Literature DB >> 34213719

Network pharmacology of triptolide in cancer cells: implications for transcription factor binding.

Ean-Jeong Seo1, Mona Dawood1,2, Annika K Hult3, Martin L Olsson3, Thomas Efferth4.   

Abstract

Background Triptolide is an active natural product, which inhibits cell proliferation, induces cell apoptosis, suppresses tumor metastasis and improves the effect of other therapeutic treatments in several cancer cell lines by affecting multiple molecules and signaling pathways, such as caspases, heat-shock proteins, DNA damage and NF-ĸB. Purpose We investigated the effect of triptolide towards NF-ĸB and GATA1. Methods We used cell viability assay, compare and cluster analyses of microarray-based mRNA transcriptome-wide expression data, gene promoter binding motif analysis, molecular docking, Ingenuity pathway analysis, NF-ĸB reporter cell assay, and electrophoretic mobility shift assay (EMSA) of GATA1. Results Triptolide inhibited the growth of drug-sensitive (CCRF-CEM, U87.MG) and drug-resistant cell lines (CEM/ADR5000, U87.MGΔEGFR). Hierarchical cluster analysis showed six major clusters in dendrogram. The sensitive and resistant cell lines were statistically significant (p = 0.65 × 10-2) distributed. The binding motifs of NF-κB (Rel) and of GATA1 proteins were significantly enriched in regions of 25 kb upstream promoter of all genes. IPA showed the networks, biological functions, and canonical pathways influencing the activity of triptolide towards tumor cells. Interestingly, upstream analysis for the 40 genes identified by compare analysis revealed ZFPM1 (friend of GATA protein 1) as top transcription regulator. However, we did not observe any effect of triptolide to the binding of GATA1 in vitro. We confirmed that triptolide inhibited NF-κB activity, and it strongly bound to the pharmacophores of IκB kinase β and NF-κB in silico. Conclusion Triptolide showed promising inhibitory effect toward NF-κB, making it a potential candidate for targeting NF-κB.
© 2021. The Author(s).

Entities:  

Keywords:  Microarrays; Natural products; Network pharmacology; Phytochemicals; Precision medicine

Mesh:

Substances:

Year:  2021        PMID: 34213719      PMCID: PMC8541937          DOI: 10.1007/s10637-021-01137-y

Source DB:  PubMed          Journal:  Invest New Drugs        ISSN: 0167-6997            Impact factor:   3.850


Introduction

Triptolide, a diterpenoid triepoxide, is predominantly an active natural product isolated from the medicinal plant Tripterygium wilfordii Hook F (TWHF) [1]. Triptolide exhibits potent pharmacological activities against inflammation, fibrosis, cancer, viral infection, oxidative stress and osteoporosis [2-4]. Triptolide has a similar structure as steroid hormones, and it showed high binding affinity to a nuclear receptor, human estrogen receptor alpha (ERα) [5]. It selectively inhibits the activity of peroxiredoxin I, which has crucial functions in the development of cancer and inflammation [6]. The XBP1 subunit of the transcription factor TFIH core complex is one of the molecular targets of triptolide, which is important for the inhibitory activity of triptolide to RNA polymerase II-mediated transcription [7]. This feature provides one explanation of the activity of triptolide against several diseases such as inflammation and cancer [8-10]. Triptolide shows proapoptotic and anti-proliferative effects on tumor cell lines in vitro and reduces the tumor size or inhibits tumor growth in vivo. It inhibits cell proliferation, induces cell apoptosis, suppresses tumor metastasis and improves the effect of other therapeutic treatments in several cancer cell lines [11]. It affects multiple molecules and signaling pathways, such as caspases, heat-shock proteins, DNA damage and NF-ĸB. It also enhances chemoradiosensitivity in cancer therapy [12]. Nowadays, targeting transcription factor drivers in cancer is becoming a successful strategy for treatment of cancer [1]. This mainly based on the fact that most of the oncogenes involved in tumorigenesis processes are transcription factors such as forkhead box O (FOXO), nuclear factor kappa B (NF-ĸb), Krüppel-like factor 8 (KLF8), MYC, GATA binding factor (GATA1), activator protein 1 (AP-1), etc. [13, 14]. NF-kB is a family of transcription factors that are constitutively active in different types of tumors. NF-κB has been identified as a key player in carcinogenesis process, since it has a role in activation of cellular pathways such as: cell proliferation, survival, apoptosis, angiogenesis, and metastasis [15]. Hence, targeting NF-κB is of significant therapeutic value. NF-κB is located in the cytoplasm in inactive form by its binding to inhibitory proteins (IκB). In the presence of specific stimuli, IκB is phosphorylated by the IκB kinase (IKK) and eventually degraded. Activated NF-κB is now free to translocate to the nucleus and binds to its specific DNA sequences at the cis-acting elements of the target genes enhancing their expression [16]. The GATA-binding factor (GATA) proteins constitute a large family of transcription factors. In mammals, it is composed of six members (GATA1-GATA6) that can be further classified into two subfamilies based on their expression profile and the structure of the gene [17]. GATA1 and its friend Zinc Finger Protein (ZFPM1, FOG1) are transcription factors and transcription regulators, respectively [18]. They regulate the differentiation of the erythroid and megakaryocytic cell lineages by regulating the expression of the key genes related to cell proliferation, cell differentiation, and apoptosis [19]. ZFPM1 binds to GATA1 to form a heterodimer complex to synergistically activate transcription at the specific regulatory region of the genes. Then, the expressed genes enable differentiation of hematopoietic cells to both erythroid and megakaryocytic cells [20]. Moreover, several studies reported that the deregulation of ZFPM1 and its pathway contributes to the initiation of hematologic malignancies. Therefore, GATA1 is considered a potential target for cancer therapy [21]. In this study, we investigated the cytotoxic activity of triptolide in tumor cell lines. Moreover, we carried out COMPARE and hierarchical cluster analyses for 60 cell lines of the National Cancer Institute (NCI, United States) that represent 9 different types of tumors. Then, we were interested to perform pathway and motif analyses using the 40 genes identified by the microarray. Later, we examined the inhibitory effect of triptolide towards NF-ĸB using in silico molecular docking and NF-ĸB reporter cell assay, since our bioinformatics analysis showed that triptolide affects NF-ĸB. Besides, we also studied the effect of triptolide to GATA proteins, because GATA proteins were predicted to bind triptolide by our motif binding analyses in this study.

Materials and methods

Cell lines

Drug-sensitive CCRF-CEM and multidrug-resistant P-glycoprotein-overexpressing CEM/ADR5000 leukemic cells were kindly given by Prof. Axel Sauerbrey (Department of Pediatrics, University of Jena, Germany). Cells were cultured in RPMI1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin (1,000 U/mL)/streptomycin (100 µg/mL) (P/S) (Life Technologies, Darmstadt, Germany). Doxorubicin (5,000 ng/mL) was supplied to retain overexpression of P-gp (MDR1, ABCB1) in resistant CEM/ADR5000 leukemic cells [26]. Human brain glioblastoma cell line U87.MG and the U87.MGΔEGFR that is transfected with a plasmid carrying an EGFR gene with a deletion of exons 2–7 were obtained from Dr. W. K. Cavenee (Ludwig Institute for Cancer Research, San Diego, CA, United States). The cell lines were cultured with 800 ng/mL geneticin [22, 23]. The panel of 60 human tumor cell lines of the Development of Therapeutics Program of the National Cancer Institute (NCI, USA) included leukemia, melanoma, non-small cell lung cancer, colon cancer, renal cancer, ovarian cancer, breast cancer, prostate carcinoma cells, and tumor cells of the central nervous system [24].

Cell viability assay

The cytotoxic activities of triptolide (Sigma Aldrich, Taufkirchen, Germany; Fig. 1A) were evaluated by the resazurin assay [25]. This assay is based on reduction of the indicator dye, resazurin, to the highly fluorescent resorufin by viable cells. Aliquots of 5,000 cells/100 µL of U87.MG and U87.MGΔEGFR were placed in 96-well plates and incubated for one day before treatment. However, for leukemic cells, 10,000 cells/100 µL cells were seeded into 96-well plates and immediately treated. Twenty microliters of resazurin 0.01% w/v solution were added to each well after 72 h at 37 °C incubation, and the plates were incubated at 37 °C for 4 h. Fluorescence was detected by an Infinite M2000 Proplate reader (Tecan, Crailsheim, Germany) with an excitation wavelength of 544 nm and an emission wavelength of 590 nm. Each experiment was carried out at least three times with six replicates each. The viability was analyzed based on a comparison with untreated cells. Fifty percent inhibition (IC50) values imply the drug concentrations needed to inhibit 50% of cell proliferation and were calculated from a calibration curve by linear regression using Microsoft Excel [26, 27].
Fig. 1

Cytotoxicity of triptolide against cancer cells. Chemical structure of triptolide A. Cytotoxic effect of triptolide against CEM/ADR5000 and CCRF-CEM B, and U87.MG and U87.MGΔEGFR C

Cytotoxicity of triptolide against cancer cells. Chemical structure of triptolide A. Cytotoxic effect of triptolide against CEM/ADR5000 and CCRF-CEM B, and U87.MG and U87.MGΔEGFR C

Compare and cluster analyses of microarray-based mRNA transcriptome-wide expression data

The mRNA microarray hybridization of the NCI cell lines has been published at the NCI Web site (http://dtp.nci.nih.gov) [28, 29]. COMPARE analyses were used to obtain rank-ordered lists of genes expressed in the NCI cell lines. The detailed method as a tool to determine candidate genes for drug resistance and sensitivity has been previously published [30-33]. In order to identify COMPARE rankings, a scale index of correlation coefficients (R-values) was generated from Iog10IC50 values of test compounds and microarray-based mRNA expression values. Greater mRNA expression correlated with enhanced drug resistance in the standard COMPARE, whereas greater mRNA expression in cell lines indicated drug sensitivity in reverse COMPARE analyses. Pearson´s correlation test was used to calculate significance values and rank correlation coefficients as relative measure for the linear dependency of two variables. For hierarchical cluster analyses, objects were classified by calculation of distances according to the closeness of between individual distances. All objects were displayed into cluster trees (dendrograms). Merging of objects with similar features leads to cluster formation, where the length of the branch implies the degree of relation. Distances of subordinate cluster branches to superior cluster branches serve as criteria for the closeness of clusters. Therefore, objects with tightly related features were clustered closely together, if separation of objects in the dendrogram increased with progressive dissimilarity. Hierarchical clustering and heat map analyses were carried out using clustered image map (CIM) miner software by the one matrix CIM (https://discover.nci.nih.gov/cimminer/oneMatrix.d) [34].

Transcription factor gene promoter binding motif analysis

The top 40 genes, which directly or inversely correlated with log10IC50 values of the NCI cell lines in COMPARE analysis, were submitted to binding motif analysis. Promoter sequences 25 kb upstream of exon 1 of the corresponding genes were retrieved from UCSC Genome Browser Gene Sorter (http://genome.ucsc.edu). Promoter sequences were checked using the SeqPos tool implemented in the Galaxy Cistrome software [35].

Molecular docking

The interaction energy of triptolide with NF-ĸB pathway proteins was predicted using molecular docking: I-ĸB kinase β, I-ĸB kinase β-NEMO (NF-ĸB essential modulator) complex, NF-ĸB, and NF-ĸB-DNA complex. The protocol for molecular docking was reported by us [36]. Protein structures using X-ray crystallography were obtained from PDB database (http://www.rcsb.org/). I-ĸB kinase β (PDB ID:3RZF), I-ĸB kinase β-NEMO complex (PDB ID:3BRT), NF-ĸB (p52/RelB heterodimer, PDB ID:3DO7), and NF-ĸB-DNA complex (p50/p65 heterodimer bound to DNA, PDB ID: IVKX) were used in our study. A grid box was defined for docking spaces in each protein according to its pharmacophores. Docking parameters were set to 250 runs and 2,500,000 energy evaluations for each docking. Dockings were performed three times independently. Lamarckian Genetic Algorithm was chosen for docking calculations. For the visualization of docking results, AutodockTools-1.5.7rcl was used. The surface representation image showing the binding pocket of proteins was made with Visual Molecular Dynamics (VMD) software developed with NIH support by the Theoretical and Computational Biophysics group at the Beckman Institute, University of Illinois at Urbana-Champaign (http://www.ks.uiuc.edu/Research/vmd/).

Ingenuity pathway analysis

Deregulated genes identified by COMPARE analysis as factors determining cellular responsiveness to triptolide were subjected to pathway analysis, in order to determine the biological function of these genes. Forty genes were imported into the Ingenuity Pathway Analysis (IPA) software (Qiagen Bioinformatics, Redwood City, CA, U.S.A) in Excel format [37]. Core analyses were carried out with general settings: “human” as species and “cell line” as type of biological sample. Canonical pathways, diseases and functions, and upstream regulators were determined by Fisher’s exact test at a significance value of p < 0.05. IPA core analyses identifies key regulators and networks in human cell lines [37, 38].

NF-ĸB reporter cell assay

HEK293 cells stably expressing HEK-Blue-Null1 vector and SEAP on a NF-ĸB promoter were obtained from Invivogen (San Diego, CA, USA). The cells were maintained according to manufacturer´s protocol and treated with various concentrations of triptolide (0 µM, 1.6 µM, 3.1 µM, 6.3 µM, 12.5 µM, 25 µM and 50 µM) for 1 h and triptolide was not removed. Afterwards, NF-ĸB activity was induced with 100 ng/mL of TNF-α for 24 h. The activation was evaluated by detecting SEAP spectrophotometrically at 630 nm with addition of Quanti Blue (Invivogen). The procedure has been published by us [39-41].

Electrophoretic mobility shift assay (EMSA)

Electrophoretic mobility shift assays were carried out as previously demonstrated [42]. And the sequence of the biotinylated probes (sequence from a regulatory region in ABO intron 1 [GenBank KC841429]) used for testing are shown in Table 1. Gel shifts were performed using LightShift™ Chemiluminescent EMSA Kit (Thermo-Fisher, Waltham, MA, USA) and nuclear extracts were prepared from K562 cells (ATCC CCL -243™) [43]. Triptolide was dissolved in DMSO to a 20 mM stock solution which was then further diluted. Nuclear extracts were pre-incubated with three different dilutions of triptolide (5 nM, 10 nM, and 20 nM) for 5 min and three concentrations (2.5 nM, 5 nM, and 100 nM) for 10 min to test if triptolide would inhibit GATA1 protein binding to the probes. The final dilution of DMSO was 0.1%. As a vehicle control, pre-incubation was performed with 0.1% DMSO only and as a negative binding control a probe with a disrupted GATA1 site was used. Supershift assay was performed with polyclonal anti-GATA-1 IgG (1 µg/µL; Active Motif, Waterloo, Belgium).
Table 1

EMSA probe designations and sequences (wildtype and mutated GATA1-binding motif highlighted in bold)

NameSequence 5’ to 3’
ABOi1 GATA FAGAGTCTTCGCAATGCCTGGGAAAGGGAGAGATAAGGCTCACTAGCCA
ABOi1 GATA RTGGCTAGTGAGCCTTATCTCTCCCTTTCCCAGGCATTGCGAAGACTCT
ABOi1 GAGA FAGAGTCTTCGCAATGCCTGGGAAAGGGAGAGAGAAGGCTCACTAGCCA
ABOi1 GAGA RTGGCTAGTGAGCCTTCTCTCTCCCTTTCCCAGGCATTGCGAAGACTCT
EMSA probe designations and sequences (wildtype and mutated GATA1-binding motif highlighted in bold)

Results

Cytotoxicity of triptolide towards ABC-transporter expressing tumor cell lines

The cell viability of drug-sensitive (CCRF-CEM, U87.MG) and drug-resistant cell lines (CEM/ADR5000, U87.MGΔEGFR) by triptolide was tested by resazurin assay. Triptolide inhibited the growth of all four cell lines after 72 h. The IC50 values of triptolide against CCRF-CEM and CEM/ADR5000 were 10.21 and 7.72 nM, respectively (Fig. 1B). Fifty percentages of U87MG and U87MG.ΔEGFR were inhibited with 0.025 and 0.021 µM triptolide, respectively (Fig. 1C).

Compare and hierarchical cluster analysis of mRNA microarray data

We studied the transcriptome-wide mRNA expression in 60 NCI cell lines of diverse tumor types using COMPARE analysis and correlated the mRNA expression data with the log10IC50 values for triptolide, in order to identify novel molecular determinants for this compound. The scale ranking of genes, which were identified by COMPARE analysis, were applied to Pearson´s rank correlation tests. Table 2 shows the top 20 genes with direct and the top 20 genes with inverse correlation coefficients.
Table 2

Correlation of constitutive mRNA expression of genes identified by COMPARE analyses with log10 IC50 values of triptolide for 60 NCI tumor cell lines a

COMPARE coefficientPattern IDGene Bank accessionGene abbreviationGene nameGene function
0.480GC29777U72514EMG1EMG1 nucleolar protein homologue (S. cerevisiae)S-adenosyl-L-methionine-dependent pseudo-uridine N(1)-methyltransferase that methylates pseudo-uridine at position 1248 (Psi1248) in 18S rRNA
0.469GC31760AI816034NHP2NHP2 ribonucleoprotein homologue (yeast)Ribosome biogenesis and telomere maintenance
0.454GC37113U18991RPE65Retinal pigment epithelium-specific protein 65 kDaProduction of 11-cis retinal and in visual pigment regeneration. The soluble form binds vitamin A (all-trans-retinol), making it available for LRAT processing to all-trans-retinyl ester
0.454GC39388AF038664B4GALT6UDP-Gal:βGlcNAc β 1,4- galactosyltransferase, polypeptide 6Biosynthesis of glycosphingolipids
0.451GC38177AB007893PPIP5K2Diphosphoinositol pentakisphosphate kinase 2Regulation of apoptosis, vesicle trafficking, cytoskeletal dynamics, exocytosis, insulin signaling and neutrophil activation
0.443GC39329D87468ARCActivity-regulated cytoskeleton-associated proteinConsolidation of synaptic plasticity as well as formation of long-term memory. Required in the stress fiber dynamics and cell migration
0.427GC27848AB015633TMEM5Transmembrane protein 5Biosynthesis of the phosphorylated O-mannosyl trisaccharide (N-acetylgalactosamine-beta-3-N-acetylglucosamine-beta-4-(phosphate-6-)mannose), a carbohydrate structure present in α-dystroglycan (DAG1), which is required for binding laminin G-like domain-containing extracellular proteins with high affinity
0.426GC30255AI972631SRRTSerrate RNA effector molecule homologue (Arabidopsis)Mediator between the cap-binding complex (CBC) and the primary microRNAs (miRNAs) processing machinery during cell proliferation
0.425GC37400D86956HSPH1Heat shock 105 kDa/110 kDa protein 1Prevents the aggregation of denatured proteins in cells under severe stress, on which the ATP levels decrease markedly
0.413GC30551Y18418RUVBL1RuvB-like 1 (E. coli)Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A
0.413GC36812J03626UMPSUridine monophosphate synthetaseUridine monophosphate synthase, pyrimidine de novo biosynthesis
0.410GC27815S78798PIP4K2APhosphatidylinositol-5-phosphate 4-kinase, type II, αCatalyzes the phosphorylation of phosphatidylinositol 5-phosphate (PtdIns5P) on the fourth hydroxyl of the myo-inositol ring, to form phosphatidylinositol 4, 5-bisphosphate (PtdIns(4,5)P2)
0.407GC27991S43855RCVRNRecoverinCalcium-bound recoverin prolongs photoresponse
0.407GC36672M94314RPL24Ribosomal protein L2460S ribosomal protein L24
0.401GC28309Y08991PIK3R4Phosphoinositide-3-kinase, regulatory subunit 4Regulatory subunit of the PI3K complex that mediates formation of phosphatidylinositol 3-phosphate
0.395GC28236U95032GAS2Growth arrest-specific 2Is cleaved during apoptosis and the cleaved form induces dramatic rearrangements of the actin cytoskeleton and potent changes in the shape of the affected cells
0.394GC35423X53777RPL17Ribosomal protein L1760S ribosomal protein L17
0.393GC31189AF081280NPM3Nucleophosmin/nucleoplasmin 3Chaperone
0.390GC30306U66035TIMM8ATranslocase of inner mitochondrial membrane 8 homologue A (yeast)Mitochondrial intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane
0.388GC35656D79995TTLL4Tubulin tyrosine ligase-like family, member 4Polyglutamylase which preferentially modifies beta-tubulin and nucleosome assembly proteins NAP1 and NAP2
-0.581GC26920AB029035ARHGEF4Rho guanine nucleotide exchange factor (GEF) 4Guanine nucleotide exchange factor (GEF) for RHOA, RAC1 and CDC42 GTPases
-0.571GC31233X54131PTPRBProtein tyrosine phosphatase, receptor type, BBlood vessel remodeling and angiogenesis
-0.561GC35073AB017915CHST3Carbohydrate (chondroitin 6) sulfotransferase 3Sulfotransferase that utilizes 3-phospho-5-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the transfer of sulfate to position 6 of the N-acetylgalactosamine (GalNAc) residue of chondroitin
-0.524GC28183X54131PTPRBProtein tyrosine phosphatase, receptor type, BBlood vessel remodeling and angiogenesis
-0.515GC28807Y09836MAP1BMicrotubule-associated protein 1BFacilitates tyrosination of α-tubulin in neuronal microtubules
-0.494GC33702D64053PTPRRProtein tyrosine phosphatase, receptor type, RSequesters mitogen-activated protein kinases (MAPKs) such as MAPK1, MAPK3 and MAPK14 in the cytoplasm in an inactive form
-0.492GC30612S40719GFAPGlial fibrillary acidic proteinA class-III intermediate filament. It is a cell-specific marker that, during the development of the central nervous system
-0.487GC39169D78014DPYSL3Dihydropyrimidinase-like 3Necessary for signaling by class 3 semaphorins and subsequent remodeling of the cytoskeleton
-0.486GC33701D64053PTPRRProtein tyrosine phosphatase, receptor type, RSequesters mitogen-activated protein kinases (MAPKs) such as MAPK1, MAPK3 and MAPK14 in the cytoplasm in an inactive form
-0.475GC31046X75342SHBSrc homology 2 domain containing adaptor protein BAdapter protein which regulates several signal transduction cascades by linking activated receptors to downstream signaling components
-0.468GC30046X65724NDPNorrie disease (pseudo-glioma)Activates the canonical Wnt signaling pathway through FZD4 and LRP5 coreceptor
-0.465GC30818U49082SLC38A3Solute carrier family 38, member 3Sodium-dependent amino acid/proton antiporter. Mediates electrogenic cotransport of glutamine and sodium ions in exchange for protons
-0.461GC29160AF011375ITGB4Integrin, β 4Integrin α-6/ β-4 is a receptor for laminin. Structural role in the hemidesmosome of epithelial cells. Regulation of keratinocyte polarity and motility
-0.459GC35360M26252PKMPyruvate kinase, muscleGlycolytic enzyme that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate (PEP) to ADP, generating ATP
-0.455GC32168Z35307ECE1Endothelin converting enzyme 1Converts big endothelin-1 to endothelin-1
-0.451GC35300X63432ACTBΒ-ActinInvolved in cell motility. Ubiquitously expressed in all eukaryotic cells
-0.449GC38666AF002715MAP3K4Mitogen-activated protein kinase kinase kinase 4Component of a protein kinase signal transduction cascade. Activates the CSBP2, P38 and JNK MAPK pathways. Specifically phosphorylates and activates MAP2K4 and MAP2K6
-0.448GC33904MAP2K1L05624Mitogen-activated protein kinase kinase 1Dual specificity protein kinase which acts as an essential component of the MAP kinase signal transduction pathway. Binding of extracellular ligands such as growth factors, cytokines and hormones to their cell-surface receptors activates RAS and this initiates RAF1 activation
-0.447GC38065X97868ARSFArylsulfatase FArylsulfatase F, which is not inhibited by DHEAS or warfarin
-0.441GC34659M62896ANXA2P1Annexin A2 pseudogene 1Annexin A2, pseudogene 1

a Positive correlation coefficients indicate direct correlations to log10 IC50 values; negative ones indicate inverse correlations. Information on gene functions was taken from the OMIM database, NCI, USA (http://www.ncbi.nlm.nih.gov/Omim/) and from the GeneCard database of the Weitzman Institute of Science, Rehovot, Israel (http://bioinfo.weizmann.a.il/cards/index.html)

Correlation of constitutive mRNA expression of genes identified by COMPARE analyses with log10 IC50 values of triptolide for 60 NCI tumor cell lines a a Positive correlation coefficients indicate direct correlations to log10 IC50 values; negative ones indicate inverse correlations. Information on gene functions was taken from the OMIM database, NCI, USA (http://www.ncbi.nlm.nih.gov/Omim/) and from the GeneCard database of the Weitzman Institute of Science, Rehovot, Israel (http://bioinfo.weizmann.a.il/cards/index.html) Hierarchical cluster analysis and cluster image mapping were performed with the mRNA expression of these genes (Fig. 2). The dendrogram of the heat map can be separated into six major clusters (Fig. 2). Cluster 1 and 5 included mainly sensitive, cluster 2, 3 and 4 contained mostly resistant cell lines. Cluster 6 has only resistant cell lines. The distribution of sensitive and resistant cell lines showed statistically significant (p = 0.65 × 10–2) (Table 3).
Fig. 2

Hierarchical cluster analysis and heatmap of genes expressions involved in cancer cell sensitivity to triptolide

Table 3

Separation of clusters of NCI cell lines obtained by hierarchical cluster analyses for triptolide shown in Fig. 2

SensitiveResistant
Partition ≤ -7.948 > -7.948
Cluster 162
Cluster 237
Cluster 358
Cluster 428
Cluster 5133
Cluster 602
Chi-square testp = 0.65 × 10–2
Hierarchical cluster analysis and heatmap of genes expressions involved in cancer cell sensitivity to triptolide Separation of clusters of NCI cell lines obtained by hierarchical cluster analyses for triptolide shown in Fig. 2

Transcription factor binding motif analysis in gene promoters

Forty genes were identified by COMPARE analysis and the promoters of these genes contained transcription factor binding motifs for NF-κB and GATA proteins (GATA1, 2 and 3) (Figs. 3 and 4). The NF-κB DNA binding motif (Rel) was significantly enriched (with a log p-value of -3.6) in regions of 25 kb upstream promoter of all genes, with 254 hits and a Z-score of -1.94 (Fig. 3). This analysis demonstrated that NF-κB plays a crucial role in the regulation of genes related to triptolide, as it was reported before [11, 12]. Furthermore, the binding motifs of GATA proteins 1, 2 and 3 were widely distributed in the promoter regions of all genes, with 112 hits, a Z-score of -3.5, with 219 hits, a Z-score of -3.7 and with 135 hits, a Z-score of -5.7, respectively (Fig. 4).
Fig. 3

Binding motif analysis of 25 kb upstream regions of 40 genes identified by COMPARE analysis revealing the significant presence of NF-κB binding motifs 

Fig. 4

Binding motif analysis of 25 kb upstream regions of 40 genes identified by COMPARE analysis revealing the significant presence of GATA proteins binding motif

Binding motif analysis of 25 kb upstream regions of 40 genes identified by COMPARE analysis revealing the significant presence of NF-κB binding motifs Binding motif analysis of 25 kb upstream regions of 40 genes identified by COMPARE analysis revealing the significant presence of GATA proteins binding motif In order to study the interaction of triptolide with the NF-κB pathway in more detail, molecular docking analyses were carried out using IκB kinase β, IκB kinase β-NEMO, NF-κB, NF-κB DNA complex in silico. Triptolide strongly bound to the pharmacophores of IκB kinase β and NF-κB DNA complex. Triptolide bound to IκB kinase β with a binding energy of -7.85 kcal/mol and to NF-κB DNA complex with a binding energy of -7.68 kcal/mol (Table 4).
Table 4

In silico molecular docking of triptolide on NF-ĸB Pathway proteins. Dockings were performed with 250 runs for each protein

ProteinLowest energy of docking (kcal/mol)Mean binding energy (kcal/mol)Residues involved hydrogen bond interaction with the ligandResidues involved in hydrophobic interaction with ligandpKi (nM)
IĸB kinase β-7.85 ± 0.26-7.78 ± 0.32LYS44, GLU100

LEU21, THR23, VAL29, ALA42, LYS44, VAL74, MET96, TYR98, CYS99, GLU100, GLY102, GLU149,

ASN150, VAL152, ILE165, ASP166, LEU167

1.89 ± 0.91
IĸB kinase β- NEMO-6.16 ± 0.02-6.08 ± 0.01-MET94, PHE97, ALA100, ARG101, VAL10430.72 ± 0.12
NF-ĸB-5.88 ± 0.12-5.86 ± 0.13PHE273, PHE276, ARG290GLN271, ALA272, PHE273, GLY274, ASP275, PHE276, ARG290, PRO29249.70 ± 10.61
NF-ĸB DNA complex-7.68 ±  < 0.00-7.66 ±  < 0.00DA18DT8, DT9, DA18, DG19, DT20, ARG1242.35 ±  < 0.00
In silico molecular docking of triptolide on NF-ĸB Pathway proteins. Dockings were performed with 250 runs for each protein LEU21, THR23, VAL29, ALA42, LYS44, VAL74, MET96, TYR98, CYS99, GLU100, GLY102, GLU149, ASN150, VAL152, ILE165, ASP166, LEU167 Deregulated genes identified by COMPARE analysis were subjected to IPA. Interestingly, pathways regulating cell death and survival, cellular development, cellular growth, cancer, post translation modification and humoral immune response, etc. appeared as top affected cellular functions and diseases (Fig. 5).
Fig. 5

Biological functions affected by triptolide as determined by mRNA microarray hybridization and ingenuity pathway analysis

Biological functions affected by triptolide as determined by mRNA microarray hybridization and ingenuity pathway analysis The canonical pathways analysis revealed that triptolide affects numerous pathways, such as natural killer cell signaling, ephrin receptor signaling, crosstalk between dendritic cells and natural killer cells, integrin signaling, actin cytoskeleton signaling, etc. (Fig. 6). On the other hand, the upstream regulators that were identified using IPA showed ZFPM1 as the top transcription regulators with a p-value of 2.85E-04.
Fig. 6

Biological functions affected by triptolide as determined by mRNA microarray hybridization and Ingenuity Pathway Analysis

Biological functions affected by triptolide as determined by mRNA microarray hybridization and Ingenuity Pathway Analysis

Experimental verification of binding motif analyses

NF-ĸB reporter assay

Since molecular dockings and motif analysis showed the high binding affinities of triptolide to NF-κB and its regulator, IκB, we carried out NF-κB reporter assay using a SEAP-driven cell line. Triptolide inhibited NF-κB activity in a dose-dependent manner (Fig. 7).
Fig. 7

Effect of triptolide on NF-κB activity

Effect of triptolide on NF-κB activity

EMSA of GATA following triptolide incubation

EMSA testing was performed with probes spanning a well-characterized GATA1 site to evaluate if triptolide can inhibit binding of transcription factor GATA1. Pre-incubation of GATA1-containing nuclear extracts with various concentrations of triptolide did not influence the binding pattern of the GATA1 protein to the probes. GATA1 protein binding was verified by addition of anti-GATA1 giving rise to a clear supershift in all cases except for the negative control, for which neither a shift nor a supershift was observed when a probe with a disrupted GATA site was used (Fig. 8).
Fig. 8

EMSA Testing was performed with 48-bp biotinylated probes spanning the GATA1 site investigated. A The wild-type probe (GATA) exhibited a shift (white arrow) upon incubation with nuclear extract (NE) from K562 cells, mock-treated or pre-incubated with different concentrations of triptolide (5, 10, and 20 nM), and a further supershift (black arrow) with addition of anti-GATA1, detecting binding of GATA1 to the wild-type probe. As a negative control the probe with a disrupted GATA1 site (GAGA) showed no shift with nuclear extract and hence no supershift could be detected. B Further testing was performed (controls not shown) with higher and lower concentrations of triptolide (100 and 2.5 nM) when the incubation time was prolonged from 5 min to 10. For all concentrations tested there are clear shifts and supershifts further indicating that triptolide does not inhibit GATA1 protein binding to the probes

EMSA Testing was performed with 48-bp biotinylated probes spanning the GATA1 site investigated. A The wild-type probe (GATA) exhibited a shift (white arrow) upon incubation with nuclear extract (NE) from K562 cells, mock-treated or pre-incubated with different concentrations of triptolide (5, 10, and 20 nM), and a further supershift (black arrow) with addition of anti-GATA1, detecting binding of GATA1 to the wild-type probe. As a negative control the probe with a disrupted GATA1 site (GAGA) showed no shift with nuclear extract and hence no supershift could be detected. B Further testing was performed (controls not shown) with higher and lower concentrations of triptolide (100 and 2.5 nM) when the incubation time was prolonged from 5 min to 10. For all concentrations tested there are clear shifts and supershifts further indicating that triptolide does not inhibit GATA1 protein binding to the probes

Discussion

Triptolide inhibits the proliferation and induces apoptotic cell death in several cancers. Triptolide increases the nuclear accumulation of p53 and apoptotic cell death in human prostatic epithelial cells [44]. Multi-drug resistance (MDR) is an obstacle for cancer therapy [45]. Triptolide inhibited the expression of MDR protein and promoted apoptotic cell death of drug-sensitive parental KB cells and multidrug-resistant KB-7D and KB-tax cells [46]. Besides, triptolide changed the activity of P-glycoprotein drug efflux and mRNA expression of MDR genes [9]. We have comparable results that triptolide strongly inhibited the growth not only of drug-sensitive CCRF-CEM cells but also MDR P-glycoprotein overexpressing CEM/ADR5000 cells in the nanomolar range. Collateral sensitivity (hypersensitivity) is occasionally observed in ABC-transporter-expressing cells. This event has been well known for several years in ABCB1 (P-gp/MDR1) and MRP1 overexpressing tumor cells [47, 48]. Interestingly, P-glycoprotein overexpressing CEM/ADR5000 cells revealed collateral sensitivity to triptolide in comparison with their parental drug-sensitive counterparts. Collateral sensitivity represents an interesting phenomenon from the therapeutic point of view, because it opens the perspective that drug-resistant refractory tumors could be successfully treated with this kind of drugs [49]. EGFR is a member of the ErbB family of receptors. Upon binding with its ligands, such as EGF or TGF-α, EGFR homo- or hetero-dimerizes with other ErbB family members to activate downstream signaling cascades after tyrosine phosphorylation. This signaling controls several cellular processes, such as proliferation, survival, and apoptosis. EGFR mutations leading to EGFR overexpression result in cancer development, and EGFR mutations affect the poor prognosis of patients and mediate drug resistance of tumors [50]. The in-frame deletion of the extracellular EGFR domain causes ligand-independent receptor activation and represents a common mutant type in brain tumors, termed ΔEGFR [51]. Triptolide showed strong inhibitory effects towards both wtEGFR (sensitive) and ΔEGFR (resistant) with the same concentrations. These results demonstrate that ΔEGFR does not confer resistance against triptolide, indicating that triptolide might be a suitable candidate to treat drug-resistant tumors with ΔEGFR mutation. The relationship between the gene expression patterns and the drug responses was investigated using the tumor cell line panel of the NCI developmental therapeutic program. We identified a gene expression profile, which was significantly related to the log10IC50 values of the cell lines to triptolide. COMPARE analysis identified a set of genes from several functional groups (e.g., cell morphology, transmembrane, ribosomal proteins, protein tyrosine phosphatase, and microtubule formation). Cluster analyses were carried out to predict, whether the cancer cell lines were sensitive or resistant to a cytotoxic drug [52]. The distribution of triptolide-sensitive or -resistant cell lines differed significantly among the different clusters. The portion of sensitive cells in clusters 1 and 5 was much higher than in clusters 2, 3, 4 and 6. Cluster 1 included 75% sensitive cells and 25% resistant cells. Cluster 2 contained 30% sensitive cell lines and 70% resistant cell lines. Cluster 3 contained 38% sensitive cell lines and 62% resistant cell lines. Cluster 4 had 20% sensitive cells and 80% resistant cells. Cluster 5 contained 81% sensitive cell lines and 19% resistant cell lines. Cluster 6 included 100% resistant cell lines. This distribution showed significant differences among the clusters as demonstrated by the chi square test (p = 0.65 × 10–2). The cluster analysis identified two clusters with predominantly triptolide-sensitive and four clusters with predominantly triptolide-resistant cell lines. What does this mean for cancer therapy? By applying this two-step approach with COMPARE and cluster analyses, it was possible to predict cellular drug response by gene expression profiling of cell lines. It is not beyond the scope of imagination that similar approaches may be applied to predict the sensitivity of individual tumors of patients towards standard chemotherapeutic drugs and also cytotoxic compounds such as triptolide. In case resistance to standard chemotherapy occurs, the oncologist could switch to cytotoxic natural products which are still active in these otherwise resistant tumors. Hence, the estimation of sensitivity or resistance to cytotoxic drugs by mRNA expression profiles may be applied for novel strategies of individualized cancer treatment and precision medicine, because an approach like this could provide opportunity to determine prior to therapy, whether or not an individual tumor would react to specific drugs or natural products. In addition to the prediction of sensitivity or resistance to specific anticancer compounds, gene expression profiling coupled with COMPARE and cluster analyses can be used to identify relevant molecular mechanisms of triptolide (and other anticancer drugs and natural products) to unravel underlying molecular modes of action of drugs. In the case of triptolide, we found that NF-κB plays an important role for the anticancer activity of triptolide. NF-κB is a ubiquitous transcription factor that controls the expression of genes involved in inflammation, the immune response, cell proliferation, and apoptosis [53]. Interestingly, the NF-κB binding motif was identified in the upstream promoter regions of all genes, which were identified by COMPARE analysis, demonstrating that NF-κB is a crucial transcription regulator of triptolide´s activity in cancer cells. NF-ĸB is cell nuclear factor, which is related to transcription regulation in the process of inflammation, stress, cell growth and proliferation. NF-ĸB promotes cell proliferation, cell apoptosis and plays a crucial role for the tumor development. NF-ĸB is a heterologous dimer composed of p50 and p65. Triptolide inhibits the transactivation effect of the p65 subunit of NF-ĸB and promotes cell apoptosis [10]. Triptolide also indirectly inhibits NF-ĸB signaling through the AKT/GSK3β/mTOR pathway and induces apoptosis in ovarian cancer by inhibition of NF-ĸB expression [54, 55]. IPA was carried out to predict molecular mechanism of triptolide using COMPARE and hierarchical cluster analyses genes. IPA indeed showed cellular processes revealing the anti-tumor activity of triptolide. Furthermore, it presented the ZFPM1 (friend of GATA1) as a top candidate in the upstream regulators list. These results are in accordance with the data obtained from the motif analyses. Therefore, we wanted to investigate the inhibition of GATA1 function by triptolide. To the best of our knowledge, the effect of triptolide towards GATA1 is described here for the first time. EMSA experiments displayed that triptolide has no apparent effect on GATA1 binding to its motif. One study showed that GATA1 was up-regulated in Sertoli cells upon treatment with triptolide for 15 days. Then, the authors concluded that triptolide has no effect at the level of Gata1 and the change in the expression was probably due to cellular changes leading to spermatids formation [56]. In conclusion, triptolide showed remarkable cytotoxic effect in different sensitive and drug-resistant cancer cell lines. In particular, P-glycoprotein overexpressing CEM/ADR5000 cells were collateral sensitive toward triptolide. Other investigations were performed to understand the mechanism of action of triptolide. Bioinformatics tools predicted the sensitivity or resistance of tumor cells to triptolide using 60 NCI cell lines. Ingenuity Pathway Analysis identified cellular processes and signaling pathways of genes involved in the mechanisms of action of PT. Finally, triptolide strongly inhibited the activity of NF-κB, while it did not show significant effect towards GATA1.
  55 in total

Review 1.  ErbB receptors: from oncogenes to targeted cancer therapies.

Authors:  Hongtao Zhang; Alan Berezov; Qiang Wang; Geng Zhang; Jeffrey Drebin; Ramachandran Murali; Mark I Greene
Journal:  J Clin Invest       Date:  2007-08       Impact factor: 14.808

Review 2.  The ability of molecular docking to unravel the controversy and challenges related to P-glycoprotein--a well-known, yet poorly understood drug transporter.

Authors:  Maen Zeino; Mohamed E M Saeed; Onat Kadioglu; Thomas Efferth
Journal:  Invest New Drugs       Date:  2014-04-22       Impact factor: 3.850

3.  An information-intensive approach to the molecular pharmacology of cancer.

Authors:  J N Weinstein; T G Myers; P M O'Connor; S H Friend; A J Fornace; K W Kohn; T Fojo; S E Bates; L V Rubinstein; N L Anderson; J K Buolamwini; W W van Osdol; A P Monks; D A Scudiero; E A Sausville; D W Zaharevitz; B Bunow; V N Viswanadhan; G S Johnson; R E Wittes; K D Paull
Journal:  Science       Date:  1997-01-17       Impact factor: 47.728

4.  Transcriptome analysis identifies key regulators and networks in Acute myeloid leukemia.

Authors:  Jiaxin Ye; Daliang Luo; Jianhong Yu; Sibo Zhu
Journal:  Hematology       Date:  2019-12       Impact factor: 2.269

5.  Triptolide decreases expression of latency-associated nuclear antigen 1 and reduces viral titers in Kaposi's sarcoma-associated and herpesvirus-related primary effusion lymphoma cells.

Authors:  Cong Long; Wei Guo; Heng Zhou; Jingchao Wang; Huan Wang; Xiaoping Sun
Journal:  Int J Oncol       Date:  2016-01-25       Impact factor: 5.650

6.  Cistrome: an integrative platform for transcriptional regulation studies.

Authors:  Tao Liu; Jorge A Ortiz; Len Taing; Clifford A Meyer; Bernett Lee; Yong Zhang; Hyunjin Shin; Swee S Wong; Jian Ma; Ying Lei; Utz J Pape; Michael Poidinger; Yiwen Chen; Kevin Yeung; Myles Brown; Yaron Turpaz; X Shirley Liu
Journal:  Genome Biol       Date:  2011-08-22       Impact factor: 13.583

7.  Glioma Association and Balancing Selection of ZFPM2.

Authors:  Shui-Ying Tsang; Lingling Mei; Weiqing Wan; Jun Li; Yi Li; Cunyou Zhao; Xiaofan Ding; Frank W Pun; Xiaoxia Hu; Jianmin Wang; Junyi Zhang; Rongcheng Luo; Siu-Tim Cheung; Gilberto K K Leung; Wai-Sang Poon; Ho-Keung Ng; Liwei Zhang; Hong Xue
Journal:  PLoS One       Date:  2015-07-24       Impact factor: 3.240

8.  Computational prediction and experimental validation of a novel synthesized pan-PIM inhibitor PI003 and its apoptosis-inducing mechanisms in cervical cancer.

Authors:  Zhongyu Liu; Weihua He; Jianglin Gao; Junhua Luo; Xian Huang; Chunfang Gao
Journal:  Oncotarget       Date:  2015-04-10

9.  Cytotoxicity of methanol extracts of Annona muricata, Passiflora edulis and nine other Cameroonian medicinal plants towards multi-factorial drug-resistant cancer cell lines.

Authors:  Victor Kuete; Joachim K Dzotam; Igor K Voukeng; Aimé G Fankam; Thomas Efferth
Journal:  Springerplus       Date:  2016-09-27

10.  Multifactorial Modes of Action of Arsenic Trioxide in Cancer Cells as Analyzed by Classical and Network Pharmacology.

Authors:  Mona Dawood; Sami Hamdoun; Thomas Efferth
Journal:  Front Pharmacol       Date:  2018-02-27       Impact factor: 5.810

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.