| Literature DB >> 34177847 |
Antonia Kreitlow1, André Becker1, Marwa F E Ahmed2,3, Sophie Kittler1, Ulrich Schotte4, Madeleine Plötz1, Amir Abdulmawjood1.
Abstract
A loop-mediated isothermal amplification (LAMP) assay system was established, allowing rplD gene-based simultaneous detection of Campylobacter jejuni and Campylobacter coli in enriched meat products. Additionally, one-step differentiation of target species on agar plates was enabled by cdtC gene- and gyrA gene-based duplex LAMP. Both the rplD and cdtC-gyrA LAMP assays amplified the target sequences in all 62 C. jejuni and 27 C. coli strains used for determining inclusivity and revealed 100% exclusivity toward 85 tested non-target species. Throughout the entire experiments, C. jejuni and C. coli strains were 100% distinguishable by melting curves of cdtC and gyrA LAMP products. After 24-h enrichment, the rplD LAMP assay reliably detected initial inoculation levels of 10-100 CFU/g in artificially contaminated minced meat. Investigation of naturally contaminated meat samples revealed a diagnostic accuracy of 95% toward real-time PCR and 94.1% toward the standard culture method applying the 24-h incubation period. Diagnostic sensitivity and specificity, and positive and negative predictive values were 89.8, 100, 100, and 91.2%, respectively, when measured against real-time PCR, and 89.6, 98.1, 97.7, and 91.2%, respectively, when measured against the standard culture method. After 48-h enrichment, the detection limit of the rplD LAMP assay improved to initial inoculation levels of 1-10 CFU/g in artificially contaminated minced meat. Applying the 48-h incubation period on naturally contaminated meat samples resulted in 100% concordant results between rplD LAMP, real-time PCR, and the standard culture method. The established LAMP assay system was proved to be suitable for rapid meat sample screening. Furthermore, it constitutes a promising tool for investigating other Campylobacter sources and could therefore make a valuable contribution to protect consumers from foodborne illness.Entities:
Keywords: Campylobacter; LAMP assay; cdtC gene; gyrA gene; meat products; rplD gene
Year: 2021 PMID: 34177847 PMCID: PMC8219907 DOI: 10.3389/fmicb.2021.668824
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
RplD-, cdtC-, and gyrA-based primer sequences used for LAMP assay establishment.
| Primer | Sequence (5′–3′) | Position |
| F3 | GTGATGTAAGTGGTGGTGG | 1662231–1662249 |
| B3 | AAGCATCTTTGACGCCAA | 1661956–1661973 |
| FIP (F1c + F2) | TTTGTTGGACCAAAAGCAACCG-CTAGAGCGGGTTCAACAAG | 1662132–1662153/1662195–1662177 |
| BIP (B1c + B2) | AAAGATTGGCGCTTGAAAGAGC-CAATAGCCAAAGAATCAGCAG | 1662072–1662093/1662016–1662036 |
| LF | CGCCTACCCAAACGTTAGTT | 1662157–1662176 |
| LB | GCAGATAAAGCAGCTAAAGGTG | 1662067–1662046 |
| F3 | GGGTAGCAGCTGTTAAAGG | 89252–89270 |
| B3 | CGCCTTTAGGGATACCTCA | 89667–89685 |
| FIP (F1c + F2) | AATGCCAACAACAACTTCAG-GGCTATTCCAAAGCGTTT | 89426–89445/89331–89348 |
| BIP (B1c + B2) | TGCTCCAAAGGTTCCATCTTCT-TAGCTGATGAACTTCCTT | 89499–89520/89576–89593 |
| LF | CTGTGCAAATTCGTTCTTTAG | 89405–89425 |
| LB | TGGCTAAACAAAGATCGCTTTC | 89525–89546 |
| F3 | CCTTAGTAAGAATGGCACAAGA | 830429–830450 |
| B3 | CTAGCATCCTTATGATCAAGCA | 830756–830777 |
| FIP (F1c + F2) | CAGTATAACGCATTGCAGCAGC-TCTATGCGTTATCCAAGTATCG | 830518–830536/830455–830476 |
| BIP (B1c + B2) | ACGATGATTCTATGAGTGAGCC-CTCGTTAAGACTATGCGGAG | 830612–830633/830714–830733 |
| LF | CCATCACCATCGATAGAACCAA | 830492–830511 |
| LB | TATTGCTGTAGGTATGGCGAC | 830685–830705 |
Analytical specificity of the rplD and cdtC–gyrA LAMP assays against target and non-target bacterial strains.
| Strain | No. of strains | LAMP | |
| 27 | + | + ( | |
| 62 | + | + ( | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 7 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 2 | − | − | |
| 3 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 2 | − | − | |
| 1 | − | − | |
| 2 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 2 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 2 | − | − | |
| 2 | − | − | |
| 4 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 8 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 5 | − | − | |
| 1 | − | − | |
| 2 | − | − | |
| 5 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 2 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
| 1 | − | − | |
FIGURE 1Detection times achieved using standard (Std) and concentrated (Conc) rplD (A) and cdtC and gyrA (B) primer mixes at different reaction temperatures. Error bars represent the standard deviation of three independent measurements.
FIGURE 2DNA-based analytical sensitivity of the rplD LAMP assay using standard and concentrated primer mixes at the optimal reaction temperature of 66°C. Error bars represent the standard deviation of three independent measurements.
FIGURE 3Amplification curves (A) and corresponding melting curves of LAMP products (B) obtained after testing 10-fold serially diluted DNA templates of C. jejuni NCTC 12660 and C. coli NCTC 12668 with merged cdtC–gyrA primers. For a better overview, only the first three dilution levels are shown. Pure cultures of C. jejuni und C. coli were distinguishable in one reaction by different melting temperatures of their LAMP products.
Total numbers of positive (+) and negative (−) results obtained by rplD LAMP, real-time PCR, and the standard culture method, testing artificially contaminated minced meat samples at four inoculation levels after 24- and 48-h enrichment.
| 0–1 CFU | 1–10 CFU | 10–100 CFU | 100–1000 CFU | |||||
| + | − | + | − | + | − | + | − | |
| 24-h enrichment | ||||||||
| 1 | 11 | 5 | 7 | 10 | 2 | 12 | 0 | |
| Real-time PCR | 1 | 11 | 7 | 5 | 9 | 3 | 11 | 1 |
| Standard culture method | 1 | 11 | 7 | 5 | 10 | 2 | 12 | 0 |
| 48-h enrichment | ||||||||
| 2 | 10 | 8 | 4 | 12 | 0 | 12 | 0 | |
| Real-time PCR | 2 | 10 | 8 | 4 | 12 | 0 | 12 | 0 |
| Standard culture method | 2 | 10 | 8 | 4 | 12 | 0 | 12 | 0 |
FIGURE 4Distribution of melting temperatures of LAMP products during investigation of artificially contaminated minced meat using cdtC–gyrA LAMP (A). Distribution of melting temperatures of LAMP products during investigation of naturally contaminated meat samples using cdtC–gyrA LAMP (B).
Diagnostic criteria of the rplD LAMP assay compared with real-time PCR and the standard culture method after examination of naturally contaminated meat products after 24- and 48-h incubation.
| Criteria | LAMP real-time PCR | LAMP (standard culture method) | ||
| 24 h | 48 h | 24 h | 48 h | |
| SE (%) | 89.8 | 100 | 89.6 | 100 |
| SP (%) | 100 | 100 | 98.1 | 100 |
| AC (%) | 95.0 | 100 | 94.1 | 100 |
| PPV (%) | 100 | 100 | 97.7 | 100 |
| NPV (%) | 91.2 | 100 | 91.2 | 100 |