The ongoing COVID-19 pandemic is caused by SARs-CoV-2. The virus is transmitted from person to person through droplet infections i.e. when infected person is in close contact with another person. In January 2020, first report of detection of SARS-CoV-2 in faeces, has made it clear that human wastewater might contain this virus. This may illustrate the probability of environmentally facilitated transmission, mainly the sewage, however, environmental conditions that could facilitate faecal oral transmission is not yet clear. We used existing Pakistan polio environment surveillance network to investigate presence of SARs-CoV-2 using three commercially available kits and E-Gene detection published assay for surety and confirmatory of positivity. A Two-phase separation method is used for sample clarification and concentration. An additional high-speed centrifugation (14000Xg for 30 min) step was introduced, prior RNA extraction, to increase viral RNA yield resulting a decrease in Cq value. A total of 78 wastewater samples collected from 38 districts across Pakistan, 74 wastewater samples from existing polio environment surveillance sites, 3 from drains of COVID-19 infected areas and 1 from COVID 19 quarantine center drainage, were tested for presence of SARs-CoV-2. 21 wastewater samples (27%) from 13 districts turned to be positive on RT-qPCR. SARs-COV-2 RNA positive samples from areas with COVID 19 patients and quarantine center strengthen the findings and use of wastewater surveillance in future. Furthermore, sequence data of partial ORF 1a generated from COVID 19 patient quarantine center drainage sample also reinforce our findings that SARs-CoV-2 can be detected in wastewater. This study finding indicates that SARs-CoV-2 detection through wastewater surveillance has an epidemiologic potential that can be used as supplementary system to monitor viral tracking and circulation in cities with lower COVID-19 testing capacity or heavily populated areas where door-to-door tracing may not be possible. However, attention is needed on virus concentration and detection assay to increase the sensitivity. Development of highly sensitive assay will be an indicator for virus monitoring and to provide early warning signs.
The ongoing COVID-19 paene">ndemic is caused by n class="Species">SARs-CoV-2. The virus is transmitted from person to person through droplet infections i.e. when infected person is in close contact with another person. In January 2020, first report of detection of SARS-CoV-2 in faeces, has made it clear that human wastewater might contain this virus. This may illustrate the probability of environmentally facilitated transmission, mainly the sewage, however, environmental conditions that could facilitate faecal oral transmission is not yet clear. We used existing Pakistan polio environment surveillance network to investigate presence of SARs-CoV-2 using three commercially available kits and E-Gene detection published assay for surety and confirmatory of positivity. A Two-phase separation method is used for sample clarification and concentration. An additional high-speed centrifugation (14000Xg for 30 min) step was introduced, prior RNA extraction, to increase viral RNA yield resulting a decrease in Cq value. A total of 78 wastewater samples collected from 38 districts across Pakistan, 74 wastewater samples from existing polio environment surveillance sites, 3 from drains of COVID-19infected areas and 1 from COVID 19 quarantine center drainage, were tested for presence of SARs-CoV-2. 21 wastewater samples (27%) from 13 districts turned to be positive on RT-qPCR. SARs-COV-2 RNA positive samples from areas with COVID 19patients and quarantine center strengthen the findings and use of wastewater surveillance in future. Furthermore, sequence data of partial ORF 1a generated from COVID 19patient quarantine center drainage sample also reinforce our findings that SARs-CoV-2 can be detected in wastewater. This study finding indicates that SARs-CoV-2 detection through wastewater surveillance has an epidemiologic potential that can be used as supplementary system to monitor viral tracking and circulation in cities with lower COVID-19 testing capacity or heavily populated areas where door-to-door tracing may not be possible. However, attention is needed on virus concentration and detection assay to increase the sensitivity. Development of highly sensitive assay will be an indicator for virus monitoring and to provide early warning signs.
Novel coronavirus pneumonia (n class="Disease">COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2) infection has become a global emergency through its widespread infection with 43,504,448 confirmed cases resulting 1,159,533 deaths in 213 countries as of 26th October, 2020 [1]. In December 2019, cluster of pneumonia like disease cases with symptoms including fever, difficulty in breathing, cough and invasive lesion on both lungs were reported from Wuhan, China [2]. The causative agent was identified as a Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) after ruling out SARS-CoV, MERS-CoV, influenza, avian influenza, adenovirus and other common respiratory pathogens [3]. Coronaviruses belonging to family Cornaviridae are enveloped, non-segmented positive sense RNA viruses distributed in human and mammals [4]. However, majority of humancoronaviruses have mild infections but two betacornaviruses; severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV) caused outbreaks in last two decades with 10% and 35.6% mortality rate respectively [5-7].
On March 11, 2020 WHO declared it as pandemic, when disease was reported in 114 countries [8]. The primary routes of viral transmission (SARS-CoV-2) was coene">nsidered to be through droplet n class="Disease">infections and person to person close contact, but later it is evident from various published studies that there is increasing possibility of fecal-oral transmission, however, environmental conditions that could facilitate faecal oral transmission is not yet clear [9, 10]. This shows the probability of environmentally mediated transmission. Since the early days of pandemic, we got interested in understanding and utilizing the role of environmental sampling mainly the sewage.
SARS-CoV-2 resembles 82% with n class="Species">SARS coronavirus (SARS-CoV) which caused an outbreak in 2003. Studies have shown the survival of SARS-CoV in stool for up to 4 days [7]. Another study described the presence of SARS-CoV and its infectious nature in water and sewage for days to weeks [11]. It was also described that faulty sewage system contaminated with SARs-CoV in a high-rise housing estate of Hong Kong during 2003 was linked to SARS outbreak involving large number of residents of surrounding buildings [12]. A recent study highlighted the shedding through stool of SARS-CoV-2 in cluster of 9 nCOVID-19patients. It was reported that that the RNA concentration decreased from 107 RNA copies/g to 103 RNA copies/g after one week of symptom onset to third week [13]. Since the source of transmission of SARS-CoV-2 is still unknown therefore wastewater transmission pathway can become an important mode [14]. Hence, the presence of SARS-CoV-2 in contaminated sewage sample and its role in transmission needs to be investigated.
First COVID-19 case was reported in Pakistaene">n oene">n 26th February 2020 in a traveler returene">ning from a religious coene">ngregatioene">n in Iraene">n, now there have beeene">n 329,375 coene">nfirmed cases with 6,745 n class="Disease">deaths as of 26th October 2020 [15]. Initially the cases were identified only in traveler returning from religious congregation, but soon afterwards local transmission was established with resident cases without any history of travel from mid-March. In this study, we used the existing polio environment surveillance network in Pakistan through which sewage samples were collected from designated sites on monthly basis in different districts of the country to investigate poliovirus presence, its spread and molecular epidemiology. Same samples collected from mid-March till 30th April 2020 were processed and tested for detection of SARs-CoV-2 RNA.
Materials and methods
The study plan and use of environmental surveillance network was approved by Natioene">nal Iene">nstitute of Health, Pakistaene">n vide letter n class="Gene">No NIH/ PHLD/21/VIR/RRL/001. Untreated wastewater samples (sewage samples) selected for testing in this study were collected using the grab sampling technique. Most of them were those collected for routine polio environment surveillance (ES). Polio ES sites are either open drains or pumping stations and are sampled routinely on monthly basis. Each sampling site represent 100,000–300,000 population [16]. Besides, wastewater from drains of some areas with recent history of SARS-CoV2 cases were also collected for detection and re-confirmation of SARs-CoV-2 detection. Sampling personnel strictly followed the standard safety guidelines for personnel protective equipment (PPE) required for wastewater sampling. One liter of sewage water was collected from the mid-stream into a sterile, leak proof container at a downstream sampling site during the peak morning flow. These samples were transported in properly sealed container with information form, indicating sampling site, district, sampling date and sampling time, to laboratory within 48 hours of collection maintaining reverse cold chain [16]. Samples were processed in laboratory for virus concentration using the two-phase separation method [17].
500 ml of each raw sewage specimens was concentrated. Firstly, clarification of the sample was done by pelleting of larger suspended solids by centrifugation (1500 X g for 20 min). The clarified sewage sample was mixed with defined amounts of polymers, 22% n class="Chemical">DextranT40 (Pharmacosmos A/S, Cat# 551000409006) and 29% polyethylene glycol (PEG-6000, Sigma Analytical, Cat# 81255) and 5NSodium Chloride (Sigma-aldrich) [17]. The homogenous mixture obtained by vigorous shaking is left to stand overnight at 4°C in a separation funnel. The polymer helped to form two distinct layers (phases) in the funnel which were collected and mixed with pellet formed in first step which was then treated with chloroform [17] (S1 Fig).
400 μl of processed sample was centrifuged at high speed (14000 X g) for 30 min to pellet the suspended solid particles that may increase the viral RNA yield. Virus may partly bouene">nd to these solids. Superene">nataene">nt was discarded carefully without disturbing the pellet. Pallet was theene">n mixed with 300 μl of Rn class="Gene">Nase free water by vigorous vortexing and was processed for RNA extraction.
Spin star viral nucleic acid kit 1.0 (n class="Gene">ADT Biotech, Phileo Damansara 1, Petaling Jaya Part No. 811803) was used to extract the viral RNA. Internal control provided with kits were added as an amplification control in rRT-PCR. Pellet was dissolved with 430 μl of lysis buffer supplied with kit, followed by 5 min vortexing to homogenously dissolve the pallet. Further processing was done as per the manufacturer’s instructions. The final elution volume is 60μl. The extracted viral RNA was store at -20°C till further testing.
Multiple qualitative reverse transcription real-time PCR kits for ideene">ntificatioene">n of n class="Species">SARS-CoV2 were used. These kits were already in use country wide for detection of SARS-CoV2 in human. These were (Kit 1) Real-Time Fluorescent RT-PCR Kit for detecting 2019-nCoV by BGI China (IVD &CE marked; Catalogue No. MFG030010), takes ORF 1ab gene as the target domain, (Kit 2) qRT-PCR for Novel Coronavirus (2019-nCoV) Nucleic Acid Diagnostic Kit (PCR-Flourescence Probing, IVD marked) by Sansure Biotech (Sansure Biotech Inc China, Ref No. S3102E). The kit utilizes novel coronavirus (2019-nCoV) ORF-1 gene and a conserved coding nucleocapsid protein N-gene as the target regions and finally (Kit 3) detection Kit for 2019 Novel Coronavirus RNA (PCR-Fluorescence Probing) targeting the ORF 1ab and N gene of SARS-CoV-2/2019-nCoV by Da An Gene Co., China (IVD and CE marked; Catalogue No. DA-930). Thermal cycling and results interpretation were performed as per manufacturer’s instruction.
For further confirmation these samples were also tested for envelop protein (E) gene detection using the primers / probe sets that was published by Corman V. M. et al. [18]. A 25 μl reaction contain 5 μl RNA, 12.5 μl 2x reactioene">n buffer provided with the Superscript III oene">ne step RT-PCR with platinum Taq n class="Chemical">Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribose triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μl of reverse transcriptase / Taq mixture from Kit and different concentration of primers and probes (Table 1). Thermal cycling was carried out at 55°C for 10 min, followed by 95°C for 3min. Then 45 cycles of 95°C for 15 sec, 58°C for 30 sec on ABI 7500 real time system (Applied Bio Systems, US. Cat # 4351104).
Table 1
E Gene primers and probes for 2019 SARS-CoV2 real time- RT-PCR.
aFAM: 6-carboxyfluorescein; BBQ: blackberry quencher.Genetic sequencing was based on conventional amplification of genomic RNA by using Qiageene">n Oene">ne step RT PCR n class="Gene">kit as described by Shirato K et al [19]. The ORF 1a gene was amplified, using a pair of primers NIID_WH-1_F501 (TTCGGATGCTCGAACTGCACC) and NIID_WH-1_R913 (CTTTACCAGCACGTGCTAGAAGG). After 1st PCR, nested PCR was performed using 2nd PCR primers (Sense: NIID_WH-1_F509(CTCGAACTGCACCTCATGG), Antisense: NIID_WH-1_R854 CAGAAGTTGTTATCGACATAGC) and 1 μl of 1st PCR product under the same condition. PCR amplicons from 2nd round were purified by Qiaquick PCR purification Kit (Qiagen, Germany) and directly sequenced by using Sequencing primers (Sense: NIID_WH-1_Seq_F519 ACCTCATGGTCATGTTATGG, Antisense: NIID_WH-1_Seq_R840 GACATAGCGAGTGTATGCC) on ABI 3100 genetic analyzer using Big Dye Terminator kit V.3.0.cycle sequencing kit (ABI Foster City Canada, USA). The nucleotide sequences were assembled, edited and analyzed by Sequencher software v.4.9 (GeneCodes Incorporation, USA). The nucleotide sequence obtained was blasted against the available NCBI databank (https://blast.ncbi.nlm.nih.gov/Blast.cgi).
Results
A total of 76 wastewater samples were collected betweeene">n 12 to 18 epidemiological weeks from 38 districts across country and were tested for SARs-CoV-2 RNA (Fig 1). 21 wastewater samples (27%) from 13 districts were positive on RT-qPCR (Table 2).
Fig 1
Geographical representation.
A. Map indicating environmental sampling sites. Each dot represents a wastewater collection site B. Map representing districts with SARs-CoV-2 positive wastewater samples as dark grey color. Each dot represents a positive wastewater sample C. Graphical representation of positive samples among tested samples.
Table 2
Wastewater sample tested for SAR-COV2 at virology department, National Institute of Health, Islamabad, Pakistan.
EPI Week
COVID-19 Detection
Samples Tested
Positive
Negative
Week12
2
1
1
Week14
13
2
11
Week15
16
4
12
Week16
32
10
22
Week17
9
1
8
Week18
6
3
3
Geographical representation.
A. Map indicating environmental sampling sites. Each dot represents a wastewater collectioene">n site B. Map represeene">nting districts with n class="Species">SARs-CoV-2 positive wastewater samples as dark grey color. Each dot represents a positive wastewater sample C. Graphical representation of positive samples among tested samples.
Primarily, 20 wastewater samples were collected during March 20, 2020 to April 09, 2020 from 17 districts of Pakistaene">n; 18 samples from differeene">nt polio eene">nviroene">nmeene">ntal sites (ES) distributed across 16 districts aene">nd 02 samples in areas with receene">nt history of n class="Species">SARS-CoV2 cases from capital city Islamabad. All these samples were tested against the three commercially available SARS-CoV-2 RNA detection diagnostic kits (mentioned under materials and methods). Negative control supplied with the diagnostic kits containing the internal control was added in each sample during extraction to ensure none of the wastewater extracted RNA samples had RT-qPCR inhibition. A total of 6 samples (30%) were positive for SARs-CoV-2 RNA, out of these all were detected on Kit 1, 2 (either one gene positive or both, results interpreted as per manufacturer’s instruction) and E gene method whereas only 4 were positive on Kit 3. 4 positive samples had Cq values between 32 to 38, whereas remaining 2 samples collected in areas with history of SARs-CoV-2 cases from Islamabad were positive on all three diagnostic kits and E gene method having Cq between 36 to 38 (S1 Table).
A centrifugation step was also introduced before Viral RNA extractioene">n to increase viral Rn class="Gene">NA yield. A decrease in Cq value has been observed, describing an increase in viral RNA concentration (S3 Table). Furthermore, 56 samples collected and received in laboratory from April 6, 2020 to April 28,2020 for polio diagnostics were also tested for detection of SARs-CoV-2, out which 14 (24%) were positive. One sample was collected from the drain of a Rawalpindi Institute of Urology (RIU), a COVID-19patient quarantine center, while other from a drain having catchment area with recent history of COVID-19patients. Both collection sites are in district Rawalpindi. These samples were found positive for SARs-COV-2 RNA on RT-qPCR (S2 Table).
The sample collected from the drain of RIU, Rawalpindi was also subjected for partial sequencing of SARs-CoV-2n class="Gene">ORF-1a. Nucleotide sequence of partial SARs-CoV-2ORF 1a is submitted in gene bank under accession number MT539157.
Discussion
The role of environmental surveillance in supporting Global Polio Eradication Initiative has already been acknowledged [20]. The environmental surveillance can be used as supplemental tool for detection pathogens circulating within the community. Wastewater provides a near-real-time data as it coene">nstaene">ntly collects feces, urine aene">nd traces of sputum that caene">n coene">ntainn class="Species">SARs-CoV-2 shed by the infected individuals. Viral load estimation in COVID-19 positive patients are still uncertain, however, recently N. Zhang et al. suggests levels as high as 600,000 viral genomes per ml of fecal material [21]. Similarly another study reported approximately 30,00,000 viral particles in a single fecal sample [21]. A previously published study on coronavirus reported that it remained infectious in water and sewage for days to weeks. Researchers reported time required for 99% reduction of virus infectivity was several days at room temperature in pure water or wastewater [22]. This adds another potential supplemental detection source of SARs-CoV-2 in communities.
In this study, we investigated the presence of SARs-CoV-2 Rn class="Gene">NA in wastewater using the existing poliovirus environment surveillance network that can be used in future as alternative system for the dependent area as SARS-CoV-2 supplementary surveillance. This definitely needs further evaluation and discussions; however, this seems to have a very interesting utilization in epidemiology. A total of 21 out of 78 positive wastewater samples for SARs-CoV-2 RNA clearly indicates viral RNA shedding in stool of infected individuals (Fig 1). Currently, there is no evidence of infection transmission of SARs-COV-2 or related SARs-Corona via wastewater [23].
We used three commercially available kits aene">nd Published E-Geene">ne detectioene">n assay for surety aene">nd coene">nfirmatory of positivity. Samples collected from Quetta district at two differeene">nt time intervals indicates n class="Disease">COVID-19 prevalence and surge in infected individuals. This can be assumed from the decrease in Cq value in wastewater sample collected two weeks after. Detection of SARs-COV-2 RNA in two specific wastewater samples collected from areas with recent history of COVID-19patients clearly explain that wastewater testing for COVID-19 can be used as a supplementary system. Likewise, SARs-COV-2 RNA positive samples from RIU, Rawalpindi and an area in Rawalpindi with COVIDpatients further strengthen the findings and use of this tool in future. This surveillance system can picks up vast majority of infected individuals with SARs-CoV-2 who do not present symptoms for the disease [23]. Furthermore, sequence data of partial ORF 1a generated from ICT-04 also reinforce our findings that SARs-CoV-2 can be detected in wastewater in Pakistan. Interestingly, the additional extra centrifugation step before viral RNA extraction seems to be encouraging in increasing the yield of viral RNA. This can be obvious from the data presented in S3 Table.
The surveillance through wastewater caene">n be useful in remote or coene">nfined communities, however, further studies are needed oene">n virus coene">nceene">ntratioene">n aene">nd detectioene">n assay to increase the seene">nsitivity. This has aene">n epidemiologic poteene">ntial for early detectioene">n of high burdeene">n area in advaene">nce; aene">nd heavily populated areas where door-to-door tracing may not be possible. This may also be more relevaene">nt to the developing countries with limited molecular testing. Developmeene">nt of highly seene">nsitive assay will be aene">n indicator for virus moene">nitoring aene">nd to provide early warene">ning signs. The developmeene">nts oene">n use of sewage samples for n class="Species">SARs CoV2 detection should be further investigated and correlated with the quantitative data which has not been addressed in this study.
Conclusion
SARS-CoV-2 detectioene">n in wasten class="Chemical">water using RT-qPCR assay, confirmed by sequencing, is a milestone in the field of epidemiology. The study finding indicates that environmental surveillance through wastewater could be used as a potential supplementary system (as used in case of poliovirus) to monitor viral tracking and circulation in settings where person to person testing capacity is limited. The virus concentration and detection method in wastewater needs attention to increase sensitivity of detection of SARs-CoV-2 in wastewater.
Process flow chart: Sewage sample concentration of wastewater by two-phase separation method.
(TIF)Click here for additional data file.
Average COVID-19 positive case per epidemiological week in Pakistan.
(TIF)Click here for additional data file.
Wastewater samples collected during March 20, 2020 to April 09, 2020.
A comparative analysis.(DOCX)Click here for additional data file.
Details of wastewater samples tested for SARS-CoV2 at virology department, National Institute of Health, Islamabad, Pakistan.
(DOCX)Click here for additional data file.
Sample preparation without and with centrifugation before viral RNA extraction.
Comparison among the Cq values.(DOCX)Click here for additional data file.
Authors: Warish Ahmed; Nicola Angel; Janette Edson; Kyle Bibby; Aaron Bivins; Jake W O'Brien; Phil M Choi; Masaaki Kitajima; Stuart L Simpson; Jiaying Li; Ben Tscharke; Rory Verhagen; Wendy J M Smith; Julian Zaugg; Leanne Dierens; Philip Hugenholtz; Kevin V Thomas; Jochen F Mueller Journal: Sci Total Environ Date: 2020-04-18 Impact factor: 7.963
Authors: Victor M Corman; Olfert Landt; Marco Kaiser; Richard Molenkamp; Adam Meijer; Daniel Kw Chu; Tobias Bleicker; Sebastian Brünink; Julia Schneider; Marie Luisa Schmidt; Daphne Gjc Mulders; Bart L Haagmans; Bas van der Veer; Sharon van den Brink; Lisa Wijsman; Gabriel Goderski; Jean-Louis Romette; Joanna Ellis; Maria Zambon; Malik Peiris; Herman Goossens; Chantal Reusken; Marion Pg Koopmans; Christian Drosten Journal: Euro Surveill Date: 2020-01
Authors: Steve J Kroiss; Maiwand Ahmadzai; Jamal Ahmed; Muhammad Masroor Alam; Guillaume Chabot-Couture; Michael Famulare; Abdirahman Mahamud; Kevin A McCarthy; Laina D Mercer; Salman Muhammad; Rana M Safdar; Salmaan Sharif; Shahzad Shaukat; Hemant Shukla; Hil Lyons Journal: PLoS One Date: 2018-12-28 Impact factor: 3.240
Authors: J S M Peiris; C M Chu; V C C Cheng; K S Chan; I F N Hung; L L M Poon; K I Law; B S F Tang; T Y W Hon; C S Chan; K H Chan; J S C Ng; B J Zheng; W L Ng; R W M Lai; Y Guan; K Y Yuen Journal: Lancet Date: 2003-05-24 Impact factor: 79.321
Authors: Peter K C Cheng; Derek A Wong; Louis K L Tong; Sin-Ming Ip; Angus C T Lo; Chi-Shan Lau; Eugene Y H Yeung; Wilina W L Lim Journal: Lancet Date: 2004-05-22 Impact factor: 79.321
Authors: Gisela Masachessi; Gonzalo Castro; Ariana Mariela Cachi; María de Los Ángeles Marinzalda; Matías Liendo; María Belén Pisano; Paola Sicilia; Gustavo Ibarra; Ricardo Manuel Rojas; Laura López; Gabriela Barbás; Diego Cardozo; Viviana Elisabeth Ré; Silvia Viviana Nates Journal: Water Res Date: 2022-05-04 Impact factor: 13.400
Authors: Liam J Reynolds; Gabriel Gonzalez; Laura Sala-Comorera; Niamh A Martin; Alannah Byrne; Sanne Fennema; Niamh Holohan; Sailusha Ratnam Kuntamukkula; Natasha Sarwar; Tristan M Nolan; Jayne H Stephens; Megan Whitty; Charlene Bennett; Quynh Luu; Ursula Morley; Zoe Yandle; Jonathan Dean; Eadaoin Joyce; John J O'Sullivan; John M Cuddihy; Angeline M McIntyre; Eve P Robinson; Darren Dahly; Nicola F Fletcher; Michael Carr; Cillian De Gascun; Wim G Meijer Journal: Sci Total Environ Date: 2022-05-16 Impact factor: 10.753
Authors: Sandy de Oliveira Gonçalves; Thiarlen Marinho da Luz; Abner Marcelino Silva; Sindoval Silva de Souza; Mateus Flores Montalvão; Abraão Tiago Batista Guimarães; Mohamed Ahmed Ibrahim Ahmed; Amanda Pereira da Costa Araújo; Sengodan Karthi; Guilherme Malafaia Journal: Sci Total Environ Date: 2022-02-19 Impact factor: 10.753
Authors: Zamathombeni Duma; Anil A Chuturgoon; Veron Ramsuran; Vinodh Edward; Pragalathan Naidoo; Miranda N Mpaka-Mbatha; Khethiwe N Bhengu; Nomzamo Nembe; Roxanne Pillay; Ravesh Singh; Zilungile L Mkhize-Kwitshana Journal: Global Health Date: 2022-01-22 Impact factor: 10.401
Authors: Athmakuri Tharak; Harishankar Kopperi; Manupati Hemalatha; Uday Kiran; Gokulan C G; Shivranjani Moharir; Rakesh K Mishra; S Venkata Mohan Journal: Int J Environ Res Public Health Date: 2022-02-25 Impact factor: 3.390