cydA, spdC, and mroQ are novel genes involved in the plasma coagulation of Staphylococcus aureus.

Coagulation is a critical pathogenic process in Staphylococcus aureus. Although the agglutination of S. aureus has been studied for a long time, the genes involved in this process are not completely clear. We performed tube agglutination and dynamic turbidimetry tests to identify novel genes involved in reduced plasma coagulation. A total of 15 genes were identified, including coa, clfA, vwbp, saeS, agrA, trpC, spdC, mroQ, cydA, qoxC, sucC, pyrP, menH, threonine aldolase, and truncated transposase for IS1272. The functions of these genes include bicomponent regulation, membrane transport, energy metabolism and biosynthesis, respectively. cydA, spdC, and mroQ genes were further studied by gene knockout and complementation. Results of gene knockout and complementation and real-time-qPCR proved that cydA, spdC, and mroQ genes are necessary for plasma coagulation. Furthermore, the survival ability of 7 day mice decreased significantly when cydA, spdC, and mroQ genes had been knocked out.

clumping factor A

dynamic turbidimetry test

tube coagulase test

tryptic soy agar

tryptic soy broth

von Willebrand factor–binding protein

INTRODUCTION

Staphylococcus aureus is an important bacterial pathogen that causes both local and severe systemic infections, such as skin and soft tissue infection, endocarditis, osteomyelitis, and sepsis. , Many virulence factors produced by S. aureus, such as coagulase, surface adhesive protein, and leukocidin assist in mediating the pathogenicity of S. aureus infections, and these are associated with different pathogenic mechanisms. For example, coagulase acts as a mechanical barrier to antagonize leukocyte phagocytosis by promoting plasma hemagglutination. S. aureus secretes two kinds of coagulases, free coagulase  and bound coagulase (von Willebrand factor–binding protein [vwbp]). The free coagulase promotes agglutination of blood cells and plasma, forming the inner core of the coated vesicles, whereas the bound coagulase forms the outer fiber network and cleaves the alpha and beta chains of fibrinogen. With the help of clumping factor A (clfA), S. aureus combines with the specific sites of soluble fibrin‐forming complexes to protect S. aureus against immune clearance. Previous studies have revealed that the lack of clfa gene in S. aureus assists in relieving the symptoms of invasive arthritis, but no effect was observed when the ClfA antibody is used for treating staphylococcal sepsis. This led to the confirmation that abscess formation is repressed when S. aureus lacks free coagulase or vWbp, and the ability is further restricted when both of these are absent. Recent studies also confirmed that thickened cell wall could reduce plasma agglutination in S. aureus, which is probably a result of the inhibition of exocrinosity of plasma coagulase. As described earlier, there might be some undetected genes involved in the formation of agglutination, except for some of the widely known genes such as coa, vwbp, and clfA.

To further investigate the genes in the coagulation process, the procoagulant genes were screened genomewide for the first time. We also constructed and screened a transposon library of S. aureus to identify novel genes involved in the agglutination process.

MATERIALS AND METHODS

Bacterial strains, plasmids, antibiotics, and growth conditions

The Escherichia coli strain DH5α (TIANGEN Biotech Co., Ltd, Beijing, China) and the S. aureus strain RN4220 were used for DNA cloning. We used the S. aureus Newman strain as the parent strain for screening. Plasmids of pID408, pRB473, pRAB11, and pKOR1 were used for constructing the transposon library, genetic complementation, and homologous recombination. , , Antibiotics with the following concentrations were used unless otherwise indicated: erythromycin, 20 μg/mL; ampicillin, 100 μg/mL; and chloramphenicol, 20 μg/mL (Solarbio C8050; Biotech Co., Ltd, Shanghai, China). Tryptic soy agar (TSA) and tryptic soy broth (TSB) were used for culturing E. coli and S. aureus, respectively.

Construction of transposon mutant library

S. aureus transposon mutant library was constructed as follows: first, we prepared the S. aureus strains RN4220 and Newman from the log phase of the cultures grown in TSB, followed by collection of bacterial cells by centrifugation at 5000 g/min. Competent cells were then acquired by washing the bacterial cells three times with sucrose; next, the temperature‐sensitive plasmid pID408 containing the transposon Tn917 was successively transformed into S. aureus strains RN4220 and Newman competent cells by electroporation (diameter of electrode cup = 0.2 cm, voltage = 2.5 kV, resistance = 100 Ω, capacitance= 25 µF) using Gene Pulser Xcell (BioRad). After resuscitation, the cells were spread on TSA plates (20 µg/mL erythromycin, 20 µg/mL chloramphenicol) and then incubated at 30°C. The Newman strain containing pID408 plasmid was cultured at 43°C, followed by shaking in an incubator at 250 rpm (875 g/min) for 18 h to induce transposon insertion. These induced clones were collected and incubated on TSA plates containing 20 µg/mL erythromycin with or without 20 µg/mL chloramphenicol. The transposon mutants were unable to survive on plates containing chloramphenicol because of missing pID408. The transposon mutagenesis bias was tested by inverse PCR and all the PCR products were confirmed by gene sequencing. Finally, about 10,000 mutant clones were picked and cultured in TSB and stored as transposon mutant library at –80°C until use.

Tube coagulase test

The mutant S. aureus Newman strain was grown on plates containing 5% sheep blood (Kemajia Microbe Technology Co., Ltd) at 37°C for 24 h. Each colony was cultured in TSB (10 mL) at 37°C for 24 h. The S. aureus culture was centrifuged at 6000g for 30 min, the supernatant was discarded, and the pellet was resuspended in sterile normal saline to 4.0 McFarland units.

The tube coagulase test (TCT) was performed using 50 μL bacterial suspension and 450 μL mixed citrate plasma from healthy volunteers (no obvious hemolysis and jaundice) in small plastic tubes (13 mm diameter), followed by incubation of the tubes at 37°C after gentle mixing. After that, clot formation was examined every hour for direct and pelleted TCT at 35°C and 16 h after incubation at room temperature. An opaque clot was identified as a positive result.

Dynamic turbidimetry test

The bacterial suspension was prepared as described above. The dynamic turbidimetry test (DTT) was performed in a 96 well plate with 10 μL of bacterial suspension and 90 μL of mixed citrate plasma from healthy volunteers (with no obvious hemolysis and jaundice). The agglutination reaction was detected using the reactive system (ELx808 enzyme labeling instrument; Berton Instruments Co., Ltd) at 37°C and 340 nm OD. Agglutination was evaluated every minute according to the instrument settings. Positive DTT results were identified if the OD340 value was greater than 0.05 when compared with the initial results.

Identification of mutated genes

The transposon insertion sites were confirmed by detecting the resistance markers. First, each mutant's overnight grown culture with reduced coagulating ability in LB broth was lysed in a lysis buffer (Sangon Biotech Co., Ltd), followed by extraction of bacterial DNA by alkaline lysis (TIANGEN Biotech Co., Ltd). Next, EcoRI was used to digest the genome at 37°C for 12 h, and T4 DNA ligase was used to ligate the target fragment was transformed in the E. coli DH5α strain (TIANGEN Biotech Co., Ltd) by chemical transfection. The self‐ligated fragments of plasmid on TSA plates containing 20 µg/mL ampicillin were screened and collected. S. aureus genome containing new plasmids was sequenced by designing primers based on the proximal repeat regions of the erythromycin‐resistance gene Tn917. The sequencing results were compared with those of the standard sequence of the S. aureus Newman strain, and the transposon insertion site was recognized to determine whether specific genes were involved in plasma agglutination.

Gene knockout and complementation

Furthermore, the pKOR1 plasmid was used to knockout the candidate genes associated with decreased ability to coagulate by homologous recombination as described previously. CydA was amplified (primers used: cydA‐UF, cydA‐UR; cyd A‐DF, cydA‐DR, shown in Table 1) and cloned into the plasmid pKOR1. The recombinant knockout plasmid was transformed into RN4220 and then into the S. aureus Newman strain. Next, homologous recombination was carried out by a two‐step procedure. In the first step, the plasmid was integrated into the chromosome of S. aureus by the selective pressure of high temperature (42°C) and 10 μg/mL chloramphenicol. In the second step, the culture was streaked on the plates containing 1 μg/mL anhydrotetracycline (20150831; National Institutes for Food and Drug Control, China) to select cydA knockout mutant strains. The correct knockout strain was then verified by PCR amplification and subsequent sequencing. The candidate gene and its upstream promoters were amplified using cydA‐IF and cydA‐IR primers. The restriction endonucleases XbaI and KpnI were used to cleave the plasmid pRB473 and the PCR‐amplified product. Except for the complementary plasmid pRAB11, the knockout technique for spdC and mroQ was similar to that of the cydA gene. Detailed primer sequences and restriction sites are shown in Table 1.

Table 1

PCR primers used in this study

Primer name	Sequence (5′–3′)	Endonuclease site
cydA‐UF	GGGGACAAGTTTGTACAAAAAAGCAGGCTGACCAAATGCCTACAG
cydA‐UR	GCTATTGAACCTGGTATTATTAGAATAAAGCACGAAG
cydA‐DF	CTTCGTGCTTTATTCTAATAATACCAGGTTCAATAGC
cydA‐DR	GGGGACCACTTTGTACAAGAAAGCTGGGTTTCTTTACCCATACTCG
cydA‐IF	CAGTTCATTGTGTTGTCATC
cydA‐IR	TTATAACACTGTTATACC
pRB473‐cydA‐F	TGCTCTAGAGCATGGACAATCATTCTGCGT	XbaI
pRB473‐cydA‐R	CGGGGTACCCCGACCTGCCCCAAAATCTAT	KpnI
spdC‐FF	GGGGACAAGTTTGTACAAAAAAGCAGGCGATTGTTGTTCAGCACGTGT
spdC‐FR	TACTAGCAAGCGCTTTGTTATATATGTAACCTCCATTAGGT
spdC‐RF	ACCTAATGGAGGTTACATATATAACAAAGCGCTTGCTAGTA
spdC‐RR	GGGGACCACTTTGTACAAGAAAGCTGGGTGATTACATAAATATGGGAGGC
spdC‐IF	TTGGTTCACCTTGCTTGTA
spdC‐IR	GACATGACGCTGGGAATT
spdC‐PF	CGGGGTACCTATTTTGCTTGTTACCTAATGGAGG	KpnI
spdC‐PR	CGCGAGCTCCTTTGTTATTATTTGTTTTTATCTG	SacI
MroQ‐FF	GGGGACAAGTTTGTACAAAAAAGCAGGCAGCCTTCTTGAATCATTGC
MroQ‐FR	ATTCGCTTGTTCCGTGGCGATGCCCATAATCTTGTCAT
MroQ‐RF	ATGACAAGATTATGGGCATCGCCACGGAACAAGCGAAT
MroQ‐RR	GGGGACCACTTTGTACAAGAAAGCTGGGTCGAATAATGTGAAGCCAGACT
MroQ‐IF	TTAATAGGCGTCCAGTTCC
MroQ‐IR	TAATCAAGGTCAATGGCAAC
MroQ‐PF	CGGGGTACCACGATAAAATAAATTATAAACAAA	KpnI
MroQ‐PR	CGCGAGCTCCATGCTATTCTTATTTGTAAAGCGAAATAAAAA	SacI

Note: Underline is the endonuclease site.

Real‐time qPCR

Real‐time (RT)‐qPCR was used to assess the expression of cydA, coa, vwbp, and clfA, and gyrB was used as the reference gene. The S. aureus Newman wild‐type, cydA knockout, and cydA complementary strains were incubated overnight in TSB at 37°C for 8 h. The obtained cultures were then centrifuged and washed two times with PBS. RNA isolation was performed according to the manufacturer's instructions (Sangon Biotech Co., Ltd). The primers were designed using the primer express software (Version 2.0, Applied Biosystems). After that, reverse transcription was performed using Super‐Script III First‐Strand Synthesis (Takara Bio). RT‐qPCR was performed using SYBR Premix Ex Taq II (Takara Bio). The amplicon of gyrB gene was used as an internal control. The PCR conditions were as follows: 95°C for 30 s, followed by 40 cycles at 95°C for 5 s, and 60°C for 30 s. The relative expression levels were determined by the comparative threshold cycle (2–ΔΔ ) method. All primers are listed in Table 1.

Growth ability tests

In order to observe whether the decrease of plasma agglutination ability of cydA, spdC, and mroQ is due to the low number of strains, we cultured mutant, complementary, and wild‐type strains of cydA, spdC, and mroQ overnight to compare the growth ability. The detailed steps are as follows: the bacteria were cultured overnight at 37°C and diluted into the fresh TSB medium at 1:50, shaken, and cultured on the shaker at 37℃. Then, 100 μL bacteria were taken every 1 h to measure OD600 within a 12 h period. The experiment was repeated three times.

Survival tests

In order to understand whether the decreased plasma agglutination abilities of cydA, spdC, and mroQ mutations affect the virulence of the strain, the mouse systemic infection test was performed. The wild‐type, mutant, and complementary strains of cydA, spdC, and mroQ genes in logarithmic growth phase were cultured and harvested. The precipitate was then centrifuged at 400 g/min and washed with PBS three times. Finally, 1 × 107 CFU of bacteria were injected into the tail vein of 4–6 weeks' old mice, and PBS was used as control. The death status of mice was observed within 7 days.

Statistical analysis

SPSS (version 17.0; IBM, New York, New York) was used for statistical analysis. The dynamic agglutination values of different genes were expressed as mean ± SD. RT‐qPCR expression of normal genes and their knockout or complementary strains were compared using the chi‐square test.

RESULTS

Construction of transposon library and screening of clones with reduced capacity of plasma agglutination and functional analysis of insertion genes

The transposon library was constructed using the Tn917 transposon located in pID408. DTT and TCT identified the clones that had disappeared or decreased agglutinating ability. About 10,000 clones were collected, of which 157 showed decreased or disappeared agglutinating ability. Some gene mutants (such as NWMN_1282, NWMN_1228, and NWMN_0756) had decreased agglutination ability, whereas in 12 gene mutants (such as NWMN_0674, NWMN_0166, NWMN_0952, NWMN_2236, NWMN_1939, NWMN_0928, NWMN_1946, NWMN_1319, NWMN_1155, NWMN_1110, NWMN_0914, and NWMN_0757) agglutination ability disappeared. The detailed results are presented in Figure 1. All well‐known genes involved in plasma agglutination, such as coa, vwbp, and clfA, had been identified. Two‐component regulatory system genes, biosynthesis genes, energy producing genes, and surface protein synthesis gene had also been identified. These genes involved in plasma coagulation are shown in Figure 2 and Table 2.

Figure 1

(a) The bacterial suspension was mixed with citrate plasma obtained from healthy volunteers (i.e. those with no obvious hemolysis and jaundice). The reactive system detected the agglutination reaction at 37°C and 340 nm OD. The agglutination reaction was evaluated every minute according to the instrument settings. Negative DTT results were identified if the OD340 value was less than 0.05 when compared with the initial results at 2 h. Decreased agglutination ability was observed when the OD340 value was above 0.05, and was significantly lower than that of the wild‐type strain. (b) A total of 15 genes that showed association with plasma agglutination promotion in Staphylococcus aureus were screened, which included 3 genes related to decreased agglutination and 12 responsible for disappearance of agglutination. The experiments were performed with three biologically independent samples. Error bars were presented as means ± SD. **p < .001 [Color figure can be viewed at wileyonlinelibrary.com]

Figure 2

The proposed pathways involved in promoting plasma agglutination of novel genes in Staphylococcus aureus

Table 2

The biological information of the mutated genes

Quantity	Agglutinant ability	Located gene	Predictive function
12	Disappeared	NWMN_0674	Sensor histidine kinase, SaeS
10	Disappeared	NWMN_0166	Coagulase, coa
16	Disappeared	NWMN_0952	Ubiquinone cytochrome reductase subunit I, cydA
8	Decreased	NWMN_1282	Indole‐3‐glycerol synthase, trpC
1	Decreased	NWMN_1228	Threonine aldolase
14	Disappeared	NWMN_2236	Surface protein display C, spdC
13	Disappeared	NWMN_1939	Membrane‐embedded CAAX protease, mroQ
4	Disappeared	NWMN_0928	Quinol oxidase polypeptide III, qoxC
5	Disappeared	NWMN_1946	Accessory gene regulator protein A, agrA
10	Disappeared	NWMN_1319	Truncated transposase for IS1272
6	Disappeared	NWMN_1155	Succinyl‐CoA synthetase, sucC
6	Disappeared	NWMN_1110	Uracil permease, pyrP
8	Disappeared	NWMN_0914	Hydrolase fold family, menH
4	Decreased	NWMN_0756	Clumping factor A, clfA
1	Disappeared	NWMN_0757	von Willebrand factor–binding protein (vwbp)

Importance of cydA, spdC, and mroQ genes in plasma coagulation

To validate the transposon library results and further characterize the role of identified genes in plasma coagulation, the most frequently identified genes, cydA, spdC, and mroQ genes, were selected for further study. The agglutinating abilities of knockout strains for cydA, spdC, and mroQ were similar to the mutants of cydA, spdC, and mroQ. This further proved that cydA, spdC, and mroQ genes are involved in the agglutination process of S. aureus. However, the results of complementary strains showed some discrepancies. The agglutinating abilities of spdC and mroQ complementary strains were restored, but not those of cydA (Figures 3 and 4). The RT‐qPCR results revealed that the expression level of cydA in the complementary strain was much higher than that of the wild‐type strain (Figure S1), which suggested that the expression of cydA itself might have no contribution to agglutination. We also found that the expressions of coa, vWbp, and clfA were significantly inhibited when the function of cydA was lost (Figure S2), indicating that the cydA mutant may present decreased agglutination ability by affecting the expression of other agglutination‐associated genes.

Figure 3

The CydA gene is necessary for plasma coagulation. (a) Tube plasma agglutination test proved that the Staphylococcus aureus Newman wild‐type strain had plasma agglutination ability, but the CydA mutant, cydA knockout, and cydA complementary strains had no plasma agglutinating ability. (b) The results of dynamic turbidimetry also proved that the S. aureus Newman wild‐type strain had plasma agglutination ability, but the cydA mutant, cydA knockout, and cydA complementary strains showed no change in the OD value [Color figure can be viewed at wileyonlinelibrary.com]

Figure 4

SpdC and mroQ genes are necessary for plasma coagulation. (a, c) Tube plasma agglutination test proved that the Staphylococcus aureus Newman wild‐type strain and the SpdC or mroQ complementary strain had plasma agglutinating ability. (b, d) The results of DTT also proved that the SpdC or mroQ mutant strain and the SpdC or mroQ knockout strain demonstrated no change in the OD value [Color figure can be viewed at wileyonlinelibrary.com]

Impact of cydA, spdC, and mroQ on the bacteria growth and survival ability

To further understand the effects of cydA, spdC, and mroQ on plasma agglutination, we performed a growth rate and survival test. Our results showed that cydA, spdC, and mroQ gene detentions did not affect bacterial growth ability, and the growth status was the same as that of the wild‐type strain within 12 h (Figure S3). Furthermore, the systemic infectious tests showed that deletion of the three genes could significantly improve mice's survival ability, and so the pathogenicity of the mutant strains was significantly reduced (Figure S4).

DISCUSSION

Agglutination is considered a vital factor in S. aureus pathogenicity and is associated with infections at various sites. Investigation into the detailed coagulation mechanism can benefit the development of novel therapeutic strategies. In this study, we screened the S. aureus Newman mutant library and identified 15 genes, among which 7 were reported previously and 7 were not reported. The functions of the seven novel genes included biosynthesis, energy metabolism, surface proteins, and the insertion of sequences. To further understand these genes, we focused on cydA, spdC, and mroQ genes by constructing new knockout mutants and complementary strains. Our results proved that the freshly constructed cydA, spdC, and mroQ knockout mutants also similarly decreased plasma coagulation while the growth ability remained unchanged. Our results also demonstrated that these genes were indeed involved in promoting plasma coagulation by adopting gene complementary tests, and plasma coagulation was important risk factor for mice survive by adopting mice survival tests.

The cyd gene consists of cydA and cydB, and encodes ubiquinone cytochrome oxidase in the bacterial electron transfer chain. Few studies suggest that electron transfer is involved in coagulase production, although the genes associated with energy production may affect the expression of virulence factors. , Energy metabolism inevitably changed the intracellular c‐di‐AMP concentration, an important secondary messenger related to the expression of virulence factors. cydA‐deleted transcriptome sequencing results obtained in this study showed that the expression of saeRS in cydA‐deleted strains was at least five times lower than that observed in the Newman wild‐type strains (data not shown). Furthermore, the known plasma‐agglutinating functional genes under the control of saeRS, such as coa, vwbp, and clfA, showed significant downregulation (data not shown). Our results also showed that cydA complementary strains did not restore plasma agglutination. This can be explained as follows: the cyd gene is a four‐subunit structure with a long nucleotide distance, and therefore, it is difficult to electroporate all the nucleotide sequences that encode the cyd gene into engineering plasmid strains. As a result, the cydA mutant used in this study did not express the cydB gene, as the cydA gene alone could not complement the phenotype. spdC encodes abortive infection protein and can control histidine kinase involved in signal transduction. In this study, the plasma coagulation function was not observed when the spdC function was diminished. WalKR, a two‐component system, is mainly involved in controlling cell wall metabolism, which could positively regulate spdC through regulation of autolysin production. At the same time, spdC could have a negative effect on WalKR regulon genes, thus synergistically regulating downstream virulence genes. The coding product of mroQ is membrane‐embedded CAAX protease, which belongs to the M79 protease‐family protein. With the knockout of this gene, the plasma agglutination ability is lost. The possible mechanism involves hydrolysis of auto‐inducing peptide by mroQ coding synthase, resulting in the inactivation of agrC. This subsequently inactivated the function of downstream RNAII and RNAIII, and the regulated genes, including coagulase, showed no expression. ,

In summary, we found that cydA, spdC, and mroQ genes were associated with plasma coagulation of S. aureus. The findings of this study provide insights into the agglutinating mechanisms of S. aureus and offer new targets for the prevention of S. aureus infections.

DISCLOSURE

The authors declare that there are no conflicts of interests.

Supplementary information.

Click here for additional data file.