| Literature DB >> 34177594 |
Qian Lu1,2, Chao Jiang1, Jialong Hou3, Hao Qian3, Feifan Chu3, Weiqi Zhang3, Mengke Ye3, Ziyi Chen3, Jian Liu3, Hanbing Yao3, Jianfeng Zhang1, Jiake Xu1,4, Te Wang1,3, Shunwu Fan1, Qingqing Wang1.
Abstract
The incidence of <Entities:
Keywords: PXR; nuclear factor κB; osteoclast; osteoporosis; patchouli alcohol; receptor activator for nuclear factor κB ligand
Year: 2021 PMID: 34177594 PMCID: PMC8227438 DOI: 10.3389/fphar.2021.684976
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primer sequences used for qRT-PCR.
| Gene | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Nfatc1 | GGAGAGTCCGAGAATCGAGAT | TTGCAGCTAGGAAGTACGTCT |
| C-fos | GCGAGCAACTGAGAAGAC | TTGAAACCCGAGAACATC |
| Acp5 | TGTGGCCATCTTTATGCT | GTCATTTCTTTGGGGCTT |
| Ctsk | CCAGTGGGAGCTATGGAAGA | AAGTGGTTCATGGCCAGTTC |
| PXR | TCAAGGATTTCCGGCTGCG | GTAGGTTGACACATCGGCCA |
| TLR4 | AATCCCTGCATAGAGGTAGTTCC | ATCCAGCCACTGAAGTTCTGA |
| Hprt | GTTGGGCTTACCTCACTGCT | TAATCACGACGCTGGGACTG |
FIGURE 1Osteoclastogenesis was impaired by PA. (A) Representative images of TRAcP-positive cells after stimulation with PA at different on the indicated days (magnification = ×100). (B) TRAcP-positive cells in 96-well plates stimulated with PA at different concentrations on the indicated days were counted and analyzed (C, E) Representative images of TRAcP-positive cells after stimulation with 10 μM PA on the indicated days (magnification = ×100). (D) TRAcP-positive cells in 96-well plates stimulated with 10 μM PA on the indicated days were counted and analyzed. (F) A CCK-8 assay was performed to detect the cytotoxicity of PA against BMMs.
FIGURE 2Bone resorption was impaired by PA. (A) Representative confocal images of F-actin and nuclei in OCs treated with or without 5 μM or 10 μM PA and subjected to immunofluorescence staining (scale bar = 200 μm). (B, C) Quantification of the average OC area and mean nuclear number in OCs. (D) Representative images of the bone resorption area in bone slices after OCs were treated with RANKL in the presence or absence of 5 μM or 10 μM PA (scale bar = 200 μm). (E) Quantification of the bone resorption area in bone slices.
FIGURE 3PA inhibited RANKL-induced OC marker genes. (A–D) Real-time PCR was used to detect the mRNA expression levels of tartrate-resistant acid phosphatase (TRAcP/acp5), cathepsin K (Ctsk), c-Fos, and nuclear factor of activated T cells, cytoplasmic 1 (NFATc1) in the presence or absence of 5 μM or 10 μM PA. All of the data were normalized to data for the housekeeping gene Hprt. (E) Western blotting was performed to measure the protein content of V-ATPase-d2, CTSK, integrin β3, NFATc1, and c-Fos at day 0, day 1, day 3, and day 5 after stimulation with GST-rRANKL (50 ng/ml) with or without PA (10 μM). (F–J) Quantitative analysis of protein expression in the PA-stimulated and control groups at different times. The expression of all proteins was normalized to β-actin expression. The data represent the mean ± SD. Significant differences are indicated as follows: *p < 0.05, **p < 0.01, and ***p < 0.001.
FIGURE 4PA suppressed RANKL-induced NF-κB signaling. (A) NF-κB luciferase activity in BMMs treated with PA at different concentrations. (B) Western blotting was performed to measure the protein content of p-P65 and IκB-α after 0, 10, 20, 30, and 60 min of stimulation with GST-rRANKL (50 ng/ml) with or without PA (10 μM). (C,D) Quantitative analysis of protein expression in the PA-stimulated and control groups at different times. The expression of all proteins was normalized to β-actin expression. (E) Representative confocal images of p65 in OCs treated with or without 10 μM PA subjected to immunofluorescence staining (scale bar = 200 μm). The nuclear translocation of p65 is indicated in this figure. (F) Quantitative analysis of the mean p65 fluorescence intensity in the nucleus after sample processing as described in (E).
FIGURE 5PA activated PXR. (A) Nonbonding interactions between PA and PXR (Compound CID of PA: 10955174). (B) 3D structure of PXR and its binding site for PA. (C) Hydrogen bonds between PA and neighboring amino acid residues in PXR. (D) Real-time PCR was used to detect the mRNA expression levels of PXR after RANKL-induced OC differentiation for different durations. All data were normalized to data for the housekeeping gene Hprt. (E) Western blotting was performed to measure the protein content of PXR after 0, 10, 20, 30, and 60 min of stimulation with GST-rRANKL (50 ng/ml) with or without PA (10 μM). (F) Quantitative analysis of PXR protein expression in the PA-stimulated and control groups at different times. The expression of all proteins was normalized to β-actin expression.
FIGURE 6PA activated its target, PXR, to suppress downstream NF-κB signaling. (A) Representative images of TRAcP-positive cells after transfection with siRNAs in the presence of PA (10 μM) (magnification = ×100). (B) TRAcP-positive cells transfected with siRNAs in the presence of PA (10 μM) in 96-well plates were counted and analyzed. (C) Representative images of the bone resorption area on hydroxyapatite-coated plates upon transfection with siRNAs in the presence of PA (10 μM) (magnification = ×100). (D) Quantification of the bone resorption area on hydroxyapatite-coated plates. (E) Western blotting was performed to measure the p65 protein content in the nucleus after transfection with siRNAs in the presence of PA (10 μM) for 1 h. (F) Quantitative analysis of p65 protein expression in the nucleus after transfection with siRNAs in the presence of PA (10 μM) for 1 h. The expression of all proteins was normalized to histone H3 expression. (G) Representative confocal images showing p65 after transfection with siRNAs in the presence of RANKL and PA (10 μM) under immunofluorescence staining (scale bar = 200 μm).
FIGURE 7PA downregulated the TLR4/Myd88/TRAF6 axis. (A) The fold change in TLR4 mRNA expression after treatment with or without PA for 0, 1, 2, three or 6 h determined using real-time PCR. (B) Western blotting was performed to measure the TLR4, MyD88, and TRAF6 protein content after transfection with siRNAs in the presence of PA (10 μM) for 1 h. (C–E) Quantitative analysis of TLR4, MyD88, and TRAF6 protein expression after transfection with siRNAs in the presence of PA (10 μM) for 1 h. The expression of all proteins was normalized to β-actin expression.
FIGURE 8PA inhibited OCs in the OVX mouse model. (A) 3D computer reconstruction of the femur and tibias in each group captured by a micro-CT instrument. (B–E) The relevant bone microstructure-related parameters were quantitatively measured: BV/TV, Tb. Sp., Tb. N, and Tb. Th. (F) Representative images of tibias stained with H and E and TRAcP. Scale bar = 500 mm; scale bar = 100 mm in the enlarged pictures. (G, H) Quantitative analyses of the OC number per bone surface (N.Oc/BS).
FIGURE 9Schematic diagram showing the mechanism by which PA inhibits osteoclastogenesis.