BACKGROUND: Brassica napus is an essential crop for oil and livestock feed. Eventually, this crop's economic interest is at the most risk due to anthropogenic climate change. DELLA proteins constitute a significant repressor of plant growth to facilitate survival under constant stress conditions. DELLA proteins lack DNA binding domain but can interact with various transcription factors or transcription regulators of different hormonal families. Significant progress has been made on Arabidopsis and cereal plants. However, no comprehensive study regarding DELLA proteins has been delineated in rapeseed. RESULTS: In our study, we have identified 10 BnaDELLA genes. All of the BnaDELLA genes are closely related to five AtDELLA genes, suggesting a relative function and structure. Gene duplication and synteny relationship among Brassica. napus, Arabidopsis. thaliana, Brassica rapa, Brassica oleracea, and Brassica nigra genomes were also predicted to provide valuable insights into the BnaDELLA gene family evolutionary characteristics. Chromosomal mapping revealed the uneven distribution of BnaDELLA genes on eight chromosomes, and site-specific selection assessment proposes BnaDELLA genes purifying selection. The motifs composition in all BnaDELLA genes is inconsistent; however, every BnaDELLA gene contains 12 highly conserved motifs, encoding DELLA and GRAS domains. The two known miRNAs (bna-miR6029 and bna-miR603) targets BnaC07RGA and BnaA09GAI, were also predicted. Furthermore, quantitative real-time PCR (qRT-PCR) analysis has exhibited the BnaDELLA genes diverse expression patterns in the root, mature-silique, leaf, flower, flower-bud, stem, shoot-apex, and seed. Additionally, cis-acting element prediction shows that all BnaDELLA genes contain light, stress, and hormone-responsive elements on their promoters. The gene ontology (GO) enrichment report indicated that the BnaDELLA gene family might regulate stress responses. Combine with transcriptomic data used in this study, we detected the distinct expression patterns of BnaDELLA genes under biotic and abiotic stresses. CONCLUSION: In this study, we investigate evolution feature, genomic structure, miRNAs targets, and expression pattern of the BnaDELLA gene family in B. napus, which enrich our understanding of BnaDELLA genes in B. napus and suggests modulating individual BnaDELLA expression is a promising way to intensify rapeseed stress tolerance and harvest index.
BACKGROUND:Brassica napus is an essential crop for oil and livestock feed. Eventually, this crop's economic interest is at the most risk due to anthropogenic climate change. DELLA proteins constitute a significant repressor of plant growth to facilitate survival under constant stress conditions. DELLA proteins lack DNA binding domain but can interact with various transcription factors or transcription regulators of different hormonal families. Significant progress has been made on Arabidopsis and cereal plants. However, no comprehensive study regarding DELLA proteins has been delineated in rapeseed. RESULTS: In our study, we have identified 10 BnaDELLA genes. All of the BnaDELLA genes are closely related to five AtDELLA genes, suggesting a relative function and structure. Gene duplication and synteny relationship among Brassica. napus, Arabidopsis. thaliana, Brassica rapa, Brassica oleracea, and Brassica nigra genomes were also predicted to provide valuable insights into the BnaDELLA gene family evolutionary characteristics. Chromosomal mapping revealed the uneven distribution of BnaDELLA genes on eight chromosomes, and site-specific selection assessment proposes BnaDELLA genes purifying selection. The motifs composition in all BnaDELLA genes is inconsistent; however, every BnaDELLA gene contains 12 highly conserved motifs, encoding DELLA and GRAS domains. The two known miRNAs (bna-miR6029 and bna-miR603) targets BnaC07RGA and BnaA09GAI, were also predicted. Furthermore, quantitative real-time PCR (qRT-PCR) analysis has exhibited the BnaDELLA genes diverse expression patterns in the root, mature-silique, leaf, flower, flower-bud, stem, shoot-apex, and seed. Additionally, cis-acting element prediction shows that all BnaDELLA genes contain light, stress, and hormone-responsive elements on their promoters. The gene ontology (GO) enrichment report indicated that the BnaDELLA gene family might regulate stress responses. Combine with transcriptomic data used in this study, we detected the distinct expression patterns of BnaDELLA genes under biotic and abiotic stresses. CONCLUSION: In this study, we investigate evolution feature, genomic structure, miRNAs targets, and expression pattern of the BnaDELLA gene family in B. napus, which enrich our understanding of BnaDELLA genes in B. napus and suggests modulating individual BnaDELLA expression is a promising way to intensify rapeseed stress tolerance and harvest index.
Since the 1970s, Brassica napus has become the world's most economically valuable crop [1]. In recent years significant progress has been made in advancing B. napus selective breeding to remove undesirable components for high-quality vegetable oil and palatable livestock feed. Unfortunately, B. napus yield is susceptible to various abiotic and biotic stresses, such as higher salinity, drought, high/low temperature, and pathogen infections. These stresses have led to severe loss in harvest index and oil production in many regions of the world and limited its geographical distribution [2, 3]. Consequently, the effects of environmental stresses on B. napus cultivation eventually losing their economic importance.Plants as sessile organisms evolved varied strategies to modulate their physiology to cope with fluctuating environmental conditions [4]. Tremendous work has been done to understand the role of plants biochemical, molecular, and cellular responses to abiotic and biotic stresses [5, 6]. These studies suggested that phytohormones are the critical components that convey the internal and external stimuli to facilitate plant adaptive response to environmental challenges. Among these hormones, Gibberellins (GAs) are considered one of the most vital phytohormones that dramatically affect plant physiology by crosstalking with multiple hormones [7, 8]. However, under external pressure, plants mediate GAs and other phytohormones homeostasis through a family of coregulators DELLA proteins to balance the growth in reserving resources for plant survival [9, 10]. A significant function of the DELLA proteins is to regulate the wide variety of transcriptional factors (TFs) and transcriptional regulators (TRs) of multiple phytohormones. For instance, DELLA proteins interact with transcriptional factors, including PHYTOCHROME INTERACTING FACTORs (PIFs), BRASSINOSTEROID INSENSITIVE 1 (BZR1), and EXPANSIN-A2 (EXP2), in a light-dependent and temperature-dependent manner to suppress cell elongation and cell proliferation [11-13], or interacting with DEHYDRATION-RESPONSIVE ELEMENT-BINDING PROTEIN 1B (DREB1B), JASMONATE ZIM-domain 1 (JAZ1), and TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCPs) to prime defense focusing on plant survival rather than its growth [14-16]. DELLA proteins are the sub-family of the transcriptional regulators GRAS (named after GIBBERLIC ACID INSENSITIVE 1, REPRESSOR OF GAI-3, and SCARECROW) [17]. Most GRAS subfamilies contain common N-terminal motifs, while DELLA proteins had a few α-helical segments called DELLA, LEXLE, and THYNP that have been termed the DELLA domain [18, 19]. Previously, it was proposed that mutation in 17 amino acids of the DELLA N-terminal region resulted in severe dwarf transgenic plant gai-1 with dark green leaves but insensitive to salt and drought stress [20, 21]. Later it was demonstrated that the N-terminal region of the DELLA domain is responsible for DELLAs stability, which is operated by a GAs receptor Gibberellin insensitive Dwarf 1 (GID1) in GAs dependent and independent manner to foster plant growth by lifting DELLAs repression [22-24].Rice, barley, tomato contain only one DELLA gene, SLR1 (SLENDER RICE1), SLN1 (SLENDER1), and PROCERA, respectively [9, 25, 26], while pea and maize hold two highly conserved DELLA genes. LA, CRY, and d8, d9, respectively [27, 28]. Additionally, researches on Arabidopsis thaliana reported the presence of five AtDELLA genes GA-Insensitive (GAI), Repressor of ga1-3 (RGA), RGA-Like1 (RGL1), (RGL2), (RGL3). Molecular cloning of the single and multiple AtDELLA genes in GA deficient mutant ga-1 suggested the overlapping and unique roles of AtDELLAs in regulating GAs stimulated plant growth. For instance, AtGAI and AtRGA have been indicated as notable repressors of the plant vegetative growth [9, 29, 30], whereas AtRGL1 and AtRGL2 repressed floral augmentation and seed germination [31-34]. AtRGL3 recently got attention in plant defense by positively regulating the jasmonic acid (JA), and salicylic acid (SA) mediated response against pathogen infections [10, 35].Work over the last decade, the impact of DELLAs on seeded plant productivity has been progressively investigated. Apart from the exogenous splattering of the GAs to improve plant growth by repressing the repressor, one key factor was to alter GAs synthesis by fine-tuning the DELLAs activity for the amelioration of semi-dwarf varieties [26, 36, 37]. This results in enhanced plant tolerance to abiotic stresses, which ultimately improves crops harvest index and survival [38-40]. In addition to this, a recent study identifies a DELLA loss of function semi-dwarf mutant ds-3 in oilseed rape, which confers a similar phenotype to previously reported semi-dwarf varieties, with resistance to lodging stress [41]. However, the DELLA gene family molecular mechanism and characterization in B. napus have not been well reported. Moreover, diversification of DELLA gene family during B. napus polyploidization would be of interest.In this study, 10 members of the BnaDELLA genes were systematically characterized and analyzed by their phylogenetic and syntenic relationship, subcellular localization, protein motifs, gene structure, and cis-elements in the B. napus genome. Furthermore, expression profiles of the BnaDELLAs in eight different tissues, root, mature-silique, leaf, flower, flower-bud, stem, shoot-apex, seed, were analyzed using the qRT-PCR. Pre-published RNA-Seq data were also predicted to investigate BnaDELLAs expression patterns under different stress conditions such as cold, heat, drought, abscisic acid (ABA), salinity, and Sclerotinia sclerotiorum infection. Gene Ontology (GO) and miRNAs targeting the BnaDELLA gene family were also examined to characterize BnaDELLAs role. These results will provide valuable insights to illustrate the multiple functions of the DELLA proteins in B. napus and a basis for further genetic manipulation toward developing B. napus variants with increased stress tolerance to environmental fluctuation.
Results
Identification and characterization of BnaDELLAs
We have identified 10 BnaDELLAs in B. napus using the known five A. thaliana DELLAs (GAI, RGA, RGL1, RGL2, RGL3) peptide sequence as queries, and performed BLASTP searches in the B. napus genome database (GENOSCOPE http://www.genos cope.cns.fr/brass icanapus/) [42]. To confirm the BnaDELLA proteins integrity in the B. napus, we further analyze the retrieved sequences in different B. napus cultivar Zhongshuang 11 (ZS11) genome browser (BnPIR, http://cbi.hzau.edu.cn/bnapus), and manually corrected the redundant sequence information of the BnaDELLAs and named them according to their loci. Based on these methods, we found that each member in the AtDELLA gene family corresponds to multiple homologs in the B. napus genome (Table 1). Simultaneously, five DELLA genes in B. rapa, four in B. oleracea, nine in B. juncea, and five in B. nigra were classified using the same methods. We found that 10 BnaDELLAs members are derived from their progenitor B. rapa and B. oleracea. The genomic sequence length of the BnaDELLAs ranged from 1524-1740 bp, with a molecular weight varying from 55.83 to 63.32 KD (Table 1). Moreover, the isoelectric point (pI) values of the BnaDELLA proteins ranged from 4.69 to 5.94, which shows that these proteins are highly acidic. Besides, all BnaDELLA proteins showed a negative value of the grand average of hydrophobicity (GRAVY), indicating that BnaDELLAs are hydrophilic proteins. Moreover, the 10 BnaDELLA proteins subcellular localization signals were detected in the nucleus, which exhibits their transcriptional regulator role. The names of the BnaDELLAs and their locus id are also shown in (Table 1).
Table 1
Characterization of BnaDELLA family proteins
Group
Gene Name
Gene LOCUS ID
Chromosome Number
Location
Protein
Arabidopsis Orthologs
Subcellular Location
Start
End
Orientation
ORF
AA
PI
Mw (Da)
GRAVY
AI
I
BnaA09GAI
BnaA09G0218400ZS
scaffoldA09
15,333,875
15,336,195
Reverse
1740
579
5.23
63,323.35
-0.247
81.07
AT1G14920 (AtGAI)
Nucleus
BnaC09GAI
BnaC09G0254100ZS
scaffoldC09
23,759,020
23,761,368
Reverse
1710
569
5.32
62,327.38
-0.232
82.65
Nucleus
BnaA06RGA
BnaA06G0409200ZS
scaffoldA06
46,345,733
46,347,952
Forward
1722
573
5.58
62,511.61
-0.203
82.25
AT2G01570 (AtRGA)
Nucleus
BnaC07RGA
BnaC07G0269400ZS
scaffoldC07
41,375,597
41,377,853
Reverse
1734
577
5.41
62,782.98
-0.177
83.19
Nucleus
II
BnaC02RGL1
BnaC02G0205300ZS
scaffoldC02
17,476,351
17,477,874
Forward
1524
507
5.37
55,827.07
-0.159
92.92
AT1G66350 (AtRGL1)
Nucleus
BnaA02RGL1
BnaA02G0160500ZS
scaffoldA02
9,357,771
9,367,517
Forward
1527
508
5.94
56,584.09
-0.215
89.84
Nucleus
III
BnaA05RGL2
BnaA05G0486300ZS
scaffoldA05
44,153,415
44,155,599
Forward
1635
544
4.71
59,184.6
-0.189
85.86
AT3G03450 (AtRGL2)
Nucleus
BnaA05RGL2-2
BnaA05G0485400ZS
scaffoldA05
44,093,973
44,096,162
Forward
1641
546
4.69
59,456.9
-0.188
86.08
Nucleus
BnaC09RGL3
BnaC09G0489900ZS
scaffoldC09
60,072,165
60,073,742
Forward
1578
525
4.8
57,604.95
-0.211
88.8
AT5G17490 (AtRGL3)
Nucleus
BnaA10RGL3
BnaA10G0194400ZS
scaffoldA10
21,533,732
21,535,309
Forward
1578
525
4.78
57,634.01
-0.203
89.16
Nucleus
ORF (Open reading frame); AI (Aliphatic index); pI (Isoelectric point); GRAVY (Grand average of hydropathicity)
Characterization of BnaDELLA family proteinsORF (Open reading frame); AI (Aliphatic index); pI (Isoelectric point); GRAVY (Grand average of hydropathicity)
Evolutionary relationship and gene structure analysis of BnaDELLAs
The DELLAs evolutionary history among six Brassicaceae species A. thaliana (At), B. napus (Bna), B. rapa (Bra), B. oleracea (Bol), B. juncea (Bju), and B. nigra (Bni) was deduced using the neighbor-joining method. Based on the phylogenetic analysis, 38 DELLA genes in which five AtDELLAs, 10 BnaDELLAs, five BraDELLAs, four BolDELLAs, nine BjuDELLAs, and five BniDELLAs were cluster into three groups according to the topologies and bootstrap support (Fig. 1). Group I contain GAI and RGA clade, Group II holds RGL1 clade, Group III holds RGL2 and RGL3 clade. B. napus DELLA genes were relatively closer to the A. thaliana. However, B. napus and B. rapa DELLAs show 100% similarity between each other. Besides, a homolog of AtRGL1 was not identified in the B. oleracea compared to those of B. napus, B. rapa, B. juncea, and B. nigra. This might be due to gene loss during the evolution process or the emerging genome gaps in B. oleracea. However, in B. napus, Group I, II, III had four, two, four DELLA members, respectively. DELLA genes grouped into the same subfamily are previously known to have distinct or overlapping functions [21, 31, 35, 43]. To recognize the DELLA genes family diversification in B. napus, we have implemented the Gene Structure Display (GSDS) web analysis by comparing the coding sequence (CDS) and corresponding genomic sequences of AtDELLAs, BnaDELLAs, BraDELLAs, BolDELLAs, and BjuDELLAs. As shown in Fig. 2, members of the DELLA genes among denoted species are highly conserved and intron-less with only one exon. Moreover, the exon location of DELLAs among different phylogenetic-related species is conserved, suggesting a similar evolutionary relationship. However, the length of exon among the DELLA subfamily was different. For example, BnaRGL1 exon length was smaller than other BnaDELLAs members in Group I and Group III, indicating gene structure diversification. In summary, the gene structure of the DELLA genes from different Brassicaceae species is highly conserved, with some difference in the exon length (Fig. 2).
Fig. 1
The cladogram of DELLA proteins from A. thaliana (At:5), B. napus (Bna: 10), B. rapa (Bra: 5), B. oleracea (Bol: 4), B. juncea (Bju: 9), and B. nigra (Bni: 4) were conducted in MEGA X [86] using the neighbor-joining method, missing data with gaps were eliminated by complete deletion option. The DELLA proteins are cluster into three groups, which are indicated by the different colors. The bootstrap test (1000 replicates) is shown next to the branches
Fig. 2
Exon and intron location of the BnaDELLAs. Blue double-sided wedge represents exon, and upstream/downstream regions are indicated as cyan-colored boxes. The scale can estimate the length of the exon at base
The cladogram of DELLA proteins from A. thaliana (At:5), B. napus (Bna: 10), B. rapa (Bra: 5), B. oleracea (Bol: 4), B. juncea (Bju: 9), and B. nigra (Bni: 4) were conducted in MEGA X [86] using the neighbor-joining method, missing data with gaps were eliminated by complete deletion option. The DELLA proteins are cluster into three groups, which are indicated by the different colors. The bootstrap test (1000 replicates) is shown next to the branchesExon and intron location of the BnaDELLAs. Blue double-sided wedge represents exon, and upstream/downstream regions are indicated as cyan-colored boxes. The scale can estimate the length of the exon at base
Multiple sequence alignment and analysis of BnaDELLAs motifs
The putative sequences of the DELLA proteins from B. napus, A. thaliana, B. rapa, B. oleracea, B. juncea, and B. nigra were aligned to explore amino acid conservation in B. napus. Based on the alignment, we found five homologs DELLA proteins from A. thaliana show higher percent amino acid similarity with B. napus (Table S1). Similar to A. thaliana, the B. napus and other denoted species contain highly conserved DELLA and GRAS domains at the N-terminal and C-terminal region, respectively. It was known that the N-terminal DELLA domain is involved in stabilizing the DELLA gene activity [18, 44], while the GRAS domain acts as a coregulator to interact with several transcriptional factors and regulators (Figure S1) [37, 45, 46]. The presence of the (VHIID-PFYRE-SAW) and two leucine heptad repeats LHRI and LHRII on the C-terminal of the GRAS domain are responsible for the protein interaction [47, 48]. However, some studies have also proposed DELLA domain lower-affinity with intrinsically unstructured proteins [45, 49]. Overall, the domain arrangements in the B. napus DELLA gene family are comparable to A. thaliana, B. rapa, B. oleracea, B. juncea, and B. nigra. The secondary structure feature (alpha-helix and Beta sheets) from the AtRGL1 accessions number (At1G66350.1) was displayed in Figure S1. However, the predicted secondary structures of all DELLA genes from the denoted plant species were relatively different.To gain more insights into the diversity of BnaDELLAs in B. napus, we generated a graph showing domains and their position on AtDELLAs and BnaDELLA protein members. We found that the DELLA and GRAS domains are conserved in all DELLA proteins of A thaliana and B. napus, but motifs were unevenly distributed (Fig. 3). Every BnaDELLA member contains four to 16 conserved motifs, and their length ranged from six to 50 amino acids. Motif 1 to 13 were identified in all groups except AtRGL3, BnaA10RGL3, and BnaC09RGL3 lacking motif 12. In which motif 7 and 8 are annotated as DELLA domain (Fig. 3). Moreover, Motif 14 and 15 were not detected in AtRGL2, BnaA05RGL2, BnaA05RGL2-2, and Group II, respectively. Motif 16 was detected in AtRGL3, BnaA10RGL3, BnaC09RGL3, BnaA09GAI, and BnaC09GAI. Furthermore, Motif 17 was only present in the N-terminal region of the AtRGA, BnaC07RGA, BnaA06RGA, BnaA05RGL2, and BnaA05RGL2-2 genes. Motif 18 was detected in AtRGA, BnaA09GAI, BnaC09GAI, BnaC07RGA, and BnaA06RGA. In contrast, Group I, AtRGL2, BnaA05RGL2, and BnaA05RGL2-2 had an extra motif 19 and 20, respectively. These results exhibit that the BnaDELLAs subfamilies differ in motif arrangements, indicating the BnaDELLA gene family functional divergence during duplication events. However, proteins with similar motifs arrangements specified the functional similarities among BnaDELLA members. A schematic logo diagram of BnaDELLAs motifs was shown in Figure S2.
Fig. 3
The length of the 20 motifs ranged from 6 to 50 amino acid residues and represented by different colors and numbers, p- values of the motifs on each protein is less than 1e−5
The length of the 20 motifs ranged from 6 to 50 amino acid residues and represented by different colors and numbers, p- values of the motifs on each protein is less than 1e−5
Chromosome location and collinearity analysis
Chromosomal mapping analysis showed that 10 BnaDELLAs distributed on eight B. napus scaffolds (Fig. 4), which have not been assembled into a chromosome. Furthermore, no distribution of BnaDELLAs were observed in the scaffoldA01, scaffoldA03, scaffoldA04, scaffoldA07, scaffoldA08, scaffoldC01, scaffoldC03, scaffoldC04, scaffoldC05, scaffoldC06, and scaffoldC08. However, six BnaDELLAs, including, BnaA02RGL1, BnaA05RGL2, BnaA05RGL2-2, BnaA06RGA, BnaA09GAI, and BnaA10RGL3, are located on the AA subgenome. In contrast, four BnaDELLAs, including BnaCO2RGL1, BnaCO9GAI, BnaC07RGA, and BnaC07RGL3, located on the CC subgenome, suggesting the uneven distribution of BnaDELLAs in the B. napus genome (Fig. 4). Furthermore, by using the BLAST and MCScanX methods, we detected the six segmental duplication pairs such as BnaA09GAI/BnaC09GAI, BnaA06RGA/BnaC07RGA, BnaA06RGA/BnaA09GAI/BnaC09GAI,
Fig. 4
Schematic representation of DELLA genes distribution on B. napus chromosomes. Chromosome number is indicated on the side of each chromosome
Schematic representation of DELLA genes distribution on B. napus chromosomes. Chromosome number is indicated on the side of each chromosomeBnaC07RGA/BnaC09GAI/BnaA09GAI, BnaA02RGL1/BnaC02RGL1, BnaA10RGL3/BnaC09RGL3, and one tandem duplication BnaA05RGL2/BnaA05RGL2-2 was determined (Fig. 5), which exhibits that during evolution segmental duplication events were the main reason for the divergence of the DELLA gene family in B. napus. In addition, comparative synteny of DELLA gene pairs between B. napus, A. thaliana, B. rapa, B. oleracea, and B. nigra was conducted (Fig. 6). The result shows that BnaDELLAs displayed the most collinearity relationship with B. rapa, B. oleracea, followed by A. thaliana, and B. nigra. A total of five, five, and 10 BnaDELLAs showed syntenic relationships with B. rapa, B. oleracea, and B. nigra, respectively (Table S2). However, five AtDELLAs show a collinearity relationship with 10 BnaDELLAs, which are more than one orthologous copy in the B. napus genome. For instance, AtGAI and AtRGA show syntenic relationships with BnaA09GAI, BnaC09GAI, BnaA06RGA, and BnaC07RGA, implying that AtDELLAs genes might contribute to the evolution of the DELLA gene family in Brassicaceae species. Moreover, we also evaluated the pressure of selective constraint on each pair of duplicated BnaDELLAs and calculated the nonsynonymous (Ka) and synonymous (Ks) ratio (Table S3, Figure S3). Our findings showed that all of the BnaDELLA pairs had the Ka/Ks ratio lower than 1, indicating that the BnaDELLA gene family experienced strong purifying selective pressure.
Fig. 5
Synteny analysis of the BnaDELLA family in B. napus. Cyan-colored line genes belong to Group I, and green-colored line genes belong to group II, yellow-colored line genes belong to Group III. These colored genes lines indicate duplicated BnaDELLA gene pairs, while gray lines in the background represent synteny blocks in the B. napus genome. The distribution density of BnaDELLAs present at the bottom of each chromosome
Fig. 6
Synteny analysis of BnaDELLAs between A. thaliana, B. rapa, B. oleracea, and B. nigra. Black lines indicate the syntenic DELLA gene pairs between denoted species. While in the background, gray line represents collinear blocks
Synteny analysis of the BnaDELLA family in B. napus. Cyan-colored line genes belong to Group I, and green-colored line genes belong to group II, yellow-colored line genes belong to Group III. These colored genes lines indicate duplicated BnaDELLA gene pairs, while gray lines in the background represent synteny blocks in the B. napus genome. The distribution density of BnaDELLAs present at the bottom of each chromosomeSynteny analysis of BnaDELLAs between A. thaliana, B. rapa, B. oleracea, and B. nigra. Black lines indicate the syntenic DELLA gene pairs between denoted species. While in the background, gray line represents collinear blocks
Prediction of the bna-microRNAs putative targets sites
The regulatory purpose of DELLAs and their interacting targets have been characterized widely in various plant species; however, a possible underlying post-transcriptional modification of DELLAs in response to environmental stresses is still unclear [50-52]. It has been reported that miRNAs play a significant role in transcriptional and post-transcriptional levels to modulate gene expression under stresses [28, 53]. To identify miRNAs interaction with BnaDELLAs isoforms, we obtained the bna-miRNAs data from B. napus comprehensive study to predict the targeted BnaDELLAs sites. We found that 10 BnaDELLAs from B. napus targets for 18 conserved B. napus miRNAs. These miRNAs lengths reached from 1–24 base pairs, with 11 nt being the most frequent in all BnaDELLAs (Table 2). Target prediction analysis shows that BnaDELLAs BnaC07RGA and BnaA09GAI are targeted by two well-known miRNAs, bna-miR6029 and bna-miR6031, respectively. Among the other bna-miRNAs identified in our study, bna-miR2111a, bna-miR166a are found to be involved in targeting the BnaRGL1. In contrast, bna-miR172b targets BnaA02RGL1 and BnaA05RGL2. Additionally, bna-miR390a and bna-miR168a are found to target BnaRGL3. Based on this analysis, we perceived that bna-miRNAs potentially target B. napus, both A and C genome, to regulate BnaDELLAs expression under constant stresses to stabilize plant growth and defense tradeoff.
Table 2
bna-miRNA targets BnaDELLA genes
miRNA_Acc
Gene symbol
Target_Acc
Target start
Target end
miRNA aligned fragment
Alignment length
e-value
bna-miR6029
BnaC07RGA
BnaC07G0269400ZS
590
610
UGGGGUUGUGAUUUCAGGCUU
21
5
bna-miR6031
BnaA09GAI
BnaA09G0218400ZS
1667
1690
AAGAGGUUCGGAGCGGUUUGAAGC
24
5
bna-miR6036
BnaA09GAI
BnaA09G0218400ZS
1581
1591
AUAGUACUAGUACUUGCAUGAUCA
11
5.5
BnaC09GAI
BnaC09G0254100ZS
1551
1561
11
5.4
BnaA06RGA
BnaA06G0409200ZS
1563
1573
11
5.4
BnaC07RGA
BnaC07G0269400ZS
566
578
13
0.35
bna-miR6028
BnaC09GAI
BnaC09G0254100ZS
1635
1645
UGGAGAGUAAGGACAUUCAGA
11
5.4
BnaA06RGA
BnaA06G0409200ZS
1647
1657
11
5.4
BnaC07RGA
BnaC07G0269400ZS
1659
1669
11
5.4
bna-miR390a
BnaA06RGA
BnaA06G0409200ZS
275
285
AAGCUCAGGAGGGAUAGCGCC
11
5.4
bna-miR171f
BnaA06RGA
BnaA06G0409200ZS
888
898
UGAUUGAGCCGCGCCAAUAUC
11
5.4
bna-miR156b
BnaC07RGA
BnaC07G0269400ZS
108
123
UUGACAGAAGAUAGAGAGCAC
16
1.4
bna-miR168b
BnaC07RGA
BnaC07G0269400ZS
1079
1089
UCGCUUGGUGCAGGUCGAGAA
11
5.4
bna-miR160a
BnaC07RGA
BnaC07G0269400ZS
1530
1540
UGCCUGGCUCCCUGUAUGCCA
11
5.4
bna-miR2111a
BnaC02RGL1
BnaC02G0205300ZS
1375
1391
GUCCUCGGGAUGCGGAUUACC
17
0.31
bna-miR172b
BnaC02RGL1
BnaC02G0205300ZS
1038
1048
GGAAUCUUGAUGAUGCUGCAU
11
4.8
bna-miR166e
BnaC02RGL1
BnaC02G0205300ZS
612
623
UCGGACCAGGCUUCAUUCCCC
12
1.2
bna-miR166a
BnaA02RGL1
BnaA02G0160500ZS
1187
1198
UCGGACCAGGCUUCAUUCCCC
12
1.2
bna-miR6030
BnaC02RGL1
BnaC02G0205300ZS
736
746
UCCACCCAUACCAUACAGACCC
11
4.8
bna-miR2111c
BnaC02RGL1
BnaC02G0205300ZS
1288
1298
UAAUCUGCAUCCUGGGGUUUA
11
4.8
bna-miR172b
BnaA02RGL1
BnaA02G0160500ZS
1041
1051
GGAAUCUUGAUGAUGCUGCAU
11
4.8
BnaA05RGL2
BnaA05G0486300ZS
745
755
11
5.1
bna-miR390a
BnaA10RGL3
BnaA10G0194400ZS
1442
1452
AAGCUCAGGAGGGAUAGCGCC
11
4.9
bna-miR168a
BnaC09RGL3
BnaC09G0489900ZS
404
414
AAGCUCAGGAGGGAUAGCGCC
11
4.9
bna-miRNA targets BnaDELLA genes
cis-element analysis in promoter regions of BnaDELLAs and their distribution
Physiological and molecular studies on DELLAs suggested their role in multiple hormonal signaling pathways by interacting with a wide variety of transcriptional regulators and transcriptional factors. However, the molecular mechanism of interaction and regulation of DELLA genes are quite unclear. To gain more insights into the potential function and regulatory mechanism of the BnaDELLAs, we analyzed the cis-regulatory elements in the 1500 bp upstream promoter region of the BnaDELLAs by using the plantCARE database and divided them into four categories (Fig. 7A). We found that the individual DELLA gene in B. napus contains multiple cis-acting elements (Table S4). Nearly all of the BnaDELLAs promoters have CAAT-box, TATA-box, light, stress, hormone, and development-related responsive cis-elements. However, the distribution and numbers varied significantly between the BnaDELLAs (Fig. 7B). In detail, BnaA09GAI, BnaA02RGL1 has a higher number of light-responsive and hormone-responsive elements. In contrast, BnaA06RGA, BnaA05RGL2, and BnaA10RGL3 carried a higher number of stress-responsive and development-related cis-elements, respectively. However, some of the cis core elements were only found in some BnaDELLAs. For example, GC-motif (enhancer-like element involved in anoxic specific inducibility), DRE-core (cis-acting regulatory element regulate cold stress, induce dehydration), and 3-AF binding site (part of a conserved DNA module array CMA3) were found in BnaA06RGA and BnaC07RGA. Similarly, GATA-motif (cis-acting regulatory element involved in light-responsive floral, hypocotyl, and seed development), AT-Rich sequence (cis-element for maximal elicitor-mediated activation) were present in BnaCO9GAI and BnaA09GAI. ATCT-motif (Part of a conserved DNA module involved in light responsiveness), Gap-Box (cis-acting element related to light-responsive GapA gene) was present in BnaC02RGL1 and BnaA02RGL1, respectively. Moreover, AuxRR-Core (cis-acting regulatory element involved in auxin responsiveness) was only found in BnaA05RGL2 and BnaA05RGL2-2. In contrast, O2-site (cis-regulatory element involved in zein metabolism regulation) was absent in all BnaDELLAs except BnaC09RGL3 and BnaA10RGL3 (Fig. 7A). These results showed that the BnaDELLA gene family contains a wide variety of stress and defense-related cis-elements compared to development, light, and hormone-responsive cis-elements, suggesting the BnaDELLAs diverse function in response to various biotic and abiotic stresses.
Fig. 7
cis-acting element prediction in the BnaDELLAs. A The values in the circle indicated the count of cis-acting element in the promoter of BnaDELLAs; B The different colored block lines represent the different types and positions of cis-acting elements in each BnaDELLA gene
cis-acting element prediction in the BnaDELLAs. A The values in the circle indicated the count of cis-acting element in the promoter of BnaDELLAs; B The different colored block lines represent the different types and positions of cis-acting elements in each BnaDELLA gene
Transcriptomic and qRT-PCR analysis of BnaDELLAs in different tissues
The BnaDELLA gene family transcriptomic expression data from the roots, cotyledon, leaf, sepal, petal, filament, pollen, bud, middle stem, lower stem, upper stem, vegetative rosette, silique, silique wall, and seed of the B. napus cultivar ZS11, were obtained from the BnTIR database http://yanglab.hzau.edu.cn/BnTIR. The extracted data normalized by log2 fold change and heatmap was generated. As shown in Figure S4, the expression patterns of the 10 BnaDELLAs were different among roots, cotyledon, leaf, sepal, petal, filament, pollen, bud, middle stem, lower stem, upper stem, vegetative rosette, silique, silique wall, and seed, which points out that the additional copies of the homologs BnaDELLAs show variations in expression during seed germination to reproductive development. This can provide important insights into these genes distinct roles in B. napus. To better understand the expression pattern of the BnaDELLAs, we performed qRT-PCR in eight primary tissues (root, mature-silique, leaf, flower, flower-bud, stem, shoot-apex, seed) of B. napus cultivar ZS11. We found a strong correlation between the transcriptomic and our qRT-PCR results (Fig. 8). On the whole, BnaGAI and BnaRGA are highly expressed in the stem and shoot-apex, while BnaRGL1 and BnaRGL2 were mainly expressed in the floral organs and seed, respectively. Conversely, in our qRT-PCR analysis, BnaRGL3 shows minimal expression in any tissues. However, combined with transcriptomic data analysis, BnaRGL3 expression was highly observed in the silique. The contradiction between the qRT-PCR and transcriptomic data, especially in the BnaRGL3 expression, might be due to the harvesting of silique at six and 28 days after flowering, which show the complex variation of the BnaDELLAs from seed germination to vegetative and reproductive development. This result indicates the unique expression patterns of the BnaDELLAs at multiple plant tissues, which might play an indispensable role in regulating gibberellins and other phytohormones signals to mediate plant growth and survival tradeoff under constant stress conditions.
Fig. 8
qRT-PCR analysis of the selected BnaDELLAs expression in different organs. The relative abundance of the selected BnaDELLAs was normalized with respect to the reference gene (Actin). The x-axis corresponds to different organs. Values on the y axis are denoted as the mean ± SD of three biological replicates (listed in Table S5.2). Asterias on vertical bar shows significant difference at * P < 0.05, ** P < 0.01, *** P < 0.001
qRT-PCR analysis of the selected BnaDELLAs expression in different organs. The relative abundance of the selected BnaDELLAs was normalized with respect to the reference gene (Actin). The x-axis corresponds to different organs. Values on the y axis are denoted as the mean ± SD of three biological replicates (listed in Table S5.2). Asterias on vertical bar shows significant difference at * P < 0.05, ** P < 0.01, *** P < 0.001
Expression analysis of BnaDELLAs under different stress
To further explore and gain more insights into possible BnaDELLAs function under biotic and abiotic stresses. We studied the pre-published RNA-seq data to detect the genes expression patterns under different stress conditions, such as MA (Cold shockat chilling 4 °C and freezing − 4 °C temperatures), CA (4 degree Celsius 12 h following cold acclimation 14 days 4 degree Celsius), FA (4 degree Celsius 12 h following cold acclimation 14 days 4 degree Celsius), DT (Drought treated), HT (Heat treatment), ABA (Abscisic acid), salinity, and Sclerotinia sclerotiorum. Overall, RNA-seq data analysis exhibits the BnaDELLAs expression patterns varied upon different stress treatments. For instance, BnaRGL2 was up-regulated by all denoted stresses except in drought and salt (Fig. 9). Whereas, BnaGAI show putatively induced expression in response to MA, HT, DT, and salinity. In contrast, BnaA10RGL3, BnaC09RGL3 almost exhibits reduced expression in response to heat, drought, ABA, and salt treatment. However, higher expression was observed during cold and Sclerotinia sclerotiorum treatment. Many previous studies on AtDELLA genes have provided evidence of their distinct and fundamental role in regulating plant physiology under abiotic and biotic stresses [33, 54–56], suggesting the strong relation of the BnaDELLA gene family in improving stress tolerance.
Fig. 9
Heatmap of the expression profile of BnaDELLAs under different abiotic and biotic conditions including, MA (Cold shock at chilling 4 °C and freezing − 4 °C temperatures), CA (4 degree Celsius 12 h following cold acclimation 14 days 4 degree Celsius), FA (-4 degree Celsius 12 h following cold acclimation 14 days 4 degree Celsius), DT (Drought treated), HT (Heat treatment), ABA, salinity, and Sclerotinia sclerotiorum. The color scale reflects the data of the expression being processed with normalization of log2 (listed in Table S7), and different colors denote different expression levels
Heatmap of the expression profile of BnaDELLAs under different abiotic and biotic conditions including, MA (Cold shockat chilling 4 °C and freezing − 4 °C temperatures), CA (4 degree Celsius 12 h following cold acclimation 14 days 4 degree Celsius), FA (-4 degree Celsius 12 h following cold acclimation 14 days 4 degree Celsius), DT (Drought treated), HT (Heat treatment), ABA, salinity, and Sclerotinia sclerotiorum. The color scale reflects the data of the expression being processed with normalization of log2 (listed in Table S7), and different colors denote different expression levels
Gene Ontology
In order to understand the functional regulatory mechanism of the BnaDELLA gene family, we used the AtDELLA orthologous pairs of the A. thaliana to performed GO enrichment analysis. Three common categories of GO terms were observed including, biological process (BP), cellular component (CC), and molecular function (MF). In the MF category, DELLA genes are highly enriched in binding (GO:0,003,700), (GO:0,005,515), and transcriptional regulation activity (GO:0,140,110). CC is enriched in the nucleus (GO:0,005,634), which exhibits that DELLAs are nuclear proteins. Similarly, most of the GO terms (GO:0,009,737, GO:0,009,739, GO:0,009,740, GO:0,009,753, GO:0,042,538, GO:0,009,863, GO:0,072,593, GO:0,009,651, GO:0,009,908, GO:2,000,033, GO:0,030,154, GO:0,010,187, GO:0,009,938, GO:0,006,355, GO:0,010,218, GO:0,009,723) were abundant in biological process, indicating a response to hormones and stresses (Figure S5, Table S8). This GO enrichment results suggested that the BnaDELLAs play a pivotal role in regulating hormonal signaling in response to stresses, which is consistent with previous studies [9, 57–59].
Discussion
In this study, 10 putative BnaDELLAs were identified from the B. napus genome and grouped into three subfamilies BnaGAI/BnaRGA, BnaRGL1, and BnaRGL2/BnaRGL3 based on their homology. Systematic analyses such as phylogenetic relation, gene structure, motif composition, physicochemical properties, gene duplication, miRNA prediction, and cis-element analysis in the promoters were performed. Moreover, qRT-PCR and pre-published RNA-seq data were analyzed to disclose the expression profiling of the BnaDELLAs. These results provide valuable insight for further functional characterization of the BnaDELLA gene family, which could improve molecular breeding to accommodate rapeseed plants to the expected climate conditions.DELLA proteins are well-known as negative coregulators that mediate crosstalk between GAs and various hormonal signals to maintain plant growth and survival tradeoff, responding to abiotic and biotic conditions [8, 10]. Previous reports on the seeded plant had identified one, two, and five DELLA genes in Oryza sativa [25], Pisum sativum [27], and A. thaliana, respectively. Cloning and modulating DELLA proteins in these plants resulted in increased harvest index, seed quality, tillering, flower timing, and stress tolerance. For example, overaccumulation of the DELLA protein enhances the submergence tolerance [60], saltstress [61], and shade avoidance [62, 63], which significantly improves plant fitness. In contrast, reduced DELLA protein expression decreases tillering [64, 65] and seed dormancy [66], thus increasing seed weight and germination. In this study, a total of 10 BnaDELLAs have been identified in B. napus, which means that the individual AtDELLA have multiple homologs in B. napus. Rapeseed is an allotetraploid (AACC) crop that originated from the hybridization of two diploid progenitors B. rapa (AA) and B. oleracea (CC) [67]. Chromosomal mapping indicated that five and four BnaDELLAs are located on the proximal or the distal ends of AA and CC subgenome, respectively (Fig. 4), which exhibits that homologs of BnaDELLAs might play a similar role in biological function as both ancestral species.DELLA gene family contain two highly conserved N-terminal DELLA and C-terminal GRAS domain in various plant species. In this study, it was found that the BnaDELLA gene family shared similar types of conserved domains. However, motif numbers and their composition between BnaDELLAs are unevenly distributed, indicating the domain shuffling in the protein structure of the BnaDELLAs, which may suggest functional diversification of the BnaDELLA gene family.DELLA gene family in A. thaliana, B. napus, B. rapa, B. oleracea, and B. juncea shows a significant gene structure containing a single exon and does not have any introns. It has been shown that the genes with no or fewer introns expressed rapidly in response to biotic and abiotic stresses [68, 69]. Compared with transcriptomic data used in this study, we detected the distinct expression patterns of the intronless BnaDELLAs in response to cold, drought, heat, Sclerotinia sclerotiorum, salinity, and ABA treatments, suggesting the strong relation of BnaDELLAs to biotic and abiotic stresses (Fig. 9, Table S7). Moreover, exon composition exhibited the higher evolutionary conservation of DELLA genes among Brassicaceae species (Fig. 2).DELLA proteins are well described as master repressors of GAs signaling to modulate plant physiology [70, 71]. GAs derepress DELLA repression through several positive regulators, including GA receptors GA-INSENSITIVE DWARF 1 (GID1), SPINDLY (SPY), and F-box protein (SLY1, SNE) under natural environment to stimulate plant growth [44]. However, several studies have illustrated that the DELLAs stability can be regulated through GAs dependent and independent proteolysis [72, 73]. A recent study has hypothesized that the rice microRNA (OsmiR396) putatively regulates the rice DELLA gene SLR1, targeting GA-responsive growth-regulating factors (GRFs) to inhibit growth promotion in rice [74]. In this study, a total of 18 bna-miRNAs were predicted in targeting the BnaDELLAs (Table 2). In which, BnaC07RGA and BnaA09GAI are putatively regulated by the two known miRNAs bna-miR6029 and bna-miR6031, respectively. In compliance with this, a recent study has shown that the increased expression of the bna-miR6029 regulates fatty acid biosynthesis to mediate seed development in response to environmental challenges [75]. Thus, we speculate that the BnaDELLAs were the most likely targeted genes by the predicted bna-miRNAs to mediate plant growth and survival tradeoff under constant exogenous or endogenous stimuli. However, further investigation is needed to elucidate the miRNA process with BnaDELLA genes.This study also discovers diverse cis-elements in BnaDELLAs promoter, including light-responsive, hormones responsive, and stress-related elements (Fig. 7), but their distribution is uneven. For instance, BnaA02RGL1, BnaC02RGL1, and BnaA09RGL3, BnaC09RGL3 had two ABREs in their promoter regions, while BnaA05RGL2 and BnaA05RGL2-2 had no ABREs, although they were considered to induced ABA response differently. Additionally, BnaA05RGL2 and BnaA05RGL2-2 had one MBS cis-element in their promoter regions. Intriguingly, the BnaRGL2 gene relative expression was not observed in the drought treatment (Fig. 9). Thus, these findings indicate the presence of unidentified cis-elements and signify that the expression of BnaDELLAs might be regulated through post-transcriptional modification [50, 52], which provides the clue for gene expression studies under different biotic and abiotic stresses. Researches on A. thaliana have identified five AtDELLA genes GA-Insensitive (GAI), Repressor of ga1-3 (RGA), RGA-Like1 (RGL1), (RGL2), (RGL3). Cloning and sequencing of these AtDELLA genes reported the distinct and overlapping role in regulating GAs stimulated plant growth. For instance, AtGAI and AtRGA control hypocotyl cell division and floral induction [29, 30, 76]. AtRGL1 and AtRGL2 are involved in modulating leaf senescence, male sterility, and seed germination [32, 33]. While AtRGL3 has been reported to contribute plant defense in response to biotic stresses [10, 35, 77]. Consistent with this, our gene expression profiling and pre-published RNA-Seq data analysis (Table S5, Table S7) putatively indicate the distinct expression patterns of the BnaDELLA gene family in response to biotic and abiotic stresses. For instance, BnaRGL2 shows higher expression in all tested stresses except in drought, salinity, and Sclerotinia sclerotiorum (Fig. 9). Whereas, BnaGAI is expressed in stems and shows a response to MA, HT, DT, and salinity. In contrast, BnaRGL3 almost exhibits reduced expression in response to heat, drought, and ABA treatment. However, induced expression was observed during cold and salt treatment. These findings are consistent with studies that have also been found on their homologs in A. thaliana [78, 79]. Moreover, previous studies also confirmed the increased expression of the AtRGL3 in response to the plant defense [10, 35, 77]. Combined with transcriptomic data used in this study, we observed the increased expression of the BnaA09RGL3 and BnaC09RGL3 in 24 h of Sclerotinia sclerotiorum infection (Fig. 9), suggesting the BnaRGL3 vital role in mediating B. napus survival under constant stress condition. Furthermore, BnaRGL2 homolog in A. thalianaAtRGL2 is indicated as an essential component to positively regulate ABA responses to promote seed dormancy [80-82]. In our qRT-PCR and RNA-seq analysis, we found that BnaRGL2 was mainly expressed in the seeds and putatively showed induced expression after 4 h of ABA treatment but eventually reduced after 24 h of ABA treatment. However, further experimental studies are required to gain more insights into the BnaDELLAs in the ABA signal transduction pathway. In contrast, during saltstress, the transcripts of the BnaA09GAI, BnaC09GAI, and BnaCO9RGL3 were up-regulated, whereas the rest of the BnaDELLAs were down-regulated (Fig. 9), suggesting the importance of BnaGAI in susceptibility to severe saltstress. Importantly the link of AtGAI with saltstress has been identified, which confirmed the enhanced salt tolerance by restraining the plant growth [83, 84].Our study provides functional diversification and comprehensive knowledge of the BnaDELLA gene family in B. napus. However, further experimental studies are needed to better understand the distinct roles of the BnaDELLAs under biotic and abiotic stress conditions, which will help consolidate our understanding of plant ontogenesis and enhance agronomic techniques to improve B. napus yield.
Conclusions
A significant role of DELLA proteins is to mediate GAs and almost all phytohormones signaling pathways to maintain a dilemma between plant defense and growth under constant stresses. In our study, we identified and characterized the BnaDELLA gene family in B. napus. A total of 10 BnaDELLAs have been identified in the B. napus genome and classified into three groups. All of the BnaDELLAs are closely related to the A. thaliana five DELLA genes, suggesting a comparable function and gene structure. The motifs composition within the same subfamily is uneven; however, individual BnaDELLA gene contains 12 highly conserved motifs, encoding the DELLA and GRAS domains. Phylogenetic and syntenic study of the DELLA genes between B. napus and its ancestral species provides helpful hints or evolutionary features of the BnaDELLAs. Moreover, miRNAs targets, cis-acting elements, and transcriptional regulation of the BnaDELLA gene family were also predicted. Overall, these results provide valuable clues into the evolutionary relationship and potential functions of the BnaDELLAs, which will be helpful for further genetic manipulation toward developing B. napus variants with enhanced tolerance to environmental fluctuation.
Methods
Identification and protein sequence analysis of BnaDELLAs
In order to search the DELLA gene family in B. napus, the peptide sequence of the five DELLA genes from A. thaliana genome database (http://www.arabidopsis.org/) with corresponding Gene ID (At1G14920.1, At2G01570.1, At1G66350.1, At3G03450.1, At5G17490.1) were retrieved and used as queries to perform BLAST P search in B. napus Genome browser (BnPIR, http://cbi.hzau.edu.cn/bnapus), and (GENOSCOPE, https://www.genoscope.cns.fr/brassicanapus/). Those from B. oleracea, B. rapa, B. juncea, and B. nigra were downloaded from Brassica Database (BRAD, http://brassicadb.cn/#/). The sequences with 80% similarity were selected, and incorrectly or repeated sequences were manually re-annotated for DELLA domain analysis in the scan ScanProsite (https://prosite.expasy.org) and InterProScan (https://www.ebi.ac.uk/interpro/search/sequence/). The protein sequences were then used to calculate the isoelectric point (pI), molecular weight (MW), and the number of amino acids by the ProtParm tool (http://web.expasy.org/). Furthermore, prediction of subcellular location pattern of each BnaDELLA was carried out using the web-server Plant-mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/) [85], and ProtComp v.9.0 in softberry (http://linux1.softberry.com/).
Phylogenetic and gene structure assessment of the DELLA in B. napus, A. thaliana, B. rapa, B. oleracea, B, juncea, B. nigra
Putative peptide sequences from the six Brassicaceae species B. napus, A. thaliana, B. rapa, B. oleracea, B. juncea, and B. nigra aligned using the MUSCLE (https://www.ebi.ac.uk/Tools/msa/muscle) with default parameters. Aligned sequences were then used to construct the evolutionary tree with the MEGA 10.2 software by the neighbor-joining (NJ) method [86]. The authenticity of the tree was tested by performing 1000 bootstrap replications. The phylogenetic tree Newick format was then uploaded to the iTOL web server (http://itol.embl.de/) for better visualization. Furthermore, genomic and coding sequences of the B. napus, B.oleracea, B.rapa, B. juncea, and A. thaliana DELLA genes were rendered in Gene Structure Display Server (GSDS2.0) (http://gsds.cbi.pku.edu.cn) to predict gene structure and exon/intron location.
Sequence alignment and evaluation of BnaDELLAs motifs
To classify the DELLAs characteristic domains in the B. napus, we have aligned the 38 DELLAs codding sequence from B. napus, A. thaliana, B. rapa, B. oleracea, B. juncea, and B. nigra by using the Muscle option in the MEGA 10 with default parameters. Furthermore, Motif Elicitation version 5.1.1 (MEME http://meme-suite.org/tools/meme) was used to identify the conserved motifs in the BnaDELLAs with the maximum motif search set to 20, and other parameters are set to default. Any repetitions were considered motifs sites that spread throughout the sequence [87]. Further annotation of the identified motifs was implemented by the InterProScan (InterPro ebi.ac.uk). The conserved motifs were visualized by using the TBtools software [88]. Additionally, the secondary structure of the BnaDELLA proteins is carried by PSIPRED (http://bioinf.cs.ucl.ac.uk/PSIPRED).
Chromosome location, collinearity analysis, and site-specific selection assessment and testing
BnaDELLAs detailed chromosome location was acquired from the GFF genome file downloaded from B. napus genomic database (BnPIR, http://cbi.hzau.edu.cn/bnapus), and mapped the predicted location on the chromosome by using the TBtools software with red-colored gene names indicated as relative position. Gene duplication events were identified by aligning the BnaDELLAs sequences using BLASTP and MCScanX to characterize the BnaDELLAs into a tandem and segmental duplication [89]. Furthermore, the syntenic map of DELLAs orthologous among B. napus, A. thaliana, B.rapa, B. oleracea, and B. nigra were obtained by the custom phyton script. For examining the site-specific selection, a Bayesian inference approach Selecton Server (http://selecton.tau.ac.il/ [90] was used to predict the positive and purifying selection. Besides this, we also calculated the synonymous (Ks) and nonsynonymous mutation (Ka) at each codon by KaKs_Calculator 2.0 [91]. In addition, BnaDELLA gene pairs divergence time was presumed using the formula T = Ks/2r with r (1.5 × 10–8) representing neutral substitution per site per year [92].
miRNA target prediction and cis-acting elements regulatory analysis
To validate the interactions between miRNA and their targets. We obtained the B. napus stem-loop and mature miRNA sequences from the PNRD (http://structuralbiology.cau.edu.cn/PNRD/index.php) [93] and miRbase (http://www.mirbase.org/) database. The Plant small RNA Target analysis server psiRNATarget [94] with default parameters was used to predict the bna-miRNAs target genes in the BnaDELLA gene family. For cis-element analysis, 1500 bp upstream promoter sequence from the translation start site of the BnaDELLAs were inspected in the plantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [95], and distribution of the cis-acting elements visualized by TBtools software [88].
Plant material RNA extraction and qRT-PCR
The seeds of B. napus cultivar ‘ZS11’ was donated by professor Liu Shengyi of Oil Crops Research Institute,Chinese Academy of Agricultural Sciences, Wuhan. B. napus was grown in the greenhouse of Institute of Life sciences Jiangsu University under the following conditions 20 ± 5°C, 16 h light /8 h dark at a light intensity of 50 µmol/m2/s and 70% relative humidity. Tissues from roots, mature-silique, leaves, flowers, flower-bud, stems, shoot-apex, and seeds were collected from adult plants and immediately frozen in liquid nitrogen and stored at -80οC for RNA extraction. The total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA) and treated with RNase-free DNaseI (Invitrogen, Carlsbad, CA). Total RNA was then employed to produce cDNA with HiScript III-RT SuperMix for qPCR (Vazyme, China) according to the manufacturer's instructions. Real-time fluorescence quantitative analysis (qRT-PCR) was performed by Thermo Fisher Scientific QuantStudio 5 Real-Time PCR system with three independent replicates. The B. napusActin gene (GenBank ID: XM_013858992) was used as an internal control. The 2−∆∆Ct method was implemented to measure the relative gene expression level of BnaDELLAs. The relative expression of the BnaDELLAs in root was used as control, and a t-test was implemented to measure the significant difference among tissues, and the results were visualized using GraphPad Prism8.0 software [96]. All of the gene-specific primers used in this study were designed by the Beacon primer design program (Primer Biosoft International, Palo Alto, CA) and listed in (Table S6).
Gene ontology and expression pattern analysis of BnaDELLAs
The BnaDELLAs functional properties were analyzed using the online web server DAVID (https://david.ncifcrf.gov/) and panther (http://go.pantherdb.org/webservices/go/overrep.jsp) to conduct Gene Ontology enrichment analysis. The predicted GO terms were annotated using the TBtools software. In addition, expression profiles of BnaDELLAs under heat, drought, cold, ABA induce, salt and Sclerotinia sclerotiorum stress condition were obtained from the pre-published transcriptomic data sets (SRP277041), (SRP190170) [97], (CRA001775) [98], and (SRP075294) [99]. The differential expression analysis was performed using the DSEeq2 package in R. The predicted values were normalized by log2 fold change, and heatmap was generated via TBtools.Figure S1: Alignment of BnaDELLA protein family.Figure S2: Schematic diagram of BnaDELLA proteins motifs logo.Figure S3: Site-specific selection assessment of BnaDELLAs.Figure S4: BnaDELLAs expression at different development stages in different organs by transcriptomic analysis.Figure S5: Gene ontology (GO) analysis.Table S1. Percent sequence homology comparison between B. napus and A. thaliana. Table S2. BnaDELLAs synteny relationship among A. thaliana, B. rapa, B. oleracea, B. nigra. Table S3. Ks/Ka values of BnaDELLAs. Table S4. cis-elements of BnaDELLAs. Table S5.1. BnaDELLAs expression at different development stages in different organs by transcriptomic analysis. Table S5.2: BnaDELLAs expression in different organs by qRT-PCR. Table S6: Primers used for Real-time PCR analysis. Table S7. Expression profiling of BnaDELLAs under different stresses. Table S8. GO enrichment analysis. Table S9. List and sequence of the 10 BnaDELLAs identified in this study.
Authors: Patrick Achard; Jean-Pierre Renou; Richard Berthomé; Nicholas P Harberd; Pascal Genschik Journal: Curr Biol Date: 2008-05-06 Impact factor: 10.834
Authors: Amelia Felipo-Benavent; Cristina Úrbez; Noel Blanco-Touriñán; Antonio Serrano-Mislata; Nicolas Baumberger; Patrick Achard; Javier Agustí; Miguel A Blázquez; David Alabadí Journal: Development Date: 2018-11-26 Impact factor: 6.868
Authors: Hui Cheng; Lianju Qin; Sorcheng Lee; Xiangdong Fu; Donald E Richards; Dongni Cao; Da Luo; Nicholas P Harberd; Jinrong Peng Journal: Development Date: 2004-03 Impact factor: 6.868