De-Feng Meng1, Hua Shao2, Chuan-Bo Feng2. 1. Department of Oncology Surgery, North China University of Science and Technology Affiliated Hospital, Tangshan, Hebei, People's Republic of China. 2. Department of Thyroid and Breast Surgery, The Second People's Hospital of Lianyungang City, Lianyungang, Jiangsu, People's Republic of China.
Abstract
PURPOSE: Long non-coding RNAs (lncRNAs) are known to regulate tumorigenesis. Although breast cancer tissues show a high expression of LINC00894, its specific biological role in breast cancer progression is still unknown. In this study, lncRNA microarray was used to analyze the lncRNA expression in breast cancer tissues, and LINC00894 was selected for further analysis. MATERIALS AND METHODS: Expression of LINC00894 in 45 pairs of breast cancer tissues and normal tissues obtained from patients with breast cancer was assessed by quantitative reverse transcription-PCR, while proliferation and invasion of breast cancer cells were assessed using a Cell Counting Kit-8 (CCK-8), EdU assay, colony formation experiment, and transwell assays. A dual-luciferase reporter gene assay and bioinformatics analysis were employed to detect potential targets of LINC00894. Additionally, RNA Binding Protein Immunoprecipitation (RIP) and Western blot assays were utilized to clarify its interaction and roles in the regulation of breast cancer progression. RESULTS: High expression of LINC00894 was observed in breast cancer cells, and its overexpression significantly expedited cell proliferation and invasion. Moreover, LINC00894 positively regulated the expression of ZEB1 by competitively binding to miR-429. CONCLUSION: Taken together, these results suggest that LINC00894 competitively binds to miR-429 to mediate ZEB1 expression; consequently, it is implicated to play a role in the progression of breast cancer.
PURPOSE: Long non-coding RNAs (lncRNAs) are known to regulate tumorigenesis. Although breast cancer tissues show a high expression of LINC00894, its specific biological role in breast cancer progression is still unknown. In this study, lncRNA microarray was used to analyze the lncRNA expression in breast cancer tissues, and LINC00894 was selected for further analysis. MATERIALS AND METHODS: Expression of LINC00894 in 45 pairs of breast cancer tissues and normal tissues obtained from patients with breast cancer was assessed by quantitative reverse transcription-PCR, while proliferation and invasion of breast cancer cells were assessed using a Cell Counting Kit-8 (CCK-8), EdU assay, colony formation experiment, and transwell assays. A dual-luciferase reporter gene assay and bioinformatics analysis were employed to detect potential targets of LINC00894. Additionally, RNA Binding Protein Immunoprecipitation (RIP) and Western blot assays were utilized to clarify its interaction and roles in the regulation of breast cancer progression. RESULTS: High expression of LINC00894 was observed in breast cancer cells, and its overexpression significantly expedited cell proliferation and invasion. Moreover, LINC00894 positively regulated the expression of ZEB1 by competitively binding to miR-429. CONCLUSION: Taken together, these results suggest that LINC00894 competitively binds to miR-429 to mediate ZEB1 expression; consequently, it is implicated to play a role in the progression of breast cancer.
Breast cancer is not only the most prevalent malignant tumor in females, but also one of the major causes of cancer-related deaths in females, worldwide.1,2 About 2.1 million newly diagnosed breast cancer cases were reported worldwide in 2018, accounting for almost 1 in 4 cancer cases among women.1 Early-stage breast cancer responds well to radiation, drug therapy, and surgical intervention.3 Nevertheless, there is a trend for breast cancer to metastasize in distal organs (eg, the brain, lungs, liver, and bones), and poor prognosis is observed in patients with distal metastasis. Despite progress in systemic chemotherapy, the median survival of patients with metastatic breast cancer is less than two years.4 Hence, more studies on effective strategies to diagnose breast cancer at an early stage, inhibit its metastasis and predict prognosis, and reduce mortality of breast cancer patients are needed.Long non-coding RNAs (lncRNAs) are non-coding RNAs composed of over 200 base pairs.5 Most of these lncRNAs have a poly A tail and are incapable of being translated into proteins unlike mRNAs.6 lncRNAs were identified earlier as “transcriptional noise” or “dark matter” without any biofunctions.7 However, many dynamically expressed lncRNAs have been identified in whole genome transcriptome analysis, and many of these lncRNAs participate in various biological activities, for example, lincRNA-RoR manages the reprogramming of human induced pluripotent stem cells.8
MYOSLID is a new lncRNA that depends on serum response factors and may amplify the differentiation of vascular smooth muscle cells.9 lncRNA is a major regulatory factor in the progression of breast cancer. The TEAD4-regulated lncRNA, MNX1-AS1, partially enhances breast cancer progression by suppressing BTG2 and activating BCL2.10 Moreover, the lncRNA SOX2OT enhances breast cancer progression by sponging miR-194-5p and regulating AKT2.11 The breast juice lncRNA is utilized as a marker to screen breast cancer.12 However, the exact role of LINC00894 in the progression of breast cancer is unclear. Therefore, in this study, lncRNA microarray was used to analyze the lncRNA expression in breast cancer tissues, and LINC00894 was selected for further analysis.The results of our study verified that high levels of LINC00894 were present in both breast cancer cells and tissues. Overexpressed LINC00894 could accelerate breast cancer cell invasion and proliferation. In brief, LINC00894 was confirmed to be involved in breast cancer progression through competitive binding to miR-429 to mediate the transcriptional factor Zinc finger E-box binding homeobox 1 (ZEB1) expression.
Materials and Methods
Clinical Tissue Samples
Forty-five pairs of breast cancer tissues and normal tissues were obtained from patients with breast cancer confirmed by pathological tests at the Second People’s Hospital of Lianyungang City. Each pair of breast cancer tissue and normal tissue was obtained from the same patient. None of the patients had undergone preoperative chemotherapy or radiotherapy, and they provided informed consent. Immediately after removal, all the samples were frozen in liquid nitrogen to perform further experiments. The experiments were approved by the Ethics Committee of the Second People’s Hospital of Lianyungang City. All population-related studies were performed based on the World Medical Association Declaration of Helsinki, and written informed consent forms were obtained from all the participants.
Cell Culture and Transfection
Breast cancer cell lines (CAL-51, MCF-7, BT-20, BT-549, and AU565) and human normal mammary epithelial cells (MCF 10A) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal bovine serum (FBS, Beyotime, Nantong, China), 100 IU/mL penicillin, and 100 μg/mL streptomycin (Invitrogen, Carlsbad, CA, USA), and maintained at 37 °C under 5% CO2. The LINC00894 overexpression plasmids, LINC00894 siRNA, LINC00894 shRNA, miR-429 inhibitors, and miR-429 mimics were constructed by GenePharma (Shanghai, China). Cell transfection was conducted using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After 48–72 h of culture, the cells were washed and transfected cells were collected for further experiments.
RNA Extraction and Quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR)
The RNAiso Plus kit (Takara, Japan) was employed for the extraction of total RNA from MCF-7 and AU565 cells and PrimeScript RT-PCR kit (Takara, Japan) was used for reverse transcription as per the manufacturers’ instructions. Using a Fast Real-time PCR 7500 System (Applied Biosystems), qRT-PCR was conducted using SYBR-green PCR Master Mix in 10 mL reaction mixtures in triplicate. GAPDH or U6 were used as internal controls.13 Primer sequences were designed as follows: LINC00894 forward 5ʹ- GCAGGGTCTCTTGAGTTCCT −3ʹ, reverse 5ʹ-TTCCTCAAGCTTCTCCAGGG-3ʹ; miR-429 forward 5ʹ-ACACTCCAGCTGGGTGCCAAAATGGTCTGT-3ʹ, reverse 5ʹ- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGATTATGAC-3ʹ; ZEB1 forward 5ʹ-GCCAATAAGCAAACGATTCTG-3ʹ, reverse 5ʹ- TTTGGCTGGATCACTTTCAAG-3ʹ. The 2−ΔCt method was utilized for calculating relative RNA levels.
Cell Proliferation
Cell Counting Kit-8 (CCK-8, Dojindo, Japan) was used to assess the viability of AU565 and MCF-7 cells as per the manufacturer’s instructions within five days after seeding transfected cells in 96-well plates. A multifunctional microplate reader (Bio-Rad Laboratories, Hercules, CA, USA) was employed to measure absorbance at 450 nm after 1 h of incubation.For the EdU assay, cell culture was performed using the EdU reagent for 2 h, with 15 min of cell fixation in 4% paraformaldehyde, followed by EdU staining as per the manufacturer’s protocol.
Colony Formation Assays
For the colony formation assay, 0.5 × 103 cells were inoculated into a 12-well plate and cultured for ten days. The original medium was replaced with fresh medium on the 5th day. Following incubation, PBS was used to rinse the cells, which were then immobilized with 4% paraformaldehyde for 5 min and stained with 0.1% crystal violet for 30 s. The experiment was performed thrice.
Transwell Cell Invasion Assay
After suspending cells at a density of 1.0 × 105/mL in serum-free medium, a transwell chamber (Corning, NY, USA) precoated with Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) was placed in the 24-well plate. The apical chamber and basolateral chamber contained a 200 μL suspension of cells and 500 μL medium with 10% FBS, respectively. Forty-eight hours later, with the chambers removed, the penetrating cells were fixed in 5% paraformaldehyde and subsequently stained with 0.1% crystal violet for 20 min. A light microscope (Olympus) was utilized for imaging and counting the invasive cells in five randomly selected fields for each filter.
Subcellular Distribution
RNA was extracted from cells at the cytoplasmic and nuclear levels using a PARIS Kit (Life Technologies, USA), and the quantification of total RNA in each fraction was carried out using qRT-PCR. Internal references were U6 and GAPDH for the nucleus and cytoplasm, respectively.
Dual-Luciferase Reporter Gene Assay
Mutant-type (ZEB1 Mut, LINC00894 Mut) and wild-type plasmids (ZEB1 Wt, LINC00894 Wt) were constructed. After seeding HEK293T cells into 24-well plates, Lipofectamine 2000 was used to co-transfect 50 nM miR-429 mimics or negative control and wild- or mutant-type plasmids. Plasmid to vector (pRL-SV40) ratio was 80 ng:5 ng. A dual-luciferase reporter assay kit (Promega, Madison, WI, USA) was used to detect luciferase intensities.
RNA Immunoprecipitation (RIP) Assay
Magna Nuclear RIP™ Nuclear RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) was used for the RIP assay. Briefly, cell lysis was performed using a complete RIPA buffer and adding RNase inhibitor and protease inhibitor cocktails. After conjugating with human AGO2 antibody or IgG as control (Millipore, Bedford, MA, USA), cell extracts were obtained using RIP buffer containing magnetic beads. Next, protein digestion was carried out to obtain immunoprecipitated RNAs. Finally, purified RNAs were quantified using qRT-PCR. Anti-miR-429 and anti-LINC00894 procured from Abcam (Cambridge, MA, USA) were used in the RIP assay.
Western Blotting
After extracting and quantifying proteins using the BCA method, the protein samples were separated using SDS-PAGE gel electrophoresis, proteins were transferred to nitrocellulose membranes, and the membranes were blocked with 5% defatted milk. Next, the membranes were incubated with antibody against ZEB1 (ab203829, Abcam, Shanghai, China) and GAPDH antibody (ab181602, Abcam, Shanghai, China) as primary antibodies and subsequently with corresponding secondary antibodies. Protein bands were visualized using chemiluminescence.
Construction of Tumor Models
Six BALB/c athymic nude mice (five-week-old) obtained from the National Laboratory Animal Center (Beijing, China) were subjected to seven days of acclimation before performing the assay. The North China University of Science and Technology approved all the animal experiments, which were performed following the National Institutes of Health (NIH) guidelines on animal welfare. For the construction of a breast cancer xenograft model, 4 × 106 AU565 cells stably transfected with sh-LINC00894 or sh-NC were injected into the dorsal right flank of each mouse. The tumor volume was measured with calipers at two major axes every 1 week and calculated as: V = 0.5 × L (length) × W2 (width). Four weeks later, the mice were anesthetized using 40 mg sodium pentobarbital and then sacrificed with 10% formalin perfusion of the central nervous system.14 Death was confirmed when the heartbeat and breathing completely stopped as well as with the disappearance of the foot withdrawal reflex. Tumor tissues were removed and weighed.
Lung Metastasis Assay
Briefly, 1 × 106 AU565 cells in 30 μL of 30% Matrigel were injected intravenously through the tail vein of nude mice. After 4 weeks, nude mice were sacrificed, and metastatic nodules in each lung were analyzed.
Statistical Processing
All statistical analyses were conducted using GraphPad Prism 6.0 (GraphPad Software Inc., San Diego, CA, USA) and SPSS 20.0 (SPSS Inc., Chicago, IL, USA). Quantitative data are reported as mean ± SD. A nonparametric test was applied for non-normally distributed data, and t-test was conducted for the analysis of normally distributed data. Pearson’s correlation coefficient was determined to assess associations among LINC00894, miR-429 and ZEB1. Log rank test and Kaplan-Meier method were used to assess survival rates. Data concerning the association of LINC00894 expression with clinicopathological features of breast cancer were analyzed by chi-squared test or Fisher’s exact test. P<0.05 indicated statistical differences.
Results
LINC00894 Expression in Breast Cancer
For identifying the correlation between lncRNAs and breast cancer, GSE119233 microarray was employed to analyze the expression profiles of lncRNAs from 20 breast cancer tissues and 10 adjacent normal tissues.15 Collectively, the top 200 dysregulated lncRNAs, including 100 upregulated and 100 downregulated lncRNAs in breast cancer tissues, were analyzed ( and ). High expression of LINC00894 was observed in breast cancer tissues. Moreover, the high expression of LINC00894 in 45 pairs of breast cancer tissue samples and breast cancer cell lines (CAL-51, MCF-7, BT-20, BT-549, and AU565) was verified using qRT-PCR (Figure 1A and B). Particularly, among the breast cancer cell lines used for subsequent experiments, AU565 cells showed the highest LINC00894 expression, whereas MCF-7 cells exhibited the lowest expression. In addition, the survival rate of breast cancer patients with highly expressed LINC00894 was inferior to that of patients with low LINC00894 expression (Figure 1C). The average expression level (0.064) of LINC00894 in breast cancer tissues was taken as the cut off value for high and low levels. Correlation between LINC00894 expression and clinicopathological parameters of breast cancer patients is shown in Table 1. We found that higher LINC00894 expression was associated with TNM stage (P < 0.05), but there was no association between the expression level of LINC00894 and molecular subtypes in breast cancer (P > 0.05).
Figure 1
Characteristics and expression of LINC00894 in breast cancer cells and tissues. (A) LINC00894 expression in breast cancer tissues and paired normal tissue samples (n= 45) using qRT-PCR. (B) LINC00894 expression in breast cancer cell lines (CAL-51, MCF-7, BT-20, BT-549, and AU565) and normal mammary epithelial cells MCF 10A using qRT-PCR. (C) Kaplan-Meier analysis of overall survival of breast cancer patients stratified by LINC00894 expression.
Table 1
Patient Clinicopathologic Features
Clinicopathologic Features
Number of Cases
LINC00894 Expression
p value
Low (n=20)
High (n=25)
Age
0.5572
<40
25
10
15
≥40
20
10
10
Tumor size
0.0389*
T1
19
12
7
T2-T4
26
8
18
N stages
0.0010*
N0
21
15
6
N1-3
24
5
19
Metastasis
0.0169*
M0
22
14
8
M1
23
6
17
TNM stage
I/II
15
12
3
0.0012*
III/IV
30
8
22
ER status
0.5273
Negative
30
12
18
Positive
15
8
7
HER-2 status
0.2244
Negative
26
14
12
Positive
19
6
13
PR status
0.7600
Negative
18
7
11
Positive
27
13
14
Notes: Total data from 45 tumor tissues of breast cancer patients were analyzed. For the expression of LINC00894 was assayed by qRT-PCR, the average expression level was used as the cutoff. Data were analyzed by chi-squared test and Fisher’s exact test. *P-value in bold indicates statistically significant.
Patient Clinicopathologic FeaturesNotes: Total data from 45 tumor tissues of breast cancer patients were analyzed. For the expression of LINC00894 was assayed by qRT-PCR, the average expression level was used as the cutoff. Data were analyzed by chi-squared test and Fisher’s exact test. *P-value in bold indicates statistically significant.Characteristics and expression of LINC00894 in breast cancer cells and tissues. (A) LINC00894 expression in breast cancer tissues and paired normal tissue samples (n= 45) using qRT-PCR. (B) LINC00894 expression in breast cancer cell lines (CAL-51, MCF-7, BT-20, BT-549, and AU565) and normal mammary epithelial cells MCF 10A using qRT-PCR. (C) Kaplan-Meier analysis of overall survival of breast cancer patients stratified by LINC00894 expression.
LINC00894 Functions in Breast Cancer Cells
qRT-PCR was conducted to verify the transfection efficacy of the LINC00894 overexpression vector and LINC00894 siRNA in breast cancer cells (Figure 2A). Employing the CCK-8 assay, proliferation of breast cancer cells was observed to be remarkably reduced due to downregulation of LINC00894 and accelerated by overexpression of LINC00894 (Figure 2B); these results were similar to those obtained from the EdU assay and colony formation experiment (Figure 2C–F). Furthermore, the transwell assay revealed that invasion of breast cancer cells was enhanced by LINC00894 overexpression and decreased by LINC00894 downregulation (Figure 2G and H). Taken together, our findings uncovered that LINC00894 might play regulatory roles in cell proliferation and invasion of breast cancer cells.
Figure 2
Regulatory effects of LINC00894 on proliferative and invasive abilities of breast cancer cells. (A) qRT-PCR for LINC00894 expression in cells following transfection with si-LINC00894 or LINC00894 overexpression (OE) vector. (B–F) Proliferation of AU565 and MCF-7 cells after transfection with LINC00894 siRNA and LINC00894 overexpression (OE) vector, respectively, in CCK-8 assay, EdU assay, and colony formation experiment. (G and H) Invasion of AU565 and MCF-7 cells following transfection with LINC00894 siRNA and LINC00894 OE vector, respectively in a transwell assay. All the data represent three individual experiments and are shown as mean ± SD.
Regulatory effects of LINC00894 on proliferative and invasive abilities of breast cancer cells. (A) qRT-PCR for LINC00894 expression in cells following transfection with si-LINC00894 or LINC00894 overexpression (OE) vector. (B–F) Proliferation of AU565 and MCF-7 cells after transfection with LINC00894 siRNA and LINC00894 overexpression (OE) vector, respectively, in CCK-8 assay, EdU assay, and colony formation experiment. (G and H) Invasion of AU565 and MCF-7 cells following transfection with LINC00894 siRNA and LINC00894 OE vector, respectively in a transwell assay. All the data represent three individual experiments and are shown as mean ± SD.
LINC00894 is Targeted by miR-429
Breast cancer cells were fractionated into cytoplasmic and nuclear fractions, with GAPDH and U6 as the respective controls for verifying the cellular location of LINC00894. The results of qRT-PCR indicated the presence of LINC00894 in the cytoplasmic fractions of AU565 and MCF-7 cells (Figure 3A). Hence, it can be concluded that LINC00894 is implicated in breast cancer progression by post-transcriptional regulation and that LINC00894 is a possible ceRNA in breast cancer progression. The expression of miR-429 was reduced in breast cancer cells as observed by qRT-PCR (Figure 3B). In addition, the expressions of miR-429 and LINC00894 were negatively related in breast cancer tissues (Figure 3C). Starbase prediction identified closely matched sequences in miR-429 to both Exon-5 and Exon-7 of LINC00894 (Figure 3D). pGL3-LINC00894 wild type (Wt) and pGL3-LINC00894 Mut were constructed based on these binding sequences (Figure 3D). HEK293T cells displayed significantly downregulated luciferase activities following co-transfection with miR-429 mimics and LINC00894 Wt. However, these activities remained unchanged after the cells were co-transfected with miR-429 mimics and LINC00894 Mut (Figure 3E). RIP analysis was conducted to determine whether LINC00894 participated to form a ribonucleoprotein complex with RNAs. Results indicated that LINC00894 was more abundant in anti-AGO2 antibodies than in controls, which was similar to miR-429 (Figure 3F). Therefore, it can be speculated that LINC00894 binds to miR-429.
Figure 3
Direct interaction of LINC00894 with miR-429. (A) LINC00894 in AU565 and MCF-7 cells at cytoplasmic and nuclear levels using qRT-PCR. (B) MiR-429 expression in breast cancer tissues and adjacent non-cancerous tissues. (C) Correlation analysis of LINC00894 and miR-429 expressions in breast cancer. (D) Binding sequences of miR-429 and LINC00894. (E) Dual-luciferase reporter gene assay in HEK293T cells. (F) Amounts of LINC00894 and miR-429 in AU565 and MCF-7 cells in the RIP experiment.
Direct interaction of LINC00894 with miR-429. (A) LINC00894 in AU565 and MCF-7 cells at cytoplasmic and nuclear levels using qRT-PCR. (B) MiR-429 expression in breast cancer tissues and adjacent non-cancerous tissues. (C) Correlation analysis of LINC00894 and miR-429 expressions in breast cancer. (D) Binding sequences of miR-429 and LINC00894. (E) Dual-luciferase reporter gene assay in HEK293T cells. (F) Amounts of LINC00894 and miR-429 in AU565 and MCF-7 cells in the RIP experiment.
ZEB1 is a Target of miR-429 Regulated by LINC00894
To explore the potential roles of miR-429 in breast cancer progression, screening for the target gene of miR-429 via bioinformatics prediction resulted in the discovery of ZEB1, which was used for subsequent analyses (Figure 4A). miRNA negative control (miR-NC) or miR-429 mimics were selected to co-transfect the constructed luciferase plasmids (ZEB1 Mut and ZEB1 Wt) in HEK293T cells. Luciferase activity of the Mut reporter+ miR-429 mimics was unchanged, while that of Wt reporter+ miR-429 mimics group was repressed (Figure 4B). ZEB1 served as a candidate target of miR-429 according to the above results. qRT-PCR revealed a significant enhancement in the RNA levels of ZEB1 in breast cancer tissues versus normal tissue samples (Figure 4C). Additionally, increased protein levels of ZEB1 were observed in breast cancer tissues by Western blot analysis (Figure 4D). Moreover, the expression levels of miR-429 and ZEB1 were negatively correlated (Figure 4E). However, a positive correlation was observed between the expressions of ZEB1 and LINC00894 (Figure 4F).
Figure 4
ZEB1 was directly targeted by miR-429. (A) Assumed miRNA binding sites in ZEB1 sequence. (B) Dual-luciferase reporter gene assay. (C) Expression of ZEB1 in breast cancer and normal tissues. (D) Protein levels of ZEB1 in breast cancer tissues and non-cancerous tissues using Western blotting. (E) Correlation analysis of ZEB1 and miR-429 expressions in breast cancer. (F) Correlation analysis of LINC00894 and ZEB1 expression in breast cancer. All the data represent three individual experiments and are shown as mean ± SD.
ZEB1 was directly targeted by miR-429. (A) Assumed miRNA binding sites in ZEB1 sequence. (B) Dual-luciferase reporter gene assay. (C) Expression of ZEB1 in breast cancer and normal tissues. (D) Protein levels of ZEB1 in breast cancer tissues and non-cancerous tissues using Western blotting. (E) Correlation analysis of ZEB1 and miR-429 expressions in breast cancer. (F) Correlation analysis of LINC00894 and ZEB1 expression in breast cancer. All the data represent three individual experiments and are shown as mean ± SD.To determine whether LINC00894 regulates ZEB1 expression by targeting miR-429, we measured ZEB1 expression levels after adjusting the content of LINC00894 and miR-429. The transfection efficacy of miR-429 inhibitor and miR-429 mimic is shown in Figure 5A. Subsequently, upregulated ZEB1 expression was identified in AU565 cells following transfection with miR-429 inhibitor as indicated by both Western blotting and qRT-PCR. However, this effect was reversed after co-transfection with LINC00894 siRNA (Figure 5B). Additionally, inhibitory effects of ZEB1 expression were detected after transfection with miR-429 mimics in MCF-7 cells; these effects were reversed by co-transfection with the LINC00894 overexpression plasmid (Figure 5C). Next, the LINC00894 Wt overexpression plasmid and corresponding mutant overexpression plasmid were transfected in MCF-7 cells prior to determining ZEB1 expression levels. As indicated by Western blotting and qRT-PCR, overexpression of wild-type LINC00894 upregulated ZEB1 expression, whereas mutant-type LINC00894 did not (Figure 5D). In summary, LINC00894 directly binds to miR-429 to generate positive regulatory effects on ZEB1 expression.
Figure 5
LINC00894/miR-429 axis is key to ZEB1 expression. (A) Transfection efficiency of miR-429 inhibitor and miR-429 mimics. (B) RNA and protein levels of ZEB1 in AU565 cells after transfection with miR-429 inhibitor ± LINC00894 siRNA. (C) RNA and protein levels of ZEB1 in MCF-7 cells after transfection with miR-429 mimics ± LINC00894 OE plasmid. (D) RNA and protein levels of ZEB1 after transfection with LINC00894 Mut OE plasmid or LINC00894 wild type (Wt) OE plasmid. All the data represent three individual experiments and are shown as mean ± SD.
LINC00894/miR-429 axis is key to ZEB1 expression. (A) Transfection efficiency of miR-429 inhibitor and miR-429 mimics. (B) RNA and protein levels of ZEB1 in AU565 cells after transfection with miR-429 inhibitor ± LINC00894 siRNA. (C) RNA and protein levels of ZEB1 in MCF-7 cells after transfection with miR-429 mimics ± LINC00894 OE plasmid. (D) RNA and protein levels of ZEB1 after transfection with LINC00894 Mut OE plasmid or LINC00894 wild type (Wt) OE plasmid. All the data represent three individual experiments and are shown as mean ± SD.
LINC00894/miR-429 Axis Regulates the Behavior of Breast Cancer Cells
The present study determined whether miR-429 had an impact on the proliferation and invasion abilities of AU565 and MCF-7 cells. The proliferation and invasion abilities were remarkably enhanced via downregulation of miR-429 in AU565 cells versus those of controls, which was partially reversed by LINC00894 siRNA treatment (Figure 6A–D). In contrast, overexpression of miR-429 restrained the proliferative and invasive abilities of MCF-7 cells, and the overexpression was partially reversed by overexpressed LINC00894 (Figure 6A–D).
Figure 6
LINC00894/miR-429 axis regulates behaviors of breast cancer cells. (A) Proliferative abilities of AU565 and MCF-7 cells in a CCK-8 assay. (B) Proliferative abilities of AU565 and MCF-7 cells in an EdU assay. (C) Proliferative abilities of AU565 and MCF-7 cells in a colony formation experiment. (D) Invasion by cells following alteration of AU565 and MCF-7 cell lines in different transfection experiments. All the data represent three individual experiments and are reported as mean ± SD.
LINC00894/miR-429 axis regulates behaviors of breast cancer cells. (A) Proliferative abilities of AU565 and MCF-7 cells in a CCK-8 assay. (B) Proliferative abilities of AU565 and MCF-7 cells in an EdU assay. (C) Proliferative abilities of AU565 and MCF-7 cells in a colony formation experiment. (D) Invasion by cells following alteration of AU565 and MCF-7 cell lines in different transfection experiments. All the data represent three individual experiments and are reported as mean ± SD.
Downregulation of LINC00894 Inhibits Breast Cancer Tumor Growth and Migration in vivo
A tumor formation assay revealed that tumor growth in vivo was suppressed by LINC00894 downregulation and that AU565 cells transduced with sh-LINC00894 grew at a slower rate after implantation in mice (Figure 7A). In addition, the average volume and weight of xenografts obtained from sh-LINC00894 transduced cells were markedly lower than those obtained from sh-NC cells (Figure 7B and C). Images of pulmonary metastatic tumors and their stained sections are shown in Figure 7D. The number of lung metastatic nodules was observed to be decreased in the LINC00894 shRNA group. As shown in Figure 7E and F, the results indicated that knockdown of LINC00894 increased miR-429 expression and decreased ZEB1 expression in pulmonary metastatic tumors. Taken together, the above findings indicated that LINC00894 shRNA inhibited the growth and migration of breast cancer tumors in vivo.
Figure 7
LINC00894 regulates breast cancer in vivo. (A) Xenograft tumors (n=3 in each group). (B) Tumor volumes in both LINC00894 knockdown and control groups measured at one-week intervals. (C) Tumor weights measured after tumor dissection. (D) Images of pulmonary metastatic tumors and their stained sections. (E, F) The expressions of miR-429 (E) and ZEB1 (F) in pulmonary metastatic tumors.
LINC00894 regulates breast cancer in vivo. (A) Xenograft tumors (n=3 in each group). (B) Tumor volumes in both LINC00894 knockdown and control groups measured at one-week intervals. (C) Tumor weights measured after tumor dissection. (D) Images of pulmonary metastatic tumors and their stained sections. (E, F) The expressions of miR-429 (E) and ZEB1 (F) in pulmonary metastatic tumors.
Discussion
Despite dramatic advances in cancer research, breast cancer remains a major health problem worldwide.16,17 lncRNAs are reported to function as regulatory factors in many cellular processes,18 and dysregulation of lncRNAs is known to be associated with the development of diseases19,20 such as Parkinson’s disease,21 pancreatic cancer,22 and Alzheimer’s disease.23 Moreover, it was demonstrated that several lncRNAs, including lncRNA-ATB,24 DSCAM-AS1,25 and lncRNA BCAR4,26 participated in the occurrence and progression of breast cancer. These studies suggested that lncRNAs may be crucial in the initiation and progression of breast cancer. Therefore, further investigation of the biofunctions and molecular mechanisms underlying the role of lncRNAs in breast cancer may facilitate the development of new target molecules for breast cancer treatment.Therefore, an lncRNA microarray was performed to analyze lncRNA expression in breast cancer tissues, and LINC00894 was found to be highly expressed in breast cancer tissues. Subsequently, LINC00894 was shown to promote the proliferative and invasive capacities of AU565 and MCF-7 cells using CCK-8, EdU, and transwell assays. The tumor xenograft model and lung metastasis assay were utilized to verify the effects of LINC00894 on breast cancer. It was demonstrated that tumor growth and metastasis were suppressed by LINC00894 knockdown in AU565 cells. Therefore, investigating the effects of LINC00894 on the proliferation and invasion inhibition of breast cancer cells is important for further studies on the occurrence, progression and metastasis of breast cancer.LncRNAs may bind to miRNAs and regulate their functions.27,28 miRNAs (18–22 nucleotides) are a class of non-coding RNAs, and various pathophysiological processes may be regulated by miRNAs, including inflammation and cancer.29–31 miRNAs could negatively regulate the expression levels of other non-coding transcripts and protein coding genes, and are involved in the post-transcriptional modulation of several genes.32,33 In our study, miR-429 bound to LINC00894 and was expressed at low levels in breast cancer cell lines. Importantly, in cell function assays, proliferation and invasion abilities of breast cancer cells were limited by overexpressed miR-429; however, the effects of miR-429 mimics were partially reversed by LINC00894 overexpression. Besides, miR-429 was reported to inhibit the pathological processes of cancers.34,35 For instance, miR-429 was shown to inhibit the invasion and migration of breast cancer cells.36 Thus, LINC00894 and miR-429 may contribute to the initiation and progression of breast cancer.Next, we confirmed that ZEB1 was a downstream target of miR-429 and that LINC00894 adjusted the expression of ZEB1 by competitively binding miR-429. ZEB1, as an epithelial mesenchymal transition (EMT) regulator, together with the EMT associated molecules such as SNAIL, SLUG, and TWIST, participates in multiple biological processes related to malignancy such as invasion and metastasis.37,38 Besides, ZEB1 is also closely related to hypoxia and chemoresistance of tumors.39,40 Meanwhile, it has been proven that ZEB1 can promote the pathophysiological process of tumors, including that of breast cancer.41–43Taken together, LINC00894 is a competitive endogenous RNA that plays an important role in regulating the expression of ZEB1 by sponging miR-429 to regulate breast cancer progression.
Authors: Sabine Loewer; Moran N Cabili; Mitchell Guttman; Yuin-Han Loh; Kelly Thomas; In Hyun Park; Manuel Garber; Matthew Curran; Tamer Onder; Suneet Agarwal; Philip D Manos; Sumon Datta; Eric S Lander; Thorsten M Schlaeger; George Q Daley; John L Rinn Journal: Nat Genet Date: 2010-11-07 Impact factor: 38.330
Authors: Marie Chas; Caroline Goupille; Flavie Arbion; Philippe Bougnoux; Michelle Pinault; Marie Lise Jourdan; Stephan Chevalier; Lobna Ouldamer Journal: Breast Date: 2019-04-01 Impact factor: 4.380
Authors: Li Duguang; He Jin; Qian Xiaowei; Xu Peng; Wang Xiaodong; Li Zhennan; Qian Jianjun; Yao Jie Journal: Cancer Biol Ther Date: 2017-11-27 Impact factor: 4.742