGTGGTGGTGGAAAC
CASP9	CTTCGTTTCTGCGAACTAACAGG	GCACCACTGGGGTAAGGTTT
Bax	CCCGAGAGGTCTTTTTCCGAG	CCAGCCCATGATGGTTCTGAT
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
MDR1	TTGCTGCTTACATTCAGGTTTCA	AGCCTATCTCCTGTCGCATTA
BSP‐CASP9	GTGGAAGAGTTGTAGGTGGATTAGT	GTGGAAGAGTTGTAGGTGGATTAGT
MSP‐CASP9‐Non‐methylation	GGTTATTCGTTATGGACGAAGC	ATATAAAACCTAAACAACTCGCGAC
MSP‐CASP9‐Methylation	TGAGTATGGAGTTTTGTGGTTATTG	AACCAACACCATTTTCTTAACAATC

Chromatin Immunoprecipitation (ChIP) assay

The enrichment of DNMT1, DNMT3a and DNMT3b in the promoter region of CASP9 gene was analysed using a ChIP Kit (Millipore, Boston, MA, USA). Upon attaining 70‐80% confluence, the TC cells were fixed using 1% formaldehyde for 10 min to induce crosslinking. The ultrasonic breaker was set to 10 s per ultrasonic cycle with 10‐s intervals with 15 cycles to break the chromatin. Next, the cells were centrifuged at 13000 rpm at 4℃. The collected supernatant was grouped into three tubes, and incubated with the positive control antibody RNA polymerase Ⅱ, IgG and rabbit antibodies to DNMT1 (ab13537), DNMT3a (ab2850), DNMT3b (Ab2851) overnight at 4℃. All antibodies were provided by Abcam (Cambridge, UK). Then endogenous DNA‐protein complex was precipitated by Protein Agarose/Sepharose and centrifuged to discard the supernatant. The non‐specific complex was rinsed, and the crosslinking was reversed at 65℃ overnight. The DNA fragments were extracted and purified by phenol/chloroform. Finally, the binding of DNMT1, DNMT3a, DNMT3b to the CASP9 promoter regions was measured by CASP9 promoter region‐specific primers (Table 1).

Methylation‐specific PCR (MSP)

Genomic DNA content was extracted from the TC tissues and cells and modified with bisulphite. Then MSP was added to detect methylation of the modified DNA. Partially modified total DNA content was supplemented with the CASP9 gene methylated and non‐methylated primers (for CpG‐rich islands) for PCR amplification (Table 1). PCR reaction conditions were as follows: pre‐denaturation for 10 min at 95℃; a total of 35 cycles for at 95℃ for 45 s, at 56 ℃ (methylation)/at 45 ℃ (non‐methylation) for 45 s, at 72℃ for 45 s and extended for 10 min at 72℃. The reaction products were subjected to agarose gel electrophoresis and photography for image analysis.

Bisulphite sequencing PCR (BSP) assay

The lytic DNA content was denatured with 2 mol/L NaOH (final concentration 0.3 mol/L) for 15 min at 150 r/min at 37℃ and mixed with 2‐fold volume melted at 75℃ low melting point 2% agarose to form beads (about 6 μL). The beads were then incubated with the freshly prepared bisulphite solution for 14 h at 80 r/min at 50℃ under conditions devoid of light. BSP was terminated by addition of 500 μL of the TE buffer (pH = 8) to equilibrate for 4 times (15 min each time). Subsequently, the beads were incubated two times with 500 μL of 0.3 mol/L NaOH at 37℃ (15 min each time) to de‐sulphonate. The beads after a rinse were directly used as PCR templates for PCR amplification. The purified PCR product was cloned into the pGEM‐T Easy vector (Promega, Madison, WI, USA) for sequencing. PCR primers were designed on the basis of CpG island on the positive chain of the CASP9 gene by an online website (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi) (Table 1).

5‐ethynyl‐2'‐deoxyuridine (EdU) assay

TC cell lines in the logarithmic growth phase were seeded into 96‐well plates at a density of 2 × 103 ‐ 4 × 104. After 24 h, the adherent cells to the wells were transfected. Three parallel wells were set up for each group. Cells in each well after transfection for 48 h were cultured with 100 μL EdU medium for 2 h and fixed with 100 μL of cell fixation solution for 30 min at room temperature. Subsequently, the cells were incubated with 2 mg/mL glycine for 5 min, rinsed with 100 μL of PBS containing 0.5% TritonX‐100 for 10 min, and stained using 1 × Apollo staining reaction solution for 30 min in conditions devoid of light. Next, the cells were reacted with 100 μL of the 1 × Hoechst 33342 reaction solution for 30 min and sealed with 100 μL of the anti‐fluorescence quenching agent. Six to ten fields of view were randomly selected for each well and photographed under a fluorescence microscope.

Tumour formation assay

A total of 30 BALB/c female nude mice (weighing 16 ± 2g, aged 3‐4 weeks; purchased from Beijing Huiao Biotechnology Co., Ltd., Beijing, China) were housed at 25‐27℃ and under saturated humidity of 45%‐50%, and randomly grouped into five groups with 6 mice in each group. Upon attaining 80%‐90% cell confluence, the cells were trypsinized and centrifuged. Briefly, on day 1, 20 µL cell suspension (1 × 107 cells) was subcutaneously inoculated into the thighs of the nude mice. Consequently, the size of the tumours was measured, the tumour volume was calculated based on the following formula: Volume (V) = (a × b2)/2 (a: the longest diameter of the tumour; b: the shortest diameter of the tumour). At 5 weeks post‐cellular injection, the mice were euthanized. The tumours were excised and the weights of the tumours were documented to plot the tumour growth curve. The experimental procedure involving these animals was conducted in compliance with the recommendations of the Guide for the Care and Use of Laboratory Animals by the National Institutes of Health. The experimental study design was permitted by the Animal Care and Use Committee of Linyi People’s Hospital.

Total RNA isolation and quantitative real‐time PCR

Total RNA content in the tissues and cells was extracted by Trizol (Invitrogen, Carlsbad, CA, USA). RNA concentration was determined using an ultraviolet spectrophotometer. RNA was reversely transcribed into cDNA using a PrimeScript RT kit (RR014A, Takara Biotechnology Ltd., Dalian, Liaoning, China). Primer5.0 software was used to design the primers (Table 1), which were synthesized by Genscript (Nanjing, Jiangsu, China). RT‐qPCR reaction was conducted in accordance with a PCR kit (KR011A1, Beijing Tiangen Biotech Co., Ltd., Beijing, China). The relative gene expression was calculated based on the 2−ΔΔCt method.

Western blot analysis

Tissue specimens of mice preserved in liquid nitrogen of each group were lysed with complete protein lysis buffer on ice for 10 min, and quantified with a bicinchoninic acid quantification kit (MultiScience (LIANKE) Biotech, Co., Ltd., Hangzhou, Zhejiang, China). Through SDS‐polyacrylamide gel electrophoresis, the protein was transferred onto a nitrocellulose membrane. Following membrane blockade using 5% bovine serum albumin in Tris‐buffered saline with Tween for 60 min, the membrane was incubated overnight at 4˚C with the corresponding primary antibody, rabbit anti‐human antibodies against CASP9 (ab32539, 1,1000), Bax (ab32503, 1,1000), multi‐drug resistance 1 (MDR1; ab168337, 1,2000), glyceraldehyde‐3‐phosphate dehydrogenase (ab128915, 1,10000). Following incubation, the membrane was incubated with the secondary antibody, horseradish peroxidase‐conjugated goat anti‐rabbit antibody against IgG H&L (HRP) (ab6721, 1,2000) for 120 min at room temperature, and developed with enhanced chemiluminescence. The antibodies were acquired from Abcam (Cambridge, UK). The quantitative analysis of band grey value was performed by the Quantity One software.

Statistical analysis

All statistical analyses were conducted using the SPSS 21.0 software (IBM Corp. Armonk, NY, USA). Measurement data were presented as the mean ± standard deviation. Differences between two groups were compared by the unpaired t test. Differences among groups were determined by one‐way analysis of variance (ANOVA) with Tukey’s post hoc test. Besides, the cell viability at different time points was compared by two‐way ANOVA, and tumour data at different time points were compared by repeated measures ANOVA, followed by the Bonferroni post hoc test. The OS of patients with high or low expression of LINC00607 was calculated by the Kaplan‐Meier survival analysis, and the Log‐rank test was applied. In all statistical calculations, a value of P < .05 demonstrated statistical significance.

RESULTS

LINC00607 is highly expressed in TC and related to a poor prognosis

The expression pattern of LINC00607 in the tissues of the resistance and sensitive groups was measured using RT‐qPCR. Results showed the expression pattern of LINC00607 in the sensitive patients was significantly lower compared to the patients that showed resistance (P < .05; Figure 1A). Through prognostic analysis of patients with different expression patterns of LINC00607, it was identified that the prognosis of LINC00607 with a lower expression pattern was superior (Figure 1B). Next, doxorubicin was applied to the TC cell lines (ARO, FRO and CAL‐62) for resistance detection. The results are shown in Figure 1C. In comparison to the FRO and CAL‐62 cells, ARO was the least sensitive to doxorubicin (P < .05). To further validate the correlation between the LINC00607 expression pattern and resistance of TC, the expression pattern of LINC00607 in the ARO, FRO and CAL‐62 cells was detected by RT‐qPCR (Figure 1D). The data indicated that the expression pattern of LINC00607 in the FRO and CAL‐62 cells was significantly reduced compared to the ARO cell line (P < .05). These results illustrated that LINC00607 was highly expressed in TC, and the ARO cell line was chosen for subsequent experimentation.

FIGURE 1

LINC00607 is up‐regulated in doxorubicin‐resistant TC cells and negatively related to the prognosis of patients. A, expression pattern of LINC00607 in TC tissues by RT‐qPCR (Resistance, n = 18; Sensitive, n = 29), *P < .05 vs the resistance group; B, the correlation between OS of patients with TC and expression of LINC00607 evaluated by Kaplan‐Meier; C, IC50 value in TC cells, *P < .05 vs the ARO cells. D, pattern expression of LINC00607 in ARO, FRO, and CAL‐62 cells by RT‐qPCR, *P < .05 vs the ARO cells. The experiment was conducted 3 times independently. The data were presented as mean ± standard deviation

LINC00607 silencing decreases resistance to doxorubicin in TC cells

The ARO cell line with the highest resistance was selected for this experiment. Then the lentiviral vectors were used to construct a stable cell line expressing oe‐LINC00607 or si‐LINC00607, respectively. RT‐qPCR was applied to assess the expression pattern of LINC00607 in each group (Figure 2A). In comparison with the cells without treatment, the expression pattern of LINC00607 in cells with the treatment of oe‐NC and si‐NC elicited no significant difference (P > .05). The expression pattern of LINC00607 in cells with treatment of oe‐LINC00607 was significantly increased (P < .05), while the expression pattern of LINC00607 in cells with treatment of si‐LINC00607 was prominently reduced (P < .05), thereby indicating successful infection. The cell viability and IC50 value after doxorubicin treatment in each group was measured using the WST‐1 method (Figure 2B, C). Relative to the cells without treatment, no vital difference was evident between the cell viability and IC50 value in cells with the treatment of oe‐NC and si‐NC (P > .05); however, oe‐LINC00607 contributed to the significantly increased cell viability and IC50 value (P < .05), while si‐LINC00607 led to conflicting results (P < .05). EdU and colony formation assays revealed that (Figure 2D, E), compared to cells without treatment, no significant difference was evident in the proliferation and colony formation ability of cells with treatment of oe‐NC and si‐NC (P > .05). Cell proliferation and colony formation were significantly increased in the LINC00607‐overexpressing cells compared with the oe‐NC‐transfected cells (P < .05). On the contrary, the cell proliferation and colony formation were significantly suppressed following treatment with si‐LINC00607 (P < .05). Expression pattern of MDR1 was measured using RT‐qPCR and Western blot analysis (Figure 2F‐H). In comparison to the cells without treatment, no significant difference was identified between the expression pattern of MDR1 in cells with treatment of oe‐NC and si‐NC (P > .05). However, the mRNA and protein expressions of MDR1 in cells with treatment of oe‐LINC00607 were noticeably up‐regulated (P < .05), while was significantly down‐regulated in cells with treatment of si‐LINC00607 (all P < .05). Altogether, these data suggested that LINC00607 down‐regulation might resensitize TC cells to doxorubicin in vitro.

FIGURE 2

si‐LINC00607 decreases resistance to doxorubicin in TC. ARO cells under the exposure to doxorubicin were treated with oe‐LINC0060 or si‐LINC00607. A, expression pattern of LINC00607 cells in each group by RT‐qPCR; B, the cell viability of cells in each group by WST‐1 method; C, the IC50 value of cells in each group by WST‐1 method; D, EdU images of cells proliferation ability in each group; E, the clone formation ability assessed by colony formation experiment; F, the mRNA expression pattern of MDR1 in each group of cells using RT‐qPCR; G, the protein bands of MDR1 by Western blot analysis; H, the protein expression pattern of MDR1 by Western blot analysis; *P < .05 vs cells with the treatment of oe‐NC; #P < .05 vs cells with treatment of si‐NC. The experiment was conducted 3 times independently. The data were presented as mean ± standard deviation

si‐LINC00607 increases apoptosis rate in TC cells

Furthermore, we adopted flow cytometry analyses to assess the effect of LINC00607 on ARO cell cycle and apoptosis (Figure 3A, B). The rates of G0/G1 phases and apoptosis were higher in the forced expression of LINC00607 of ARO cells compared to the oe‐NC‐transfected cells, whereas LINC00607 knockdown in the ARO cells significantly increased the rate of G0/G1 phase and apoptosis relative to the si‐NC group (P < .05). In addition, RT‐qPCR and Western blot analysis were applied to detect the expression patterns of Bax and Bcl‐2 (Figure 3C, D). The expression patterns of two genes in cells with treatment of oe‐NC and si‐NC elicited no difference, compared to cells without treatment (P > .05). However, the mRNA and protein expressions of Bax in cells with treatment of oe‐LINC00607 were significantly diminished, and that of Bcl‐2 was notably promoted (P < .05). Meanwhile, the mRNA and protein expressions of Bax in cells with treatment of si‐LINC00607 were up‐regulated drastically, while that of Bcl‐2 was profoundly down‐regulated (P < .05). These results supported the notion that si‐NC00607 increased the apoptosis rate in TC cells.

FIGURE 3

si‐NC00607 suppressed cell cycle entry and promoted apoptosis in TC cells. ARO cells under the exposure to doxorubicin were treated with oe‐LINC0060 or si‐LINC00607. A, the percentage of cell cycle evaluated by PI staining; B, cells apoptosis measured using Annexin V‐FITC/PI double staining; C, the mRNA expression patterns of Bax and Bcl‐2 in cells determined by RT‐qPCR; D, the protein bands of Bax and Bcl‐2 tested by Western blot analysis; E, the protein expression patterns of Bax and Bcl‐2 tested by Western blot analysis; *P < .05 vs cells with the treatment of oe‐NC; #P < .05 vs cells with treatment of si‐NC. The experiment was conducted 3 times independently. The data were presented as mean ± standard deviation

CASP9 is a putative target of LINC00607

With an attempt to explore the underlying mechanism by which LINC00607 regulates TC cell apoptosis, the relationship between LINC00607 and CASP9 was investigated. An existing study reported that the activation of CASP9 may initiate an apoptotic protease cascade, highlighting CASP9 as an imperative target in researching tumour cell apoptosis. Moreover, lncRNA has been demonstrated to modulate tumour cell apoptosis via regulating CASP9. Based on the previous literature, we initially detected the protein expression pattern of CASP9 in the normal thyroid cell line (Nthy‐ori3‐1) and the TC cell lines (ARO, FRO and CAL‐62), which revealed that the CASP9 expression was lowered in the TC cell lines (Figure 4A), indicating CASP9 as a potential target of TC tumour cells. Next, blast comparison was employed and showed the presence of numerous base pairs of binding sites between LINC00607 and the promoter regions of CASP9 genes (Figure 4B). Moreover, as the results of dual‐luciferase reporter gene assay displayed, the luciferase activity of CASP9‐wt‐2 was significantly decreased by LINC00607 (P < .05), while that of CASP9‐wt‐1, CASP9‐mut‐1 and CASP9‐mut‐2 remained unaffected (P > .05; Figure 4C). These results suggested that LINC00607 could bind to the promoter region of CASP9 gene, and the binding sequence located at the 246‐256 bp of CASP9. Next, the subcellular localization of LINC00607 predicted by the lncATLAS website showed that LINC00607 located in the nucleus in several cell lines (Figure 4D). FISH verification indicated that LINC00607 was primarily expressed in the nucleus (Figure 4E), which was consistent with prediction of the lncATLAS website. Therefore, the expression pattern of CASP9 in the TC cells was negatively regulated by LINC00607.

FIGURE 4

LINC00607 binds to the CASP9 gene promoter region. A, the expression pattern of CASP9 in different cell lines detected by Western blot analysis; B, comparison of LINC00607 and CASP9 promoter region by Blast C, luciferase activity of CASP9‐wt and CASP9‐mut after treatment of LINC00607 or NC; D, subcellular localization of LINC00607 in lncATLAS website; E, location of LINC00607 by FISH; *P < .05 vs the NC group. The experiment was conducted 3 times. The data were presented as mean ± standard deviation

LINC00607 increases DNA methylation in CASP9 promoter region

A total of 600 bp nucleotide sequences near the promoter of CASP9 gene were added as input using the MethPrimer software to analyse the CpG island in the promoter region. The results revealed the presence of CpG islands in the promoter region of CASP9 (Figure 5A), indicating the expression pattern of CASP9 would be affected by promoter methylation. To further research the correlation between the methylation level in CASP9 promoter region and DOX resistance or sensitivity of TC cells, MSP was applied to detect the methylation level of the CpG islands in CASP9 promoter region between the resistance and sensitive tissue samples. The results (Figure 5B, C) showed that the methylation level of CASP9 promoter region in the sensitive samples of TC was significantly diminished relative to the resistance samples (P < .05).

FIGURE 5

LINC00607 increases DNA methylation in CASP9 promoter region. A, CpG islands distribution in CASP9 promoter region; B, electrophoretogram of methylation levels in CASP9 promoter region of TC patients with resistance and sensitivity to doxorubicin by MSP (H2O, double NC; IVD, methylation positive control; NL, non‐methylated positive control; U, unmethylation; M, methylation); No.1 to No.4 indicate four randomly selected tissue samples from the group; C, methylation level of CASP9 promoter region in TC patients with resistance and sensitivity to doxorubicin. D, the enrichment of methylated transferases (DNMT1, DNMT3a and DNMT3b) by LINC00607 in each group of cells measured by RIP; E, enrichment of the methylated transferase (DNMT1, DNMT3a and DNMT3b) in CASP9 promoter region in each group of cells determined by ChIP; F, CASP9 mRNA expression pattern in TC cells evaluated by RT‐qPCR; G, the protein bands of CASP9 in TC cells evaluated by Western blot analysis; H, the protein expression pattern of CASP9 in the TC cells evaluated by Western blot analysis; *P < .05 vs cells with oe‐NC; #P < .05 vs cells with the treatment of si‐NC. The experiment was conducted 3 times independently. The data were presented as mean ± standard deviation

Interaction between LINC00607 and CASP9 methylation was analysed by RIP and ChIP. As shown in Figure 5D, E, the enrichment of methyltransferase in cells with oe‐NC and with si‐NC elicited no drastic difference (P > .05) compared to cells without treatment. The enrichments of DNMT1, DNMT3a and DNMT3b in cells with treatment of oe‐LINC00607 were significantly increased (P < .05), meanwhile in cells with si‐LINC00607 were prominently decreased (P < .05). The expression pattern of CASP9 was measured by RT‐qPCR and Western blot analysis (Figure 5F‐H), which illustrated that, relative to the cells without treatment, the expression did not differ in cells treated with oe‐NC and with si‐NC (P > .05). In disparity, the mRNA and protein expressions of CASP9 RNA in the cells with oe‐LINC00607 were down‐regulated (P < .05), while they were promoted significantly in cells with si‐LINC00607 (P < .05). Therefore, LINC00607 could stimulate methylation of CASP9 to decrease CASP9 expression.

LINC00607 increases methylation of CASP9 promoter region to restrain apoptosis of TC cells

DNA methyltransferase inhibitor (5‐Aza‐dc) was added for cell demethylation. Then the cells were treated with 5‐Aza‐dc, DMSO alone or in the presence of oe‐LINC00607 to detect the methylation level, proliferation and colony formation ability as well as the cell cycle and apoptosis of cells, respectively. MSP assay demonstrated (Figure 6A‐D) no difference in the expression pattern of CASP9 and its CpG methylation between cells with oe‐LINC00607 + 5‐Aza‐dc and DMSO (P > .05); CASP9 mRNA and protein expressions in cells with oe‐LINC00607 + DMSO were progressively reduced while that in cells with 5‐Aza‐dc was up‐regulated (P < .05). EdU and colony formation experiment results showed (Figure 6E, F) no difference in the proliferation and clone formation ability between cells treated with oe‐LINC00607 + 5‐Aza‐dc and DMSO (P > .05). The proliferation and colony formation ability in cells with oe‐LINC00607 + DMSO were significantly potentiated, while the same had progressively diminished in cells with 5‐Aza‐dc (P < .05). The results of cell cycle and apoptosis detected by flow cytometry are shown in the Figure 6G, H, and no difference was evident in the cell cycle and apoptosis ratio in cells with oe‐LINC00607 + 5‐Aza‐dc and DMSO (P > .05). The per cent of oe‐LINC00607 + DMSO‐treated cells in G0/G1 phase was lower, accompanied with reduced apoptosis rate. Additionally, a higher percentage of ARO cells expressing 5‐Aza‐dc were observed in the G0/G1 phase, along with an enhanced apoptosis rate. The preceding results illustrated that LINC00607 increased CASP9 methylation so as to reduce the apoptosis in TC cells.

FIGURE 6

LINC00607 increases methylation of CASP9 promoter region to restrain the apoptosis of TC cells. ARO cells were treated with 5‐Aza‐dc, DMSO alone or in the presence of oe‐LINC00607. A, methylation level of cells determined by MSP. B, CASP9 mRNA expression pattern in cells measured by RT‐qPCR; C, CASP9 protein bands in cells of each group tested by Western blot analysis; D, CASP9 protein expression pattern in cells of each group tested by Western blot analysis. E, cells proliferation in each group evaluated by EdU; F, clone formation ability in each group assessed by colony formation experiment; G, cell cycles in each group tested by PI staining; H, cell apoptosis in each group evaluated by Annexin V‐FITC/PI staining. *P < .05 vs cells with DMSO treatment. The experiment was conducted 3 times independently. The data were presented as mean ± standard deviation

LINC00607 silencing inhibits TC growth in nude mice

We subsequently explored the tumour‐initiating activities of LINC00607 in vivo, and the nude mice were treated with ARO cells harbouring oe‐LINC00607 or si‐LINC00607. The results revealed that nude mice with the treatment of oe‐NC and si‐NC had no difference in tumour volume and weight (P > .05). Nevertheless, nude mice with oe‐LINC00607 exhibited increased significantly tumour volume and weight (P < 0.05), and nude mice with si‐LINC00607 demonstrated remarkably reduced tumour volume and weight (P < .05; Figure 7A‐C). Our study showed that silencing of LINC00607 led to suppressed doxorubicin‐resistant TC tumour growth in vivo.

FIGURE 7

si‐LINC00607 inhibits TC growth in nude mice injected with ARO cells harbouring oe‐LINC00607 or si‐LINC00607. A, tumour volume in nude mice at the 1st, 2nd, 3rd, 4th and 5th week; B, representative images of tumours; C, tumour weight (g) in nude mice; *P < .05, n = 6. The experiment was conducted 3 times independently. The data were presented as mean ± standard deviation

DISCUSSION

TC incidence has continuously increased worldwide over the past decades. The currently adopted clinical treatment protocols for TC are surgery and radioactive iodine therapy. However, resistance due to the drug treatment still persists as problematic in the treatment of cancer. Majority of chemotherapeutic drugs function through inducing cancer cell apoptosis. Notably, some lncRNAs play vital roles against the acquired drug resistance. Furthermore, lncRNA can function as modulators of genome activity through DNA methylation and post‐translational histone modifications. On the basis of the preceding literature, our investigation demonstrated that a new lncRNA, LINC00607 could function as a tumour promoter for TC via DNA methylation of the CASP9 gene promoter. Furthermore, our findings proved that LINC00607 has the potency to bind to the CASP9 gene promoter so as to down‐regulate its expression, thus inducing the viability and colony formation of TC cells, while decreasing TC resistance to doxorubicin.

In this study, we analysed the biological role of LINC00607 in TC cells. In effect, the significance of various lncRNAs in TC has been highlighted in a previous study. For example, LINC00210 was overexpressed, which promoted the cell proliferation, migration, and invasion in TC. Furthermore, knockdown of lncRNA taurine up‐regulated gene 1 could restore the sensitivity against the acquired resistance to doxorubicin in hepatocellular carcinoma. In compliance with these findings, our findings identified that some lncRNAs had a stimulative effect of cell proliferation, tumour growth in TC. However, a new lncRNA, LINC00607, has been not discussed so far, and therefore, the underlying role of LINC00607 in TC cells requires further investigation.

As for another vital factor CASP9, a member of the caspase family is closely linked to inflammation and cell death, thus maintaining habitual homeostasis. Moreover, knockdown of a lncRNA, NR_026689, could potentiate the ovarian cell apoptosis by the up‐regulating the expression of the pro‐apoptotic protein CASP9. In addition, the Mdm2 antagonist Nutlin‐3 induced the apoptosis of colon cancer cells by activation of CASP9. From these preceding studies, we speculated the mechanism supporting that active CASP9 could influence the cell development processes such as apoptosis. Dual‐luciferase reporter gene assay further validated CASP9 as a putative target of LINC00607. Therefore, we speculated the presence of a relationship between LINC00607 and CASP9 in TC, which warrants research in a further study.

Moreover, our findings denoted that the methylation of CASP9 gene reduced after a methylation inhibitor 5‐Aza‐dC treatment, to the extent to support an increased gene expression. An existing previous study has demonstrated the significance of gene methylation as a vital factor for the poor prognosis of patients with glioblastoma, and patients with unmethylated CASP8 advanced from a prolonged survival relative to the patients harbouring methylated CASP8. Our findings demonstrated the ability of 5‐Aza‐dC to counteract the inhibitory effect of overexpression of LINC00607 on the CASP9 expression and TC cell apoptosis. Similarly, 5‐Aza‐dC treatment in papillary TC cells contributed to demethylation of the DNA methyltransferase 3A (DNMT3A) and elevation of the DNMT3A expression. Additionally, methylation of another pro‐apoptotic tumour suppressor gene, TMSI, was methylated in the TC cells and inhibition of methylation by 5‐Aza‐dC elevated expression of the gene and promoted cell apoptosis induced by the TNF‐related apoptosis‐inducing ligand. Significantly, lncRNAs can essentially regulate the DNA methylation via interaction with different DNMT members both directly and indirectly. Nevertheless, how LINC00607 regulated the methylation of CASP9 comprehensively and whether this interaction functioned in vivo remains to be explored.

To conclude, LINC00607 could facilitate a novel aspect of the treatment for patients with TC where the decreased methylation of CASP9 gene promoter, accelerated the apoptosis period of TC and reduced the level of resistance in cancer cells (Figure 8). Nevertheless, due to the lack of specific report on the potential role of LINC00607 and CASP9 promoter methylation in TC progression, further studies are warranted to identify the mechanism for the development of potentially targeted therapy in TC.

FIGURE 8

The mechanism diagram depicting that LINC00607 could decrease the methylation of CASP9 gene promoter to accelerate the apoptosis of TC cells and reduce the level of resistance in cancer cells

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

AUTHOR CONTRIBUTION

Lanzhen Li: Conceptualization (equal); Formal analysis (equal); Writing‐original draft (equal); Writing‐review & editing (equal). Zhongcheng Gao: Conceptualization (equal); Formal analysis (equal). Lei Zhao: Data curation (equal); Formal analysis (equal); Writing‐original draft (equal); Writing‐review & editing (equal). Peiyou Ren: Data curation (equal); Formal analysis (equal); Writing‐original draft (equal); Writing‐review & editing (equal). Hongyan Shen: Conceptualization (equal); Formal analysis (equal); Funding acquisition (equal); Resources (equal).